[CANCER RESEARCH 53, 5108-5112. November 1. 1993] Advances in Brief Fusion of PAX3 to a Member of the Forkhead Family of Transcription Factors in Human Alveolar Rhabdomyosarcoma1 David N. Shapiro,2 Jack E. Sublett, Baitao Li, James R. Downing, and Clayton W. Naeve Departments of Experimental Oncology /I). N. S., J. E. S., B. L.¡.Hcmatology/Oncology ¡D.N. S./, Pathology [J. R. D.¡, Tumor Cell Biology /J. R. D./, anil Virology and Molecular Biology fC. W. N.¡,St. Jude Children's Research Hospital. Memphis. Tennessee 38105, and Departments of Pediatrics [D. N. S.¡and Pathology /./. R. D.. C. W. N.J, University of Tennessee College of Medicine. Memphis. Tennessee 38163 Abstract alveolar rhabdomyosarcoma and show that this rearrangement results in the creation of a chimeric fusion gene composed of 5' PAX3 Alveolar rhabdomyosarcoma, a malignant tumor of skeletal muscle, is sequences juxtaposed to 3' sequences derived from a previously un- characterized by a chromosomal translocation, t(2;13)(q35;ql4). This described member of the forkhead family of transcription factors, translocation Is associated with a structural rearrangement of the gene provisionally designated ALV (7). In PAX3-ALV, the putative 3' tran encoding /' 1 \ ¡.a presumed transcriptional regulator expressed exclu sively during embryogenesis. The breakpoint results in a fusion between scriptional activation domain of PAX3 is replaced by the bisected PAX3 and a gene provisionally named ALV, a novel member of the fork- forkhead binding domain of ALV, while retaining the structural integ head family of transcription factors. In PAX3-ALV, the structural integrity rity of the PAX3 paired box and homeodomain. Thus the chimeric of both /' l \ i DNA-binding regions, the paired box and homeodomain, are protein product of this translocation has the potential to promote retained while the putative transcriptional activation domain of PAXÃŒis tumorigenesis by acting as an aberrant transcription factor, consistent replaced by the bisected forkhead DNA-binding domain of ALV. Forma with the molecular abnormalities in other solid tumor and several tion of chimeric transcription factors has now been implicated in diverse leukemia-associated rearrangements. human tumors of myogenic, hematopoietic, neuroectodermal, and adipo- cytic origin, suggesting that transcriptional deregulation is a common Materials and Methods mechanism of tumorigenesis. Cell Lines. Alveolar rhabdomyosarcoma cell lines containing the (2;13) Introduction translocation are RH3, RH4, RH5, RH18, RH28, and RH30. Some have Malignant transformation occurs because of the accumulation of previously been reported as case 5 (RH3), case 11 (RH4), case 3 (RH18), case 4 (RH28), and case 13 (RH30) (8). Control cell lines without this tumor- somatic mutations, often made apparent cytogenetically by the acqui sition of tumor-specific chromosomal translocations. Two frequent specific translocation include the embryonal rhabdomyosarcoma cell RH1 [previously referred to as BG (9)] as well as the Ewing sarcoma cell line EWS consequences of these chromosomal events, which have been most 3. All cell lines were grown in RPMI 1640 supplemented with 10% fetal calf thoroughly studied in hematopoietic malignancies, are oncogene ac serum and 50 /xg/ml gentamicin. tivation or the creation of a novel oncogenic fusion protein. There is RNA Analysis. Total cellular RNA was isolated from the indicated cells less information available regarding the genes involved in specific and fractionated in a 1% agarose-formaldehyde gel. After electrophoresis, the translocations of solid tumors. This situation results in part from the RNA was transferred to Duralon-UV nylon filters (Stratagene, La Jolla, CA), technically more challenging task of obtaining conventional cytoge- UV-cross-linked, and sequentially hybridized to ^-P-labeled probes as de netic analyses from these neoplasms. Nevertheless, recurrent chromo scribed in Fig. 1. Autoradiography was for 96 h (Fig. \A) or 48 h (Fig. Iß)at -70°C. The size of mRNA was estimated using a RNA ladder (GIBCO BRL, somal translocations have been observed in some solid tumors, par Gaithersburg. MD). ticularly sarcomas. Recently, the translocation breakpoints in both cDNA Cloning. Separate Agt22AcDNA1 libraries were prepared with 2 /ng Ewing sarcoma and myxoid liposarcoma have been molecularly de of polyadenylated mRNA from the RH18 and RH30 alveolar rhabdomyosar fined and chimeric fusion genes with the properties of transcriptional coma cell lines using oligodeoxythymidylale primers with a GIBCO BRL regulators have been identified in each case (1, 2). Superscript cDNA synthesis kit. Sized and adapted inserts were directionally The molecular basis of the t(2;13)(q35;ql4) in alveolar rhabdomyo- cloned in the Àvector with a Sail adapter. Libraries were screened with a sarcoma, a malignant tumor derived from skeletal muscle precursors, full-length murine Pax-3 cDNA probe under conditions of normal stringency. has been shown to consistently involve a rearrangement of the 5' Positive A clones were plaque purified and the inserts were cloned into Noti/ portion of the PAX3 gene on chromosome 2q35 (3). These studies .SV;/I-digcsted pBlucscripl SK+ (Stratagene). demonstrated that both regions of the PAX3 gene with DNA-binding Inserts from positive clones from both cell lines were subcloned into activity, the paired box and the paired-type homeodomain, are juxta M13mpl8 and cycle sequencing reactions performed using Prism chemistry posed to previously uncharacterized sequences on chromosome 13ql4 (Applied Biosystems. Inc., Foster City, CA) and protocols recommended by the manufacturer. Samples were electrophoresed, detected, and analyzed on an (4). The involvement of PAX3 in the t(2;13) is of interest not only AB1 373 DNA sequencer. Analysis of the completed consensus nucleic acid because of its role as a presumed transcriptional regulator during early and peptide sequences was performed using the Intelligenetics and GCG soft neuromuscular differentiation but also in the context of the recently ware packages as well as BLAST algorithms. ALV cDNA clones were also demonstrated oncogenic potential of several murine Pax genes, in isolated from a cell line without the t(2;13) by screening the UOCB-1 pre-B cluding Pax-3 (5, 6). We now describe an analysis of the t(2;13) in cell ALL cDNA library in AZAP. Rescued phagemid DNA containing ALV inserts was subcloned into M13 prior to sequencing. Received 9/29/93; accepted 10/1/93. PCR Analysis. To verify the PAX3-ALV fusion mRNA, amplification was The cosls of publication of this article were defrayed in part by the payment of page carried out with primers corresponding to positions 1137 to 1158 (forward charges. This article must therefore be hereby marked advertisement in accordance with primer) in PAX3 and positions 1474 to 1495 (reverse primer) in ALV in 18 U.S.C. Section 1734 solely to indicate this fact. 1Supported in part by Grant CA-23099 and Cancer Center CORE Grant CA-21765 reactions containing approximately 10 ng of target cDNA. The amplification from the NIH and by the American Lebanese Syrian Associated Charities (ALSAC). 2 To whom requests for reprints should he addressed, at the Department of Experi mental Oncology. St. Jude Children's Research Hospital. 332 North Lauderdale. Mem 1The abbreviations used are: cDNA, complementary DNA; ALL, acute lymphohlas- phis, TN 38105. toid leukemia: PCR. polymerase chain reaction. 51 OS Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 1993 American Association for Cancer Research. mX3 AND FORKHEAD IN ALVEOLAR RHABDOMYOSARCOMA MTTLAOAVPHMMRPGP 10 CACCTQQATATAATTTCCQAQCQAAQTQCCCCCAQQATQACCACOCTQOCCQQCQCTOTOCCCAOOATQATQCQOCCOQQCCCQ 84 QQNYPRSQFPLEVSTPLQOQRVNQLQQV 44 QQQCAQAACTACCCQCOTAQCQQQTTCCCQCTQQAAQTQTCCACTCCCCTCQOCCAQQQCCQCQTCAACCAQCTCQQCOQCQTT 168 F VEMA G PCV T TTAINQRPLPNHIRHKTCAACQQCAQQCCOCTQCCCAACCACATCCQCCACAAQAI TCQTQQAQATQQCCCH ACCH ACQQC AITCRCOQCCCTQCOTCA1 TC72252 S l R P O A 100 ;ATACOTCCTQOTOCC 336 IGGSKPKOVTTPDVEKKIEEYKRENPGM 128 ATCQQCQQCAQCAAQCCCAAaCAQGTGACAACQCCTQACQTOGAGAAQAAAATTaAGQAATACAAAAGAGAOAACCCGGGCATQ 420 F S W E IRDKLLKDAVCDRNTVPSVSS I SR IM TTCAGCTGGQAAATCCOAQACAAATTACTCAAQQACQCGGTCTGTGATCGAAACACCGTGCCGTCAGTQAGTTCCATCAGCCGC 504 I LRSKFQKGEEEEAOLERKEAEESEKKA 164 ATCCTQAGAAaTAAATTCGGGAAAGGTGAAGAQGAQGAGGCCGACTTGGAQAGQAAGGAGGCAGAGGAAAGCGAGAAGAAQGCC see DSEPD 212 lACTCTGAACCAGAT 672 LPLKRKORRSRTTFTAEOLEELEHAFER 240 TTACCACTAAAGAQQAAACAQCQCAGAAGCCQAACCACCTTCACAGCAGAACAGCTGGAGGAACTQQAGCGTGCTTTTGAGAGA 766 266 640 296 AACCOCCQTaCAAQATOQAQQAAQCAAGCTQGGGCCAATCAACTGATGGCTTTCAACCATCTCATTCCCGGGGGGTTCCCTCCC 924 TAMPTLPTYQLSETSYQPTSIPQAVSDP 324 ACTOCCATOCCOACCTTQCCAACGTACCAGCTOTCGGAOACCTCTTACCAOCCCACATCTATTCCACAAGCTGTGTCAGATCCC 1008 SSTVHRPOPLPPSTVHOST I PSNPDSSS 362 AQCAQCACCGTTCACAQACCTCAACCQCTTCCTCCAAaCACTGTACACCAAAQCACGATTCCTTCCAACCCAGACAQCAGCTCT 1092 360 1176 NPT l G N G L S P Q SI l HVQ 406 AACCCCACCATTOGCAATOaCCTCTCACCTCAO»NCTACACAQCAAGTTCATTCGTOTGCAQNEGTGK83WWMLNPEQGK3GKSPRRRAA AATTCAATTR COTH CATN AA TLCTOS TCCLHSKF 1260 436 AATâAAaaAACTGOAAAAAQTTCTTQaTQQATQCTCAATCCAQAaQQTaaCAAaAGCQQGAAATCTCCTAGGAaAAGAGCTGCA 1344 SMONNSKF TCCATQQACAACAACAOTAAATT' 464 1428 AQOSPQSOFSKWPASPQSHSNDDFONWS 492 GCTQGQGACAOCCCTGOATCACAOTTTTCCAAATOOCCTOCAAQCCCTGGCTCTCACAGCAATGATGACTTTQATAACTGOAGT 1512 TFRPRT3SNASTISORLSPIMTEQDDLG 520 ACATTTCaCCCTCGAACTAOCTCAAATQCTAGTACTATTAQTGGGAGACTCTCACCCATTATGACCGAACAOGATGATCTTGGA 1596 EOOVHSMVYPPSAAKMASTLPSLSE l SN 546 GAAQQOOATGTGCATTCTATOGTGTACCCQCCATCTGCCOCAAAGATGQCCTCTACTTTACCCAGTCTGTCTGAGATAAQCAAT
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages6 Page
-
File Size-