Clemson University TigerPrints
All Dissertations Dissertations
8-2011 EFFECT OF GOLDENSEAL (Hydrastis canadensis) ON BACTERIAL MULTI DRUG RESISTANT EFFLUX PUMPS Jyothi Rangineni Clemson University, [email protected]
Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Part of the Microbiology Commons
Recommended Citation Rangineni, Jyothi, "EFFECT OF GOLDENSEAL (Hydrastis canadensis) ON BACTERIAL MULTI DRUG RESISTANT EFFLUX PUMPS" (2011). All Dissertations. 785. https://tigerprints.clemson.edu/all_dissertations/785
This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected].
EFFECT OF GOLDENSEAL (Hydrastis canadensis) ON BACTERIAL MULTI DRUG RESISTANT EFFLUX PUMPS
A Dissertation Presented to the Graduate School of Clemson University
In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Microbiology
by Jyothi Rangineni December 2009
Accepted by: Dr. Tzuen-Rong Tzeng, Committee Chair Dr. Joseph Gangemi Dr. Xiuping Jiang Dr. Melissa Riley
Abstract
Multi-Drug-Resistance (MDR) efflux pumps have been increasingly reported in
Gram negative and Gram positive bacteria. These efflux mechanisms pump out a wide
variety of structurally unrelated antimicrobials thus leading to reduced susceptibility due
to lowered intracellular concentrations. The activity of such antimicrobials can be
restored by the inhibition of the multi-drug efflux pumps. Several MDR pump inhibitors
which inhibit the efflux mechanisms in bacteria have been identified. Reserpine and
verapamil are two such inhibitors showing considerable effects on the MDR pumps. But
the concentrations required to achieve these effects are too high to be clinically relevant.
Reserpine has adverse effects such as neurotoxicity. The identification and development
of safe and effective inhibitors of bacterial efflux pumps is needed. Crude leaf extracts of goldenseal (Hydrastis canadensis) have been shown to have such effects.
This dissertation researches the MDR pump inhibitory activity of goldenseal leaf
extract and the separation of its constituents. First, three forms of goldenseal samples
supplied by the Sleepy Hollow Farm, GA were evaluated for their antimicrobial
properties. Minimum inhibitory concentration (MIC) of all different forms of goldenseal
i.e, powders, liquid extracts, and retention solids, in five different ratios of root/leaf
combinations was determined against MDR bacterial strains of Staphylococcus aureus
and Campylobacter jejuni. The antimicrobial activity of goldenseal samples was also
determined against human intestinal beneficial bacteria, Lactobacillus acidophilus.
Goldenseal liquid extracts were found to have high activity against the MDR bacteria while showing minimum impacts on the viability of L. acidophilus.
ii
Second, goldenseal leaf extract was assayed for its MDR efflux pump inhibitory
activity against MDR pumps belonging to different pump superfamilies in both S. aureus
and C. jejuni. Goldenseal increased the potency of different antimicrobials against the
MDR bacteria when combined in sub lethal doses (≤ 0.5MIC) by exerting at least a 2-fold
reduction in MICs of antimicrobials against S. aureus strains and a 16-fold reduction
against C. jejuni strain. Quantitative real-time RT-PCR and ethidium bromide
uptake/efflux studies indicated that goldenseal leaf extract represses the genes encoding
these MDR pumps in both bacterial systems.
Finally, five active bands exhibiting potential MDR efflux pump inhibitory
activity were identified in thin layer chromatography and bioautographic studies. The
identity of these bands could not be established by GC/MS which might be due to the
volatility of the compound. LC/MS analysis led to a list of possible compounds in these
active bands. In conclusion, the results of this work indicate that one or more constituents
in goldenseal leaf extract exhibit MDR efflux pump inhibitory activity.
iii
Acknowledgements
I would like to acknowledge the contributions of my advisor, Dr. Jeremy Tzeng, and fellow committee members, Dr. Joseph Gangemi, Dr. Xiuping Jiang, and Dr. Melissa
Riley. Additionally, I would like to thank the Department of Biological Sciences for funding my teaching assistantship for the duration of my studies; Dr. Alfred Wheeler, Dr.
Pat Mickelsen, Dr. Krista Rudolph, Dr. Hayasaka and Dr. George Huang for their expertise and support; and my fellow lab mates and friends for their support.
iv
Table of Contents
Page
Title Page ...... i
Abstract ...... ii
Acknowledgments ...... iv
List of Tables ...... ix
List of Figures ...... x
Chapter 1
1. Literature Review ...... 1
1.1 Antibiotic Resistance ...... 1
1.2 Mechanisms of Antibiotic Resistance: ...... 2
1.3 Multi-Drug-Resistance Efflux Pumps ...... 4
1.4 Multi-Drug Efflux Pump Classification ...... 6
1.5 Multi-Drug Efflux Pump Structure ...... 7
1.6 Efflux Pump Inhibitors ...... 9
1.7 Plants as Sources for EPIs ...... 11
1.8 Hydrastis canadensis ...... 12
1.9 Chemical Composition of Goldenseal ...... 14
1.10 Objectives ...... 16
v
Table of Contents (Continued)
Chapter 2
2. Antimicrobial Activity of Hydrastis canadensis (Goldenseal) ...... 17
2.1 INTRODUCTION ...... 17
2.2 MATERIALS AND METHODS ...... 18
2.2.1 Bacterial Strains ...... 18
2.2.2 Goldenseal Samples ...... 19
2.2.3 Antimicrobial Assay ...... 19
2.3 RESULTS ...... 20
2.4 DISSCUSSION ...... 23
Chapter 3
3. Effect of Goldenseal Leaf Extract on MDR Pumps in Staphylococcus aureus and
Campylobacter jejuni ...... 25
3.1 INTRODUCTION ...... 25
3.1.1 Staphylococcus aureus ...... 25
3.1.2 Methicillin Resistant S. aureus (MRSA) ...... 26
3.1.3 Pathogenesis of S. aureus ...... 27
3.1.4 Multi-Drug-Resistance in S. aureus ...... 28
3.1.5 Campylobacter jejuni ...... 31
3.1.6 Pathogenesis of C. jejuni ...... 31
3.1.7 Antibiotic Resistance in C. jejuni ...... 32
3.1.8 Multi-Drug-Resistance (MDR) in C. jejuni ...... 33
vi
Table of Contents (Continued)
3.2 MATERIALS AND METHODS ...... 34
3.2.1 Bacterial Strains ...... 34
3.2.2 Antimicrobial Assay ...... 35
3.2.3 Synergistic Assay of Goldenseal Leaf Extract ...... 36
3.2.4 Agar Well Diffusion Assay ...... 37
3.2.5 Quantitative Real-Time RT-PCR ...... 37
3.2.6 Ethidium Bromide Uptake Assay ...... 39
3.2.7 Ethidium Bromide Efflux ...... 40
3.2.8 Statistical Analysis ...... 40
3.3 RESULTS ...... 41
3.3.1 Antimicrobial Assay ...... 41
3.3.2 Synergy Studies ...... 42
3.3.2.1 Microbroth Assay ...... 42
3.3.2.2 Agar Diffusion Assay ...... 45
3.3.3 Quantitative Real-Time RT-PCR ...... 46
3.3.4 Ethidium Bromide Uptake ...... 50
3.3.5 Ethidium Bromide Efflux ...... 54
3.4 DISCUSSION ...... 56
Chapter 4
4. Separation and Identification of Goldenseal Leaf Extract Constituents ...... 59
4.1 INTRODUCTION ...... 59
vii
Table of Contents (Continued)
4.2 MATERIALS AND METHODS ...... 60
4.2.1 Goldenseal Leaf Extract Sample ...... 60
4.2.2 Bacterial Strains ...... 60
4.2.3 Thin Layer Chromatography (TLC) ...... 60
4.2.4 Bioautography Studies ...... 61
4.2.5 Sample Preparation for Analysis ...... 61
4.2.6 Gas Chromatography/Mass Spectrometry GC/MS ...... 62
4.2.7 Liquid Chromatography/Mass Spectrometry LC/MS ...... 62
4.3 RESULTS ...... 63
4.3.1 TLC ...... 63
4.3.2 TLC Bioautography ...... 64
4.3.3 GC/MS ...... 69
4.3.4 LC/MS ...... 69
4.4 DISCUSSION ...... 71
Conclusion ...... 73
References ...... 76
viii
List of Tables
Table Page
2.1: List of samples provided by Sleepy Hollow Farm ...... 18
2.2: MIC and MBC of all goldenseal samples on S. aureus SA1199 and SA1199B
and L. acidophilus ...... 21
2.3: Percentage of berberine and hydrastine in the goldenseal liquid extracts ...... 22
2.4: MIC of goldenseal liquid extracts on different bacterial strains ...... 23
3.1: Primary and secondary infections caused by S. aureus ...... 28
3.2: Examples of Antimicrobial Resistance Determinants in S. aureus ··································· 30
3.3: List of bacterial Strains ...... 35
3.4: List of primers for different strains of S. aureus used in Real-Time RT-PCR ...... 39
3.5: MIC (µg/mL) of antimicrobials on the NorA pump expressing strains ...... 41
3.6: MICs (µg/mL) of different antimicrobials on the MDR strains ...... 42
3.7: MDR pump inhibitory activity of goldenseal leaf extract on NorA strains ...... 43
3.8: MDR pump inhibitory activity of goldenseal leaf extract on MDR S. aureus strains ...... 45
3.9: 2-∆∆Ct of S. aureus NorA strains ...... 48
3.10: 2-∆∆Ct values of the MDR bacteria ...... 49
4.1: ZOIs on TLC plates sprayed with indicator bacteria seeded with sub lethal
dose of ciprofloxacin ...... 67
4.2: List of compounds predicted by LC/MS data ...... 70
ix
List of Figures
Figure Page
1.1: Antibiotic resistance mechanism ...... 3
1.2: Representative members of the five characterized families of multi-drug
efflux pumps ...... 6
1.3: MDR pumps in Gram positive and Gram negative bacteria ...... 7
1.4: Hydrastis canadensis (goldenseal) ...... 12
1.5: Distribution of Hydrastis canadensis ...... 14
1.6: Structures of alkaloids present in goldenseal ...... 15
3.1: Timeline in years of emergence of antibiotic-resistant S. aureus, epidemic,
and estimated deaths caused by MRSA in the United States ...... 26
3.2: Agar diffusion assay ...... 46
3.3: Effect of goldenseal on the gene expression of MDR pump genes ...... 50
3.4: Ethidium bromide uptake of bacteria on S. aureus strains ...... 51
3.5: Effect of reserpine on EtBr uptake on S. aureus strains ...... 52
3.6: Effect of goldenseal leaf extract on EtBr uptake on S. aureus strains ...... 53
3.7: Effect of goldenseal leaf extract and reserpine on the EtBr uptake of
C. jejuni ...... 54
3.8: EtBr efflux of S. aureus strains, SA1199 and SA1199B in the presence and
absence of MDR pump inhibitors ...... 55
4.1: TLC separation of goldenseal leaf extract ...... 64
4.2: Zone of inhibition (ZOI) of (a) goldenseal leaf extract, (b) berberine sulfate and (c)
ciprofloxacin prior to separation ...... 65
4.3: TLC bioautographic studies of SA1199B ...... 66
x
4.4: Number of ZOIs on SA1199B + sub lethal dose of ciprofloxacin sprayed
on developed TLC plate spotted with goldenseal leaf extract ...... 68
4.5: TLC bioautographic studies of SAK2068 ...... 69
xi
Chapter 1
Literature Review
1.1 Antibiotic Resistance:
Antibiotics are substances that kill bacteria or prevent their reproduction. Since
their discovery in the 1940’s, use of antibiotics has led to possible treatment of many bacterial infections that once killed millions. Between 1940’s and 1970’s life expectancy rate increased by 8 years and, much of it has been attributed to antibiotics (Riley, 2001).
Penicillin, the first introduced antibiotic discovered by Sir Alexander Fleming, was used to effectively treat Streptococcus pneumonia infections during the World War II.
Resistance to antibiotics was observed in bacteria soon after their introduction as chemotherapeutic agents against bacterial infections. Antibiotic resistant bacteria are defined as the strains of bacteria that can grow and divide normally in the presence of an antibiotic that should kill or inhibit their growth. In 1967 the first penicillin-resistant S. pneumoniae was observed in Australia, and seven years later in USA, another case of penicillin-resistant S. pneumoniae was observed in a patient with pneumococcal meningitis (Doern, 2001). This trend was observed with other bacteria and antibiotics.
Tetracycline resistance by normal human intestinal flora increased from 2% in the 1950s to 80% in the 1990s. Kanamycin, an antibiotic used in the 1950s, became clinically useless as a result of the prevalence of kanamycin-resistant bacteria (Shoemaker, 2001).
1
1.2 Mechanisms of Antibiotic Resistance:
Bacteria develop resistance to antimicrobials by various mechanisms which
include: change in metabolic pathways, (Hancock 1997, 1998), production of enzymes
which inactivate the agents (Thomson and Smith, 2000), alteration of target sites
(Hooper, 2000) and active efflux from cells (Poole, 2000).
Many mechanisms with which bacteria utilize to defend themselves from antibiotics are depicted in Figure1.1. The four major mechanisms of antibiotic resistance
are drug inactivation or modification, alteration of target site, metabolic pathway
modification and efflux pumps.
Drug inactivation or modification by the production of antibiotic degrading
enzymes is the best known mechanism. Examples for this are the β-lactamases which
cleave the β-lactam ring in the penicillin rendering it inactive. Around 200 β-lactamases
have been isolated and these are wide spread in most bacteria and show varying degrees
of resistance to β-lactamase inhibitors, such as clavulanic acid (Livermore, 1995).
Alteration of target site, which becomes resistant to inhibition by the antibiotic
while continuing to produce the initial sensitive target, is the second mechanism. This
allows bacteria to survive in the face of selection; the alternative enzyme “bypasses” the
effect of the antibiotic. An example is the alternative penicillin binding protein (PBP2a),
which is produced in addition to the normal penicillin binding proteins by methicillin
resistant Staphylococcus aureus (MRSA). This protein is encoded by the mecA gene, and
because PBP2a is not inhibited by antibiotics such as penicillin, the cell continues to
2
synthesize peptidoglycan and hence has a structurally sound cell wall (Michel, Gutmann,
1997).
Figure 1.1: Antibiotic resistance mechanism: (Hawkey, 1998)
Metabolic pathway modification is another resistance mechanism which bacteria
exhibit. Sulfonamides inhibit the enzyme dihydropterate synthetase of bacteria which acts
upon para-aminobenzoic acid, a precursor of folic acid. This enzyme is not found in mammalian cells. This makes sulfonamides a better choice for treatment of bacterial
3 infections. Resistance is developed by the bacteria by their utilizing preformed folic acid like mammalian cells (Beneveniste, Davies, 1973).
All living cells express multidrug efflux transporters as surface proteins which recognize a wide range of structurally dissimilar hydrophobic organic compounds and extrude them from the cytoplasm into the outer medium (Ambudkar, 1999, Putman,
2000, Georgiev, 2000). Resistant bacteria overexpress such pumps or work in synergy with other factors (Jun Lin, 2003). Examples of such pumps are NorA in S. aureus and
CmeABC in C. jejuni. Substrates for these pumps include various anti cancer and antimicrobial agents.
1.3 Multi-Drug-Resistance Efflux Pumps:
Multi-drug-resistance (MDR) is defined as the ability of bacteria to show resistance against structurally different compounds. A simple error in the DNA replication could lead to MDR. But such small mutations do not explain the rate at which the MDR spreads through generations, as the mutation occur at low frequencies and is due to a change on the chromosome. The rapid spread of MDR has been attributed to plasmid transfer (Kruse, 1996).
Resistance due to MDR efflux pumps has been widely reported in the last two decades (Lewis, 1994, Nikaido, 1994), since P-glycoprotein was first identified by R. L.
Juliano and V. Ling. Unlike other resistance genes which are either plasmid encoded or specific for a given antibiotic and which are acquired through horizontal gene transfer, the genes for efflux pumps are found in all living things. Efflux pumps prevent the
4 accumulation of antibiotics by pumping them out of the cell. These efflux pumps are modified transport proteins present on the cell membrane which form solute-specific channels or transport pathways (Nikaido, Saier Jr, 1992).
The MDR pumps have been found to be homologous to regular, substrate-specific transporters. The MDR pumps Bmr, Blt and NorA of Gram positive bacteria share a higher sequence similarity with tetracycline transporters TetA, B and C of Gram negative bacteria than with other MDR pumps belonging to the same family. Hence it is evident that drastic changes in the transporter structure are not required for these MDR pumps to acquire the ability to recognize multiple compounds. This can be further proved by the fact that pumps of different families share similarity in substrates, for example a major facilitator Bmr and an ABC transporter P-glycoprotein recognize largely overlapping spectra of substrates and share many common inhibitors like reserpine (Neyfakh, 1991).
Co-existence of multiple mechanisms of resistance to a particular antibiotic in a single bacterial cell has been demonstrated in several bacteria. A single cell may also contain more than one efflux pump capable of efflux of the same antibiotic. Escherichia coli or Pseudomonas aeruginosa despite the presence of endogenous MDR pumps
(AcrAB-TolC and MexAB-OprM, respectively) in their genome may acquire plasmid- encoded transporters such as TetA or CmlA through mutation, which can also transport tetracycline and chloramphenicol (Nikaido, 1998, Poole, 2000). P. aeruginosa contains multiple MDR pumps that can confer resistance to fluoroquinolones (Lomovskaya,
2000).
5
1.4 Multi-Drug Efflux Pump Classification:
MDR pumps are classified into five families: ATP binding cassette (ABC)
(Lubelski, 2007), major facilitator super family (MFS) (Law, 2008), resistance nodulation
cell division (RND) (Tseng, 1999), small multidrug resistance (SMR) (Chung & Saier,
2001) and multidrug and toxic compound extrusion (MATE) (Moriyama, 2008). A
characterization of these pumps is shown in Figure 1.2. All of these families are energy
dependent active drug efflux transporters and utilize energy through either ATP or proton
motive force (PMF) (Paulsen, 1998,). ABC transporters are dependent on ATP hydrolysis
(primary active transporters), MFS, RND and SMR are proton-driven efflux pumps and
MATE transporters consist of a Na+/H+ drug antiporter system (secondary active
transporters). Examples of MDR efflux pumps in Gram positive and Gram negative bacteria are given in Figure 1.3.
Figure 1.2: Representative members of the five characterized families of multidrug efflux pumps (Paulsen, 2003)
6
1.5 Multi-Drug Efflux Pump Structure:
Primary Active Transporters:
Crystallization of the ABC proteins has proved difficult but electron microscopic studies of single particles and 2D crystals have provided low-resolution structural information. This structural information elucidates a hexagonal ring of protein with a central asymmetrical pore (Borges-Walmsley, McKeegan, 2003).
Figure 1.3: MDR pumps in Gram positive and Gram negative bacteria (Piddock, 2006)
7
Secondary Active Transporters:
The structure of the secondary active transporters differs from one another. MFS
transporters are typically composed of approximately 400 amino acids that are putatively
arranged into 12 membrane-spanning helices, with a large cytoplasmic loop between helices six and seven (Saier, 1999). RND transporters are much larger than MFS transporters, being composed of approximately 1000 amino acid residues (Tseng, 2003).
Unlike MFS transporters, they possess large periplasmic or extracytoplasmic domains between helices 1 and 2 and between helices 7 and 8 (Murakami, 2003). SMR transporters are much smaller than those belonging to the MFS and RND families. SMR pumps are normally composed of around 100 amino acids that are putatively arranged into four helices (Paulsen, 1996). MATE transporters are similar in size to the MFS transporters, and are typically composed of approximately 450 amino acids which are putatively arranged into 12 helices; however, they do not have any sequence similarity to members of the MFS transporters (Jack, 2001).
Efflux pumps are differentiated based on the number of components they possess, which also determines the extrusion of antibiotics from the cell. Single component efflux pumps such as TetA extrude the antibiotic into the periplasmic membrane which results in maintaining a concentration gradient across the inner membrane (Thanassi, 1997).
Two-component efflux pumps such as TolC, AcrA and AcrB, have a transporter which brings the two components together thus allowing extrusion of antibiotics into the
external medium (Zgurskaya and Nikaido 1999a; Zgurskaya and Nikaido, 1999b). This
8
results in a concentration gradient across the outer membrane and decreases in antibiotic
levels in the periplasmic membrane.
Over expression of these MDR pumps has led to the development of drug
resistant tumor and bacterial and fungal infections. Inhibition of these pumps can lead to
increased drug sensitivity and provides a new approach to overcome multidrug resistance.
Due to emergence of resistance to all classes of antibiotics, in particular the
fluoroquinolones, significant interest has been shown on MDR pump inhibitors.
One approach of overcoming resistance by MDR efflux pumps is the development of derivatives of existing antibiotics which are minimally affected by the efflux pumps. Examples of this are the glycylcyclines (Sum, 1998), a new class of semi- synthetic tetracyclines which overcome MDR efflux pumps. The glycylcyclines are not
recognized by the transporter proteins (Someya, 1995).
1.6 Efflux Pump Inhibitors:
Another approach for overcoming resistance due to MDR efflux pumps is the
inhibition of these MDR efflux pumps by Efflux Pump Inhibitors (EPIs). In the present
market there are no EPIs that can be used in combination with a drug that is a pump
substrate to increase its activity. The concept of using a compound that inhibits resistance
together with a conventional antibiotic is well proven (Esposito, Noviello, 1990). Several
MDR pump inhibitors which inhibit the efflux mechanisms have been identified. Several
factors such as appropriate potency and spectrum of activity, bioavailability, clearance,
avoidance of mechanism-based and/or non-mechanism based toxicity need to be
9 considered when developing a new infectious disease drug. Development of an EPI will most obviously result in a combination therapy.
In the selection of an effective EPI, several criteria should be considered:
• Determining the selectivity of the EPI should be the foremost criteria to be
ascertained. As mentioned earlier five families of MDR pumps have been
identified and representatives of each family are present in both eukaryotic and
prokaryotic cells and an EPI which would not be selective to specific pumps is
best desired.
• MDR efflux pumps though belonging to different families extrude similar
antibiotics; hence it maybe possible to identify a single EPI which would target
several relevant transporters.
• MDR efflux pumps extrude structurally dissimilar compounds, so a random
screening process is a more practical approach in initial designing of an EPI.
MDR efflux pump inhibition by several synthetic chemical compounds has been demonstrated by various investigators. A library of 9600 synthetic molecules was screened against NorA pump yielded in about 4% of the coumpounds showing activity
(Markham, 1999). All the coumpounds showed a 4-fold decrease in the MIC of ciprofloxacin in strains of S. aureus over expressing the NorA pump. Another synthetic compound MC-207 screened from a library of 200,000 synthetic compounds decreased the intrinsic resistance to levofloxacin, an. 8-fold, in a wild type strain of P. aeruginosa,
10
while in strains over-expressing efflux pumps the susceptibility was increased up to 64-
fold (Lomovskaya, 2001).
Screening of 85,000 Streptomyces fermentations has resulted in the
characterization of two new natural product EPIs, EA-371a and EA-371d (Lee, 2001).
Both compounds caused a 4-fold reduction in the MIC of levofloxacin effluxed by the
MexAB-OprM pump in P. aeruginosa.
1.7 Plants as sources for EPIs:
Reserpine is an antihypertensive plant alkaloid isolated from the roots of
Rauwolfia vomitoria Afz (Poisson, 1954). Reserpine has been demonstrated to show
activity against the Bmr efflux pump; this pump mediates tetracycline efflux in Bacillus
subtilis (Neyfakh, 1991). 5′-methoxyhydnocarpin, isolated from Berberis fremontii,
decreases the antimicrobial actvity of ciprofloxacin on NorA expressing strains of S.
aureus (Sterimitz, 2000).
There are many reasons for searching the plant world for possible EPIs; a few of
them are listed below:
• Soil is rich in microflora with bacteria, fungi and viruses, so it is rational to
assume that plants produce several antimicrobials as part of their defense. Several
bacterial species found in the soil are taxonomically similar to pathogenic
bacteria; hence this relation could be further explored.
11
• 25% of prescription drugs and 60% of anticancer and antibiotics owe their origin
directly or indirectly to natural products (Gibbons, 2008). This makes
phytochemicals as natural products highly valuable as bioactive compounds.
• Due to their difference in structures from microbial derivatives, phytochemicals
might show a different mode of action distinct from the existing antibiotics.
• There are several instances in history where plants have been used to treat varied
ailments, Echinacea, St. John’s Wort, Ginseng etc, are a few examples.
1.8 Hydrastis canadensis:
Goldenseal (Hydrastis canadensis) (Figure1.4) belongs to the family
Ranunculaceae. It is a small hairy perennial which emerges in early spring (mid-March to early May) and dies back in mid-August to mid-September. The natural range of the plant extends from southern New England west through the extreme southwestern portion of southern Ontario, to southern Wisconsin, and south to Arkansas and northern Georgia
(Figure 1.5) (USDA page for plant profile).
Figure 1.4: Hydrastine Canadensis (Goldenseal)
12
Historically, Native Americans have used goldenseal for various health conditions including skin diseases, ulcers, and gonorrhea. Its roots and rhizomes, which internally are bright yellow in color, have been used as a traditional medicine for the treatment of infection, inflammation, and as an immune system booster (Edwards, Draper, 2003).
More recently it is known to be taken orally to treat upper respiratory infections and gastrointestinal tract disorders, and is commonly found in commercial products in combination with Echinacea purpurea (Borchers, 2000, Scazzocchio, 1998, Schieffer,
2002). Modern herbalists consider it an alternative anti-catarrhal, anti-inflammatory, antiseptic, astringent, bitter tonic, laxative, and muscular stimulant (Grieve, 1971, Mills,
2000, Birdall, 1997). Goldenseal has also been evaluated for its activity against MDR
Mycobacterium tuberculosis (Gentry 1998). An increase in the primary IgM response was noticed in rats injected with the antigen keyhole limpet hemocyanin, on administration of goldenseal root powder (Maisel, 1999). It has been demonstrated as natural LDL-lowering agent (Abidi, 2006).
13
Figure 1.5: Distribution of Hydrastis canadensis (USDA, Plant Profile 2009)
1.9 Chemical composition of Goldenseal:
The National Toxicology Program is currently investigating the toxicology of
goldenseal root powder. A rapid ambient extraction method to assay goldenseal root powder and determine its purity has been developed (Weber, 2003). The main components of goldenseal are its alkaloids: berberine, hydrastine and canadine (Figure
1.6). It also possesses secondary metabolites such as protoanemonin and glycosides.
Berberastine, meconin, chlorogenic acid, phytosterins, resins, albumin, starch, sugars, lignin, and volatile oil (in the root) are other compounds found in addition in goldenseal
(Van Berkel, 2007).
14
c a b
Figure 1.6: Structures of alkaloids present in goldenseal, (a) berberine, (b) canadine and (c) hydrastine
Berberine extracts and salts have been demonstrated to inhibit intestinal parasites like Giardia lamblia, Entamoeba histolytica, Trichomonas vaginalis, (Kaneda. Y 1990) and Leishmania donovani (Abidi, 2005). Crude extracts were more effective than berberine salts (Kong, 2004). Berberine provides the yellow color to the root and rhizome, hence the name “Yellow Root” for goldenseal.
The other major alkaloid components are canadine and hydrastine. Canadine is known for its sedative and muscle relaxant properties. Hydrastine is a valuable drug in the treatment of diseases of the skin. Both of them are taken internally into the body or as a topical application. Hydrastine is especially useful as a stomachic tonic, and as a hepatic stimulant in cutaneous infections. Better activity is exhibited when hydrastine is used as a topical application than taken internally (Beckstrom-Sternberg, 1997).
Two new C-methyl flavonoids, 6, 8-di- C-methylluteolin 7-methyl ether and 6- C- methylluteolin 7-methyl ether have been isolated and these show activity against oral
15 pathogens such as Streptococcus mutans and Fusobacterium nucleatum (Hwang, 2003).
Quinic acid feruloyl esters have also been identified and their activities against
Mycobacterium tuberculosis have been evaluated, but have been shown not to have a significant effect (Gentry, 1999).
1.10 Objectives
The long term goal of this project is to develop therapies combining antimicrobial agents and MDR inhibitors to enhance the activities of antimicrobial agents, reduce the side effects associated with the use of antibiotics, and minimize the emergence of MDR pathogens. The main objectives of this project are:
1. Determine the antimicrobial activity of different forms of goldenseal on
Staphylococcus aureus and its effect on beneficial bacteria
2. Determine the efflux pump inhibitory activity of goldenseal leaf extract on
different families of efflux pumps in Gram negative and Gram positive bacteria
3. Separation and identification of goldenseal leaf extract constituents
16
Chapter 2
Antimicrobial Activity of Hydrastis canadensis (Goldenseal)
2.1 Introduction
Initially available only in specialty health and natural foods stores, goldenseal became part of the general marketplace during the 1990s, and since then the demand has been increased dramatically (Foster, 2000). Between 1991 and 1996, the wholesale value of goldenseal in the U.S. increased by as much as 600% (Robbins, 1996). Since 1994 goldenseal has been one of the top six best-selling medicinal herbs in the U.S. (Robbins,
1996; Small and Catling, 1999), and remains so today (Foster, 2000). Between 1995 and
1997, the medicinal plant market as a whole, as well as demand for goldenseal, experienced in excess of a 30% growth rate (USFWS, 1997). Goldenseal is also available in numerous drug products (Small and Catling, 1999) and in a wide array of herbal products on international markets, e.g., in China, France, Australia, Germany, United
Kingdom, Italy, and other European countries (IUCN, 1997; Robbins, 1996). Since demand has increased greatly, and supplies have declined, the price of goldenseal has increased dramatically.
Presently, the quality of the goldenseal samples in the market is analyzed by methods developed by two groups: Genest and Hughes and those described by Wagner and Bladt (Govindan, 2000). But these methods check for adulteration and for the presence or absence of berberine. To develop research grade goldenseal, a more thorough
17 analysis, which involves testing of the sample goldenseal on different pathogens and beneficial bacteria, is required.
The goldenseal samples for this work were supplied by the Sleepy Hollow Farm in Georgia. A brief description of the samples provided is given in Table 2.1.
Table 2.1: List of samples provided by Sleepy Hollow Farm
Sample Description Components Liquid Extracts 60% grain alcohol extracts. Supplied in Root and rhizome different ratios and combinations Leaf and Stem Powders Dried, ground powder. Supplied in different Root and rhizome ratios and combinations Leaf and stem Retention Solids Solids obtained from retention of the liquid Root and rhizome extracts by evaporation. Leaf and stem
The primary objective of this study was to determine the antimicrobial characteristics of the various goldenseal preparations on MDR S. aureus, C. jejuni strains and beneficial bacteria existing as a normal gut flora of the human body such as
Lactobacillsc acidophilus.
2.2 Materials and Methods
2.2.1 Bacterial Strains:
The MDR strains selected for these studies were the NorA MDR pump over expresser strain: SA1199B and its wild type counterpart SA1199 donated by Dr. Glenn
Kaatz. Lactobacillus acidophilus (ATCC 53544) strain was obtained from American
Type Culture Collection. S. aureus strains were maintained in Mueller Hinton II (BD-
18
Difco) medium at 35°C under aerobic conditions. L. acidophilus 53544 was maintained
in MRS medium (BD-Difco) at 37°C with 5% CO2.
2.2.2 Goldenseal Samples:
The goldenseal samples were provided by the Sleepy Hollow Farm, GA as listed
in Table 2.1. The liquid extracts and retention solids were lyophilized to determine the
dry weight.
2.2.3 Antimicrobial Assay:
The Minimum inhibitory concentration (MIC) of the liquid extract and powder
samples of goldenseal was determined by using the microbroth assay as described by the
Clinical and Laboratory Standards Institute (CLSI). The antimicrobial is added in two- fold dilutions in triplicates to round bottomed 96 well plate and each well is seeded with
105 cell/ml in MH II broth (final volume in each well is 200µL). The plates are incubated
aerobically at 35°C for 18-24hrs and observed for visual growth. MIC is determined as
the lowest concentration of the antimicrobial with no visible growth. The assays were
performed twice in triplicates.
Due to nature of the powder samples which would not make it possible to observe
the growth in the wells of the 96 well plate, macrobroth technique is applied. The
samples of goldenseal and bacteria were scaled up to a volume of 5mL. The tubes were
incubated in a shaker incubator at 35°C for 18-24hrs under aerobic conditions. The tubes
were taken out of the incubator and observed for turbidity after allowing the powders to
settle.
19
Minimum bactericidal concentration (MBC) was determined by taking the
inoculums (100µL) from the wells in the microbroth assay and resuspending in fresh
liquid and solid MH II medium. The agar and broth was incubated aerobically at 35°C for
18-24hrs and observed for growth. MBC is defined as the lowest concentration which would not give rise to any growth. All assays were performed twice in triplicates. For all the assays berberine sulfate was used as standard for comparison.
2.3 Results
The MIC and MBC of the goldenseal samples and berberine sulfate are displayed in Table 2.2. Among the three different combinations, liquid extracts yielded the best results. The liquid samples are achieved by the extraction of the root or stem of goldenseal in 60% grain alcohol at the Sleepy Hollow farm. Of the different preparations of the liquid extracts (mixtures consisting of different root/leaf ratio combinations); the
2:2 R/L preparations has shown the maximum effect on the MDR S. aureus: SA1199B.
The powders had a very high MIC values against the S. aureus strains, which was expected as the samples had more solid material than the others. The retention solids had comparatively moderate effect on the bacteria. But retention solids were supplied as thick paste of root or leaf, which when diluted to make the different ratios formed suspensions.
The suspensions had to be shaken vigorously each time sample had to be taken, thus leading to the contributable inconsistency in the amount taken.
The MBCs of the powder samples were twice the MIC values and there is no difference in the MIC and MBC of the retention solids. The MBCs of the liquid extracts
20 are slightly different than their MIC. The MIC and MBC of the extracts on the over expresser SA1199B are the same as the MICs. The MBC of the 4:0, 3:1 and 0:4 R/L preparations on the wild type SA1199 are the same, while the MBC of 2:2 and 1:3 R/L preparations are twice that of MIC.
The MIC of goldenseal samples on L. acidophilus 53544 was much higher in comparison the MIC to that on the S.aureus. The MIC of different liquid extract prparations on L. acidophilus was greater than 2mg/mL, that of powder samples greater than 10mg/mL and that of retention solids greater than 2mg/mL.
Table 2.2: MIC and MBC of all goldenseal samples on S. aureus SA1199 and SA1199B and L. acidophilus
Goldenseal sample SA1199 SA1199B L. acidophilus Root/Leaf MIC MBC MIC MBC MIC MBC Powders 4:0 5mg/mL 10mg/mL 5mg/mL 10mg/mL 3:1 5mg/mL 10mg/mL 5mg/mL 10mg/mL >5mg/ml 2:2 5mg/mL 10mg/mL 5mg/mL 10mg/mL 1:3 5mg/mL 10mg/mL 5mg/mL 10mg/mL 0:4 5mg/mL 10mg/mL 5mg/mL 10mg/mL Liquid Extracts 4:0 250µg/mL 250µg/mL 500µg/mL 500µg/mL 3:1 250µg/mL 250µg/mL 500µg/mL 500µg/mL >2000µg/mL 2:2 250µg/mL 500µg/mL 500µg/mL 500µg/mL 1:3 500µg/mL 1000µg/mL 1000µg/mL 1000µg/mL 0:4 1000µg/mL 1000µg/mL 1000µg/mL 1000µg/mL Retention solids 4:0 625 µg/mL 625 µg/mL 625 µg/mL 625 µg/mL 3:1 625 µg/mL 625 µg/mL 1250 µg/mL 1250 µg/mL >2000µg/mL 2:2 1250µg/mL 1250µg/mL 1250µg/mL 1250 µg/mL 1:3 1250µg/mL 1250µg/mL 1250µg/mL 1250 µg/mL 0:4 1250µg/mL 1250µg/mL 1250µg/mL 1250 µg/mL Berberine sulfate 125µg/mL 125µg/mL 250µg/mL 250µg/mL 250µg/mL
21
The goldenseal samples were analyzed by the Sleepy Hollow Farm for the
percentage of different constituents in them. Table 2.3 shows an interpretive of all the
constituents in the liquid extracts.
Table 2.3: Percentage of berberine and hydrastine in the goldenseal liquid extracts
R/L Ratio Berberine Hydrastine Percentage of Dry Weight Berberine Hydrastine mg/ml mg/ml Grain alcohol mg/ml % % 4:0 1.53 1.11 53.00 8 mg/ml 19.13 13.875 3:1 1.32 1.03 54.50 10 mg/ml 13.20 10.3 2:2 1.1 0.95 56.00 10 mg/ml 11.00 9.50 1:3 0.89 0.87 57.50 11 mg/ml 8.09 7.91 0:4 0.67 0.79 59.00 13 mg/ml 5.15 6.08
The MIC of berberine sulfate on the NorA over expresser strains SA1199B and L. acidophilus is 250µg/mL. Using the interpretive Table 2.3 the concentration of each liquid extract sample was calculated (Table 2.4). When the 2:2 R/L liquid extract preparation is taken into consideration, the MIC of this sample showed best antimicrobial activity on SA1199B (500µg/mL). The berberine content in this sample was calculated to be about 55µg/mL, almost one fifth of the MIC of pure berberine sulfate. This observation leads to the speculation that an unknown component(s) in the extract acts in synergy with berberine thus lowering its MIC.
When tested against SA1199B, of all the liquid extracts tested the lowest concentration of berberine was determined to be in the leaf extract (0:4 R/L) preparation.
This berberine level (51.50µg/mL) is much lower than the berberine level in the root
extract (95.65µg/mL). This indicates that the highest activity (if present) of the unknown
component is present in the leaf extract.
22
Table 2.4: MIC of goldenseal liquid extracts on different bacterial strains (the amount of equivalent berberine in each sample is given in the parenthesis
R/L Ratio SA1199 (wild- SA1199B (MDR) C.jejuni L. acidophilus type) 81-176 53544 4:0 250 µg/ml 500 µg/ml 31.25 µg/ml > 2 mg/ml (= 47.83µg/ml (= 95.65µg/ml (=5.98µg/mL (> 382.60 µg/ml berberine) berberine) beberine) berberine) 3:1 250 µg/ml 500 µg/ml 31.25 µg/ml > 2 mg/ml (= 33.00 µg/ml (= 66.00 µg/ml (=4.125µg/mL (> 264.00 µg/ml berberine) berberine) beberine) berberine) 2:2 250 µg/ml 500 µg/ml 31.25 µg/ml > 2 mg/ml (= 27.50 µg/ml (= 55.00 µg/ml (=3.44µg/mL (> 220.00 µg/ml berberine) berberine) beberine) berberine) 1:3 500 µg/ml 1000 µg/ml 62.5 µg/ml > 2 mg/ml (= 40.45 µg/ml (= 80.90 µg/ml (=5.05µg/mL (> 161.8 µg/ml berberine) berberine) beberine) berberine) 0:4 1000 µg/ml 1000 µg/ml 62.5 µg/ml > 2 mg/ml (= 51.50 µg/ml (= 51.50 µg/ml (=3.2µg/mL (> 103 µg/ml berberine) berberine) beberine) berberine) Berberine 125µg/mL 250µg/mL 8µg/mL 250µg/mL sulfate
2.4 Discussion
The results of the antimicrobial assay clearly indicate that the liquid extracts are much more effective on the S. aureus than the other forms of goldenseal. This might be
due the fact that the grain alcohol has extracted the components responsible for the
antimicrobial activity. Hence the liquid extracts are best form that can be projected for
antimicrobial effect. The hisher antimicrobial activity of goldenseal leaf extract on L.
acidophilus clearly indicates that the human beneficial strain was less susceptible to the antimicrobial activity of goldenseal than the S. aureus strains. This finding is favorable
23
since if goldenseal is administered as antimicrobial agent, the minimal the impact on the
normal microflora is desirable.
When tested against SA1199B, of all the liquid extracts tested the lowest concentration of berberine was determined to be in the leaf extract (0:4 R/L) preparation.
This berberine level (51.50µg/mL) is much lower than the berberine level in the root
extract (95.65µg/mL). This indicates that the highest activity (if present) of the unknown
component is present in the leaf extract. The other alkaloids in the extracts, hydrastine
and canadine have not been reported to have much antimicrobial activity. Hence it is safe
to assume that berberine is responsible for the antimicrobial activity of goldenseal
extracts
The SA1199B strain used for this study, over expresses the NorA MDR efflux
pump (Kaatz, 1991). The natural substrates for NorA pump include berberine,
ciprofloxacin and ethidium bromide. Similarly the CmeABC pump in C. jejuni extrudes
the antimicrobials like ciprofloxacin and ethidium bromide. Goldenseal leaf extract has
exhibited antimicrobial property against these strains which when compared to the
equivalent concentration of berberine in it, is much lower. The leaf extract as discussed
earlier might consist of unknown component(s) that lower(s) the MIC of berberine in
synergy and could be used as a potential MDR EPI.
24
Chapter 3
Effect of Goldenseal Leaf Extract on MDR Pumps in Staphylococcus aurous and Campylobacter jejuni
3.1 Introduction
3.1.1 Staphylococcus aureus
Species of the genus Staphylococcus cause a range of suppurative (pus-forming) diseases in humans and other animals. Staphylococci are Gram positive cocci and are characteristically nonmotile, catalase positive facultative anaerobes that grow in grape- like clusters. The genera are also divided into coagulase positive and coagulase negative based on whether the bacteria can produce the enzyme coagulase, which clots the fibrinogen in blood. Staphylococcus aureus, the most invasive species, is coagulase positive and often produces a yellow carotenoid pigment, hence the name 'golden staph'.
S. aureus causes acute to chronic infections, such as boils, deep tissue abscesses, enterocolitis, bacteriuria, osteomyelitis, pneumonia, carditis, meningitis, septicemia and arthritis. Coagulase negative species, such as Staphylococcus epidermidis, are opportunistic pathogens that although generally less invasive, are increasingly associated with serious infections (Von Eiff, 2002).
25
3.1.2 Methicillin Resistant S. aureus (MRSA):
S. aureus was first proposed to be a major cause of wound suppuration by Sir
Alexander Ogston (Ogston,1883) and Skinner and Keefer reported in 1941 that the
mortality rate associated with S. aureus bacteremia in 122 patients at the Boston City
Hospital was 82% (Skinner, Keefer, 1941). The discovery of penicillin by Sir Alexander
Fleming led to the management of S. aureus infections but incidence of penicillin
resistant S. aureus (PRSA) started emerging in the mid 1940’s. Introduction of
methicillin in 1959 resulted in a general decline of pandemic phage-type 80/81 S. aureus,
the strain responsible for the infections in hospitals and community. In two years,
however, methicillin resistant S. aureus (MRSA) was isolated (Jevons, 1964) and, slowly,
reports of small clusters started appearing. A general timeline of the emergence of
resistant S. aureus is given in Figure 3.1.
Figure 3.1: Timeline in years of emergence of antibiotic-resistant S. aureus, epidemic, and estimated deaths caused by MRSA in the United States. Arrows indicate approximate length of time for each pandemic/epidemic. (DeLeo, 2009)
26
In the United States, the numbers of hospitalizations due to S. aureus are 292,000
of which 40% are caused by MRSA (Kuehnert, 2005). These infections have now been
given the status of the number one cause of hospital acquired (HA MRSA) infections
(DeLeo, 2009). Between the late 1970s and early 1980s and continuing to present day,
there has been a growing incidence of hospital-associated (nosocomial) and also
community-acquired (CA MRSA) infections caused by strains of S. aureus (Slade, 2009).
MRSA infections in USA intensive-care units rose from 2% in 1974, to 22% in 1995 and
64% in 2004 (Klevens, 2006). Community acquired infections were initially caused by
methicillin sensitive S. aureus (MSSA), but CA MRSA fast emerged and it now occurs
worldwide (Chambers, 2001).
3.1.3 Pathogenesis of S. aureus:
Those infections or syndromes caused by S. aureus are listed in Tables 3.1. There are five stages in the pathogenesis of S. aureus infections: colonization, local infection, systemic dissemination and/or sepsis, metastatic infection, and toxinosis. Approximately 30% of humans are asymptomatic nasal carriers of S. aureus (Archer, 1998) carrying it in their anterior nares, such that in these individuals S. aureus is part of the normal flora. S. aureus carriers are at higher risk of infection and are presumed to be an important source of the S. aureus strains that spread among individuals. The primary mode of transmission of S. aureus is by direct contact, usually skin-to-skin contact with a colonized or infected individual, although contact with contaminated objects and surfaces might also have a role. Local abscesses of skin or skin structures result when the organism is inoculated into the skin from a site of carriage. The infection can spread locally (e.g., carbuncle,
27
cellulites, impetigo bullosa, or wound infection) or can gain access to the blood and cause
bacteremia.
Table 3.1: Primary and secondary infections caused by S. aureus
Primary symptoms Secondary symptoms
Furuncle or carbuncle Cellulites Impetigo bullosa Hospital-acquired bacteremia
Surgical wound infection Hematogenous osteomyelitis Pyomyositis Septic arthritis Botryomycosis Brain abscess Acute or right-sided endocarditis Hospital-acquired pneumonia Epidural abscess Emphysema
Toxic shock syndrome Septic shock Scalded skin syndrome Food-borne gastroenteritis
3.1.4 Multi-Drug-Resistance in S. aureus:
MRSA are not only resistant to methicillin, but maybe resistant to as many as 20
different antimicrobial compounds, including various biocides, representing most of the
available drug classes (Table 3.2). According to most surveys (Archer, 1991, Truckiss,
1991), 50% of MRSA are also resistant to macrolides, lincosamides, fluoroquinolones, and amino glycosides. The threat posed by such antibiotic-resistant pathogens to patient
health and to the community in general has initiated considerable research into the nature
of the genes encoding antibiotic resistance and the mechanisms by which these genes
spread and evolve in bacterial populations.
28
Goldenseal leaf extract exhibited effective antimicrobial activity on the NorA pump carrying strain of S. aureus and CmeABC pump carrying strain of C. jejuni. For the further analysis, three more different MDR pumps isolated from S. aureus were chosen and a brief description of each is given below:
NorA Efflux Pump:
The NorA MDR efflux extrudes various structurally distinct compounds such as: berberine, ciprofloxacin and ethidium bromide. It is mainly responsible for fluoroquinolone resistance in S. aureus (Nikaido, 2009). The gene for this pump, norA is present on the chromosome (Yoshida, 1990) and the MDR strains over express the gene norA in comparison to the wild type strain. NorA belongs to the major facilitator super family (MFS) of pumps and has 12 transmembrane segments (Paulsen, 1996). The NorA show structural homology to the Bacillus subtilis Bmr and Blt pumps and NorA mediated drug transport like that of Bmr is reserpine sensitive (Kaatz, 1993).
MepA Efflux Pump:
MepA is the first S. aureus MATE family MDR transporter to be identified and is capable of transporting several clinically relevant biocides and antimicrobial agents. It is repressed by the product of mepR, which is present on the same gene cluster as mepA in, the mepRAB cluster (Kaatz, 2006). The gene cluster is present on the chromosome, while in the wild type only the mepR is seen, in the over expressers, the whole mepRAB cluster is seen. Like the NorA pump the MepA MATE pump is sensitive to reserpine.
29
Table 3.2: Examples of Antimicrobial Resistance Determinants in S. aureus (Slade, 2006)
Antimicrobial agent Resistance determinant Mechanism of resistance Biocides qacA, B, C Multidrug efflux pump (MFS) Bleomycin ble Bleomycin binding protein Chloramphenicol cat Chloramphenicol acetyltransferase Chloramphenicol, cfr 23S rRNA methyltransferase lincosamides, linezolid Fluoroquinolones grlA/B DNA topoisomerase IV Fluoroquinolones gyrA/B DNA gyrase Fluoroquinolone norA Multidrug efflux pump (MFS) Fusidic acid fusA EF-G (elongation factor) Fusidic acid fusB Fusidic acid detoxification Gentamicin, kanamycin aacA-aphD 6′-aminoglycoside N-acetyltransferase/2″- aminoglycoside phosphotransferase Linezolid 23S rRNA genes 23S rRNA Methicillin, oxacillin mecA PBP2a (low-affinity PBP) MLS group erm(A) rRNA adenine N-6-methyltransferase MLS group erm(B) rRNA adenine N-6-methyltransferase MLS group erm(C) rRNA adenine N-6-methyltransferase Streptogramin A vga(A)(B) MLS efflux pump (ABC) Streptogramin A vat(A)(B) Virginiamycin A acetyltransferase PStreptogramin B vgb(A) Streptogramin B lyase Mupirocin ileS Isoleucyl tRNA synthetase Mupirocin ileS-2 Insensitive isoleucyl tRNA synthetase Neomycin, kanamycin aphA-3 Aminoglycoside phosphotransferase Neomycin, kanamycin aadD Aminoglycoside adenyltransferase Penicillin blaZ Class A b-lactamase Penicillin mecA PBP2a (low-affinity PBP) Rifampicin rpoB RNA polymerase b-subunit Spectinomycin spc Spectinomycin adenyltransferase Streptomycin str Streptomycin adenyltransferase Streptomycin aadE Streptomycin adenylyltransferase Streptothricin sat4 Streptothricin acetyltransferase Tetracycline tetA(K) Tetracycline efflux pump (MFS) Tetracycline tetA(L) Tetracycline efflux pump (MFS) Tetracycline, minocycline tetA(M) Ribosomal protection protein Tigecycline mepA Multidrug efflux pump (MATE) Trimethoprim dfrA Insensitive dihydrofolate reductase Trimethoprim dfrB Insensitive dihydrofolate reductase Vancomycin, teicoplanin vanHAXYZ Glycopeptide resistance
30
MsrA Efflux Pump:
The MsrA pump extrudes macrolides and has been isolated from various strains of S. aureus. It belongs to the RND MDR pump family. No known EPIs of the MsrA have been reported until recently, diterpine totaral was recently shown to have inhibitory activity against this pump (Kaatz, 2007).
3.1.5 Campylobacter jejuni
Campylobacter jejuni is one of the leading causes of gastroenteritis in humans in
USA and worldwide (Wesley, 2000). Instances of infections due to Campylobacter date back to 1886, when Escherich observed campylobacters in the stools of children with diarrhea (Kist, 1985). These were determined to be the cause of diarrhea in 1956 but were thought to be Vibrio (King, 1957). The genus Campylobacter was proposed in 1973
(Vernon, 1973) and by 1980s Campylobacter was identified to be the leading cause of bacterial gastroenteritis by worldwide (Allos, 2001). C. jejuni is a microaerophilic Gram negative, oxidase positive curved rod exhibiting corkscrew motility. C. jejuni is a thermo tolerant bacterium, with the ability to grow at temperatures between 41°C-43°C but are unable to grow below 30°C due to absence of cold-shock proteins (Hernandez, 1991). Its cephalothin resistance is applied to isolate it from cephalothin-sensitive non- campylobacter diarrhea-causing bacteria.
3.1.6 Pathogenesis of C. jejuni
The infectious disease caused by Campylobacter is called campylobacteriosis.
The gastroenteritis symptoms of C. jejuni are usually indistinguishable from other similar pathogens like Shigella, Yersinia, etc. These include more commonly diarrhea, fever and
31
abdominal cramps and less frequently becteremia, septic arthritis and other extra intestinal symptoms (Sorvillo, 1991). The incidence of campylobacteriosis is more in
HIV infected patients and common complications in the patients include recurrent
infections and infections due to antibiotic resistant strains (Perlman D J, 1988).
Campylobacteriosis leads to a much more serious disorder called the Guillain-Barré syndrome in about 40% of patients (Allos, 1997). Guillain-Barré syndrome is an acute demyelinating disorder of the central nervous system. Only certain serotypes of C. jejuni
are known to increase the chances of contracting this disorder.
Poultry is considered as the main reservoir for C. jejuni, though other agents such
as water, raw milk and direct transmission from pets has also been reported (Butzler,
2004). Campylobacteriosis is majorly self limiting, but antibiotic resistant strains are
more prominent in immune-compromised individuals such as HIV patients or in
persistent infections. In such cases the usual antibiotics preferred were fluoroquinolones
and macrolides. C. jejuni is carried in the intestine of many wild and domestic animals, particularly avian species, where the intestine is colonized resulting in healthy animals as
carriers. Wildlife has long been considered an infectious reservoir for campylobacters
because of their close association with and contaminated surface waters (Levin, 2007).
3.1.7 Antibiotic Resistance in C. jejuni:
It is a concern that due to use of antibiotics in food animals as therapeutic agents or growth promoters and since C. jejuni can be passed from animals to humans, antibiotic resistant C. jejuni might arise (Angulo, 2004). A significant rise in macrolide and fluoroquinolone resistance has been reported in human isolates of C. jejuni since the
32
1990’s (Engberg, 2001). This could have been accelerated due to widespread use of these
antibiotics. Fortunately the prevalence of macrolide resistance in C. jejuni human isolates
has remained low (12%) (Gibreel, 2006) while the prevalence of fluoroquinolone
resistance has increased very high (90%) (Prats, 2000).
3.1.8 Multi-Drug-Resistance (MDR) in C. jejuni:
In 2002, the RND efflux pump CmeABC in C. jejuni was described. This pump
confers resistance to several antimicrobials including fluoroquinolones, erythromycin, tetracycline, chloramphenicol and ampicillin, as well as detergents and dyes (Jun Lin,
2002). To date, a number of studies have defined a contributory role of the CmeABC efflux system to acquired MDR (Pumbwe, 2004). CmeABC consists of three components as is characteristic of RND pumps, a periplasmic fusion protein (CmeA), an inner membrane transporter (CmeB) and an outer membrane channel protein (CmeC). The three components are encoded by a single polycistronic operon (cmeABC). An insertion
mutation in the cmeB increases the susceptibility of the resistant strains to some of the
antimicrobials, which indicates the presence of other efflux pumps (Jun Lin, 2002).
It has been shown that the CmeABC pump acts synergistically with gyrA
mutations to confer fluoroquinolone resistance (Luo, 2003). In contrast to other bacteria where over expression of efflux pump activity is largely associated with acquired fluoroquinolone resistance (Kaatz, 2005), fluoroquinolone resistance in C. jejuni does not appear to require over expression of efflux pumps and may be mediated by single-step point mutations in gyrA in the presence of the constitutively expressed CmeABC pump.
The CmeABC pump may also act independently or in synergy with the 23S rRNA
33
mutation, which is responsible for macrolide and erythromycin resistance in C. jejuni
(Mamelli, 2005).
Crude 60% grain alcohol goldenseal leaf extract’s activity on some of the MDR
bacterial strains indicates that the concentration of alkaloids, specifically berberine is not
sufficient to such levels of antimicrobial activity. The objective of this study is to analyze
the synergistic effect of goldenseal leaf extract on the inhibition of MDR efflux pumps in
strains of S. aureus and C. jejuni.
3.2 Materials and Methods
3.2.1 Bacterial Strains:
The list bacterial of strains used in this study are listed in Table 3.3 along with the
MDR pump expressed in them and the associated MDR pump family. S. aureus strains
SA1199 (norA wild type), SA1199B (norA over expresser), RN4220 (msrA) and
SAK2068 (mepA) and Escherichia coli strains DH10B and DH10B/pK21 (wild type
DH10B with norA carrying plasmid pK21) were kindly provided by Dr. Glenn Kaatz
(Wayne State University School of Medicine, Detroit, MI). S. aureus 25923 and L. acidophilus 53544 were obtained from ATCC, Richmond VA. All the strains were maintained in Mueller Hinton II (MH II) (BD-Difco) medium at 35°C under aerobic conditions.
C. jejuni 81-176 (cmeABC) is a human isolate provided by Dr. Jun Lin of the
Department of Animal Science at the University of Tennessee. These isolates were routinely grown in Mueller-Hinton II (MH II) broth (BD-Difco) or agar at 42°C under
34
microaerophilic conditions generated using the Anoxomat system (Mart Microbiology) in
enclosed jars.
Table 3.3: List of bacterial Strains
Strain Description MDR pump family S. aureus SA1199 Wild type NorA MFS S. aureus SA1199B Over expresser NorA MFS S. aureus SAK2068 MepA MATE S. aureus RN 4220 MsrA RND S. aureus ATCC 25023 - - E. coli DH10B - - E. coli DH10B/pK21 Plasmid containing norA gene MFS C. jejuni 81-176 CmeABC RND
3.2.2 Antimicrobial Assay:
The minimum inhibitory concentrations (MICs) of different antimicrobials,
goldenseal leaf extract and berberine sulfate were determined by using the microbroth
assay as described by the Clinical and Laboratory Standards Institute (CLSI) for the S.
aureus. The antimicrobial is added in serial two-fold dilutions in triplicates to round
bottom 96 well plate and each well is seeded with 105cell/ml in MH II broth (final volume in each well is 200µL). The plates are incubated aerobically at 35°C for 18-24hrs and observed for visible growth. MIC is defined as the lowest concentration of the antimicrobial with no visible growth. The assays were performed twice in triplicates. All the chemicals and antimicrobials were obtained from Sigma-Aldrich. Goldenseal leaf extract was provided by Sleepy Hollow farm, GA.
35
The minimum bactericidal concentration (MBC) is determined by taking the
100µL from the wells that show no visible growth (≥ MIC) in the microbroth assay and resuspending in fresh liquid and on solid MH II media. The agar and broth is incubated aerobically at 35°C for 18-24hrs and observed for growth. MBC is defined as the lowest concentration which yielded no growth. All assays were performed twice in triplicates.
For C. jejuni 81-176 the MICs were determined using the standard 96 well microtiter broth dilution method in MH II broth with an inoculum of 106cell/mL.
Microtiter plates were incubated for 48 hrs under microaerophilic conditions at 42°C and
observed for visual growth. The assays were performed twice in triplicates.
3.2.3 Synergistic assay of goldenseal leaf extract:
The pump inhibitory activity of goldenseal leaf extract on the S. aureus strains
was performed by a slight modification of the microbroth assay. Sub-lethal doses of the
antimicrobial being tested and sub-lethal doses of goldenseal leaf extract are added
together in the wells of the 96 well plates. The plates were then seeded with 105cell/mL
in MH II broth (final volume 200µL/well). The plates were incubated aerobically at 35°C
and observed for visible growth. The decrease in MIC is then measured in fold-decrease.
Reserpine, a known MDR pump inhibitor, was used as a standard for MDR pump
inhibitory activity. For the C. jejuni strains the plates were seeded with 106cell/mL in MH
II broth. The plates were incubated for 48 hrs under microaerophilic conditions at 42°C
and observed for visible growth.
36
3.2.4 Agar well-diffusion assay
To demonstrate synergy between the goldenseal leaf extract and antimicrobials on
the bacteria, a slightly modified technique of agar-well diffusion assay as described earlier (Schillingeur and Lucke,F, 1989). MH II agar plates were overlaid with soft agar seeded with 105cell/mL of the indicator bacteria (SA1199B). Wells of 1mm in diameter were then punched in the agar and the antimicrobial agent (goldenseal leaf extract or ciprofloxacin) added to them. The diameter of the zone of inhibition (ZOI) was
measured. Synergy was demonstrated by placing the wells of ciprofloxacin and
goldenseal leaf extract with a measured distance from the edge of ZOI of ciprofloxacin to
the Zone of goldenseal leaf extract. A disfiguration of ZOI would indicate the
synergy/antagonism between the two agents.
3.2.5 Quantitative Real-Time RT-PCR:
RNA extraction:
The bacteria were grown overnight in MH II broth with or without sub-lethal doses of the EPIs (Reserpine or goldenseal leaf extract). Total RNA was then extracted from the bacteria using the 1-2-3 RNA extraction kit from Idaho Technologies according to the manufacturer’s protocols. 100µL of the cell culture was added to the bead tubes and the carrier RNA (RNA module) and vortexed for 5min on a Vortex Genie to lyse the bacteria. 450µL of the binding buffer was added to the lysate. The lysate was transferred avoiding the beads to a spin filter and centrifuged. The spin filter was washed twice with wash buffer and RNA was eluted in 50µL of the elution buffer.
37
The concentration of total RNA was determined by spectrophotometer readings at
260nm. The purity of the RNA was confirmed by doing a ratio of absorbance at 260nm
and 280nm and running a formaldehyde agarose gel electrophoresis.
Real-Time RT-PCR:
The Bio-Rad MiniOpticon Real-Time PCR Detection system was used to amplify
cDNA following reverse transcription of the isolated total RNA so that differences in
gene expression levels could be easily measured. Use of the Bio-Rad iScript™ One-Step
RT-PCR Kit with SYBR Green allowed for reverse transcription and PCR to be carried
out in one tube with fluorescence of SYBR green measured at the end of each cycle. For
one-step RT-PCR, 25µL reaction volumes containing the followings per tube were used:
12.5µL of 2x SYBR green master mixes, 0.5µL of 10µM forward primer, 0.5µL of 10µM
reverse primer, 0.5µL of reverse transcriptase, 25ng RNA, and RNAase free water to
bring the reaction volume to 25µL. Triplicate samples were run in duplicate under the following conditions: cDNA synthesis at 50°C for 10 minutes, RT inactivation and initial denaturation at 95°C for 5 minutes, denaturation for 10 seconds at 95°C and annealing
(data collection step) for 30 seconds at 53.8°C for 35-45 cycles. The primers used in the gene expression assay are listed in Table 3.4. The purity of the amplicon was determined by doing a melt curve analysis.
Analysis of the data generated by the RT-PCR was done by the comparative Ct method. The Ct values of both the control and the samples of interest were normalized to
an appropriate endogenous housekeeping gene (16S rRNA). The threshold cycle, Ct, is
defined as the cycle at which fluorescence crosses into the exponential phase from the
38
initial linear phase. The standard curve method was not considered as the amounts of
RNA added to the reaction mixture were known.
Table 3.4: List of primers for different strains of S. aureus used in Real time RT-PCR
Strain Gene GenBank Left Primer Right Primer Accession No. S. aureus 16S L37597 tccggaattattgggcgtaa ccactttcctcttctgcactca housekeeping rRNA SA1199, norA M80252 agaatttatgtttgctatcggt tttgctttttgatggcttggtg SA1199B SAK2068 mepA AY661734 ggcaaataaaggccgtatga cagtcgcttgaagcatacca RN4220 msrA AF167161 agctgtgcgagatgtacgtg atgcttggtcctccctttct C. jejuni 16S Z29326 caacacttttaccgggtgct gccattttgcaatcctttgt housekeeping rRNA C. jejuni 81- cmeABC AF466820 gagtgagggagaggcagatg gtttagggcgtggactacca 176
3.2.6 Ethidium Bromide Uptake:
Uptake of EtBr by the bacteria was achieved by growing the bacteria overnight in
MH II broth. Bacteria were harvested at an OD660 of 0.7 to 0.8, washed in ice-cold MH II,
and then resuspended in MH II to a final OD660 of 0.4. The suspension was warmed to
37°C, and ethidium bromide (final concentration, 20µg/mL) was added. The suspension
was maintained at 37°C with agitation, and the fluorescence of aliquots was determined
at frequent intervals (excitation wavelength, 530nm; emission wavelength, 600 nm). The
effect of reserpine and goldenseal leaf extract on the uptake was measured by adding
39
them to the medium after resuspension. The final concentration of reserpine used was
20µg/mL and that of goldenseal leaf extract was 500µg/mL.
3.2.7 Ethidium Bromide Efflux:
Ethidium bromide efflux studies were performed as described earlier with some
differences (Kaatz, 2006). For ethidium bromide efflux, bacteria were grown overnight in
MH II and diluted into the same medium as used for overnight growth, and at an OD660 of
0.7 to 0.8. Ethidium bromide loading of bacteria was accomplished by the addition of ethidium bromide and reserpine (final concentrations of both being 20µg/mL). After 20 min of incubation at room temperature, the OD660 was adjusted to 0.4 using fresh MH II
containing ethidium bromide and reserpine or goldenseal leaf extract. Bacteria in 1 ml of
this dilution were pelleted and then resuspended in fresh MH II without reserpine or
ethidium bromide. Efflux of ethidium bromide was monitored by measuring the
fluorescence of the suspension continuously (excitation and emission wavelengths, 530
and 600 nm, respectively). The effect of reserpine (20µg/mL) and goldenseal leaf extract
(500µg/mL) was determined on the efflux of ethidium bromide.
3.2.8 Statistical Analysis:
Numbers expressed as mean ± standard deviation were analyzed by Student’s T
test. Values were considered significantly different when p values were less than 0.05.
Notations were also made when p<0.01.
40
3.3 Results
3.3.1 Antimicrobial Assay:
The MICs of different antimicrobials on the bacterial strains are given in Table
3.5 and 3.6. Table 3.5 is the results of the antimicrobial activity of ciprofloxacin,
goldenseal leaf extract, berberine sulfate and reserpine against the NorA strains. The MIC
of ciprofloxacin against the over expresser NorA strain SA1199B was 32-fold higher than
that on the wild type, SA1199 while on DH10B/pK21, it was 3-fold higher than the wild
type DH10B.
Table3.5: MIC (µg/mL) of antimicrobials on the NorA pump expressing strains
Antimicrobial SA1199 SA1199B DH10B DH10B/pK21 Ciprofloxacin 0.25 8 0.02 0.06 Goldenseal Leaf 1000 1000 1000 1000 Extract Berberine sulfate 125 250 >250 >250 Reserpine > 250 >250 250 250
The MICs of different antimicrobials on other indicator bacteria are given in
Table 3.6. The MIC of goldenseal leaf extracts on all the S. aureus strains was
comparable, but it exhibited a much lower MIC on the C. jejuni strain. Similarly the MIC
of berberine on all the MDR S. aureus was high compared to that on C. jejuni. Reserpine
showed a high MIC on all the S. aureus, E.coli and C. jejuni strains suggesting that
reserpine has limited antimicrobial property.
41
Table 3.6: MICs (µg/mL) of different antimicrobials on the MDR strains
Antimicrobial SA1199B SAK2068 RN4220 C. jejuni 81-176 Ciprofloxacin 8 4 0.25 0.313 Tetracycline 0.25 1 0.25 50 Erythromycin 0.25 0.5 64 0.078 Goldenseal Leaf 1000 500 1000 62.5 Extract Berberine sulfate 125 250 250 8 Reserpine > 250 >250 >250 >100
3.3.2 Synergy Studies:
3.3.2.1 Microbroth assay:
The synergistic activity of goldenseal and reserpine with other antimicrobials was
evaluated against all the MDR strains. The results for synergy between ciprofloxacin and
goldenseal leaf extract on the NorA strains are shown in Table 3.7. The sub lethal doses of goldenseal leaf extract evaluated were 500, 250 and 125µg/mL. There was no
reduction in MIC of ciprofloxacin on the wild type NorA S. aureus strain SA1199. The
MIC of ciprofloxacin on the NorA over expresser, SA1199B was reduced to 1µg/mL,
which was an 8-fold reduction, when a sub lethal dose of 500µg/mL of goldenseal leaf extract was used. There was a 4-fold and 2-fold reduction in the MIC of ciprofloxacin observed for sub lethal doses 250µg/mL and 125µg/mL respectively. Different concentrations of reserpine were also assayed as controls. An 8-fold decrease in ciprofloxacin was observed when 20µg/mL of reserpine was used. A 4-fold and 2-fold decrease in ciprofloxacin was observed for 10µg/mL and 5µg/mL of reserpine respectively.
42
In the case of the E. coli strains the sub lethal doses of goldenseal leaf extract
used were 500, 250 and 125µg/mL. There was a decrease in MIC of ciprofloxacin on E.
coli DH10B/pK21 by 8-fold (0.0075µg/mL) observed for 500µg/mL of goldenseal leaf extract. A 4-fold and 2-fold decrease in MIC of ciprofloxacin seen with 250µg/mL and
125µg/mL of goldenseal leaf extract was observed, respectively. No reduction was
observed in the case of DH10B with goldenseal leaf extract. Reserpine at a concentration
of 20µg/mL exerted a decrease of MIC of ciprofloxacin by 16-fold on the E. coli
DH10B/pK21 and an 8 fold decrease on the DH10B strain with 20µg/mL concentration.
An 8-fold and 4-fold reduction of MIC of ciprofloxacin on E. coli DH10B/pK21 and 4-
fold and 2-fold decrease of MIC of ciprofloxacin on DH10B was observed with 10µg/ml
and 5µg/mL of reserpine respectively.
Table 3.7: MDR pump inhibitory activity of goldenseal leaf extract on NorA strains. All the concentrations are in µg/mL and degree of decrease in MIC is in parenthesis
Antimicrobial SA1199 SA1199B DH10B DH10B/pK21 Ciprofloxacin 0.25µg/mL 8 µg/mL 0.02µg/mL 0.06µg/mL Goldenseal 1000µg/mL 1000µg/mL 1000µg/mL 1000µg/mL Ciprofloxacin + Goldenseal 500µg/mL No change 1µg/mL (8) No change 0.0075µg/mL (8) 250µg/mL 2µg/mL (4) 0.015µg/mL (4) 125µg/mL 4µg/mL (2) 0.03µg/mL (2) Ciprofloxacin + Reserpine 20µg/mL No change 1µg/mL (8) 0.0075µg/mL (8) 0.0037µg/mL(16) 10µg/mL 2µg/mL (4) 0.015µg/mL (4) 0.0075 µg/mL (8) 5µg/mL 4µg/mL (2) 0.03µg/mL (2) 0.015µg/mL (4)
43
The synergy between other antimicrobials and goldenseal leaf extract are shown
in Table 3.8. The sub lethal concentration of goldenseal leaf extract used for the synergy
assay were 250µg/mL and 500µg/mL for SAK2068 and RN4220 and those of reserpine were 20µg/mL for both strains. The assay was also done on the ATCC 25923strain as a
control.
Goldenseal leaf extract exhibited a decrease in the MIC of ciprofloxacin from 4 to
1µg/mL, a 4-fold decrease on the SAK2068, the MATE pump strain. There was also a 4-
fold reduction from 1 to 0.25µg/mL of tetracycline and 2-fold reductions from 0.5 to
0.25µg/mL of erythromycin in synergy with goldenseal leaf extract on the SAK2068. A
reduction of 2-fold in the MIC of ciprofloxacin and erythromycin was observed in the
RN4220, the RND pump strain with goldenseal leaf extract. No change was observed in the MIC of tetracycline on RN4220 with goldenseal leaf extract. Goldenseal leaf extract
showed a 2-fold reduction in the MIC of both, tetracycline and erythromycin on
SA1199B, the MFS pump strain. The synergy effects of goldenseal leaf extract were
comparable to those of reserpine on all the strains at a concentration of 20µg/mL.
The sub lethal dose of goldenseal leaf extract for synergy studies of C. jejuni 81-
176 used was 31.25µg/mL. The MIC of ciprofloxacin against C. jejuni 81-176 was
lowered by 16-fold from 0.313µg/mL to 0.004µg/mL. When the sub lethal dose of
goldenseal leaf extract was lowered to 16µg/mL, an 8-fold decrease in MIC of
ciprofloxacin was observed. Reserpine at a concentration of 20µg/mL showed a 2-fold
decrease in MIC of ciprofloxacin against C. jejuni 81-176. Synergy of goldenseal leaf
extract with tetracycline on C. jejuni 81-176 was not evaluated as the resistance of this
44 strain towards tetracycline id due to a different pump and not conferred by CmeABC (Jun
Lin 2002).
Table 3.8: MDR pump inhibitory activity of goldenseal leaf extract on MDR S. aureus strains. All the concentrations are in µg/mL and degree of decrease in MIC is in parenthesis. The sub lethal dose of goldenseal leaf extract for each stain is half its MIC against the strain given in parenthesis after the strain description. The concentration of reserpine used was 20µg/mL
Antimicrobial SA1199B SAK2068 RN4220 SA25923 C. jejuni 81-176 (500µg/mL) (250µg/mL) (500µg/mL) (500µg/mL) (31.25µg/mL) Goldenseal 1000µg/mL 500µg/mL 1000µg/mL 1000µg/mL 62.5µg/mL Ciprofloxacin 8µg/mL 4µg/mL 0.25µg/mL 0.125µg/mL 0.313µg/mL +Goldenseal 1(8 fold) 1(4 fold) 0.125(2 fold) 0.062(2 fold) 0.0039(16 fold) +Reserpine 1(8 fold) 0.5(8 fold) 0.125(2 fold) 0.062(2 fold) 0.1565(2 fold) Tetracycline 0.25µg/mL 1µg/mL 0.25µg/mL 0.25µg/mL +Goldenseal 0.125(2 fold) 0.25(4 fold) 0.25(none) 0.25(none) - +Reserpine 0.125(2 fold) 0.5(2 fold) 0.125(2 fold) 0.25(none) Erythromycin 0.25µg/mL 0.5µg/mL 64µg/mL 0.125µg/mL 0.078µg/mL +Goldenseal 0.125(2 fold) 0.25(2 fold) 32(2 fold) 0.125(none) 0.0395(2 fold) +Reserpine 0.125(2 fold) 0.5(none) 64(none) 0.125(none) 0.078(none)
3.3.2.2 Agar Diffusion assay:
The agar diffusion assay was performed on the NorA over expresser S. aureus strain SA1199B to demonstrate the synergy between goldenseal leaf extract and ciprofloxacin. The zone of inhibition of different concentrations of ciprofloxacin and goldenseal leaf extract was initially determined. The well containing the ciprofloxacin
(5µg) was then surrounded by wells with different concentrations of goldenseal leaf extract (130µg, 260µg, 390µg and 520µg). The distance between the edges of ZOIs is
45 varied in different plates (Figure 3.2). The deformation in the ZOI of ciprofloxacin towards the ZOI of leaf extract indicates that there may be synergy between goldenseal leaf extract and ciprofloxacin.
i A ii A
Cipro Cipro B D B D D
C C
iii A iv A
Cipro Cipro B D B D D
C C
Figures 3.2: Agar diffusion assay of SA1199B, dist bet ZOI (i) 3mm, (ii) 5mm, iii)7.5mm and (iv)10mm. Wells A-D represent increasing concentrations of leaf surrounding the center well of ciprofloxacin
3.3.3 Quantitative Real-Time RT-PCR:
RNA extraction:
After extraction, only the RNA samples that showed a 260/280 ratios falling between 1.9-2.1 were selected for the polymerization reaction. A formaldehyde gel
46
electrophoresis of the samples showed a double band of RNA without any contaminants
as is characteristic of the RNA.
Real-Time RT-PCR:
The comparative Ct method was employed to analyze the RT-PCR results. Ct
refers to the threshold cycle where the fluorescence of the reporter crosses from linear
into the exponential range.
∆∆Ct = ∆Ct control – ∆Ct unknown sample
∆Ct control = Ct housekeeping – Ct control
Ratio of the sample to the control = 2-∆∆Ct
The 2-∆∆Ct values were interpreted as follows: for values less than 1, the treatment
caused the sample to have a 2-∆∆Ct value lower than the reference (housekeeping)
indicating a decrease in MDR pump gene expression; values equal to 1 mean that the
sample had the same 2-∆∆Ct as the reference and thus no change in gene expression
between treatment and non-treatment; and values of greater than 1 indicate the treatment
caused the sample to have a greater 2-∆∆Ct value than the reference, meaning an increase
in MDR pump gene expression compared to untreated bacteria.
The 2-∆∆Ct of the NorA strains SA1199 and SA1199B both treated and untreated with goldenseal leaf extract or reserpine are given in Table 3.9. The 2-∆∆Ct values of the
wild type NorA SA1199 remained unchanged for both the treated and untreated samples.
The 2-∆∆Ct of SA1199B bacteria treated with 20µg/mL reserpine was less than 1 and
significantly different from those of the untreated bacteria (p < 0.05) indicating a gene
47 repression. At lower doses reserpine exerted an increase in the gene expression with significantly different from the untreated bacteria. The 2-∆∆Ct of SA1199B bacteria treated with goldenseal leaf extract are less than one for all the three doses, 500µg/mL,
250µg/mL and 125µg/mL indicating a decrease in the norA gene due to treatment with goldenseal leaf extract. In comparison to the untreated bacteria and bacteria treated with reserpine, the gene repression by goldenseal was highly significant (p < 0.01).There was a general increase in the 2-∆∆Ct values as the dose of the goldenseal decreased.
Table 3.9: 2-∆∆Ct of S. aureus NorA strains
EPI 2-∆∆Ct SA1199 2-∆∆Ct SA1199B Reserpine 20µg/mL 1 0.82 10µg/mL 1 1.04 5µg/mL 1 1.30 Goldenseal leaf extract 500µg/mL 1 0.23 250µg/mL 1 0.34 125µg/mL 1 0.53 n=6
The norA strains SA1199 and SA1199B were also treated with sub lethal doses of ciprofloxacin and berberine sulfate and subjected to real-time RT-PCR. No difference in the 2-∆∆Ct of treated and untreated samples was observed.
The real-time RT-PCR results of other MDR strains are listed in Table 3.10. The concentration of goldenseal leaf extract used for SAK2068 was 250µg/mL, for RN4220 was 500µg/mL, and for C. jejuni 81-176 was 31.25µg/mL. The concentration of reserpine used was 20µg/mL. The 2-∆∆Ct of the mepA of the MATE MDR strain, SAK2068 treated
48
goldenseal leaf extract* or reserpine^ were both less than 1 showing significant decrease
in gene expression (*p < 0.01, ^p < 0.5). But the 2-∆∆Ct of SAK2068 treated with
goldenseal was much lower than that of the SAK2068 treated with reserpine (p < 0.05).
The results suggest that the mepA gene expression was reduced more with goldenseal leaf
extract compared to reserpine. Similar results were observed in RN4220, the 2-∆∆Ct of
RN4220 treated with goldenseal leaf extract was significantly lower than that of reserpine
(p < 0.05), indicating a higher repression of msrA with goldenseal leaf extract compared to reserpine. The 2-∆∆Ct of bacteria treated with reserpine remained 1 indicating no change
in gene expression while those treated with goldenseal leaf extract showed a 2-∆∆Ct of less
than 1 indicating a gene repression exerted by goldenseal leaf extract. The level of gene
repression by goldenseal leaf extract is shown in Figure 3.3.
The 2-∆∆Ct of C. jejuni 81-176 treated with goldenseal leaf extract was
significantly lower than that of the untreated bacteria (p < 0.01) while the 2-∆∆Ct of reserpine was similar to those of the untreated bacteria.
Table 3.10: 2-∆∆Ct values of the MDR bacteria
EPI SA1199B SAK2068 RN4220 C. jejuni 81-176 (MFS) (MATE) (RND) (RND) Leaf extract 0.23 0.19 0.27 0.184 Reserpine 0.82 0.71 0.58 1 n=6
49
The real-time RT-PCR was also done on RNA extracted from SAK2068, RN4220 and C. jejuni 81-176 bacteria treated with sub lethal doses of ciprofloxacin or berberine
sulfate. No change was observed.
Figure 3.3: Effect of goldenseal on the gene expression of MDR pump genes n=6, *p<0.01, ^p<0.05
3.3.4 Ethidium Bromide Uptake:
The Ethidium Bromide (EtBr) uptake of bacteria without any EPI is shown in the
chart in Figure 3.4: The wild type NorA strain showed a steady increase in fluorescence
indicating accumulation of EtBr in the bacteria, which normalized after a time. All the other MDR bacteria showed an increase in initial EtBr uptake and after an interval there
50
is a decrease in fluorescence. This might indicate the efflux of EtBr by the the MDR efflux pumps.
EtBr uptake by bacteria
150 SA1199 SA1199B SAK2068 100 RN4220 50 Fluorescence in arbitrary units arbitrary in Fluorescence 0 0 20 40 60 Time in min
Figure 3.4: Ethidium bromide uptake of S. aureus strains n=6
The effect of reserpine and goldenseal leaf extract on the bacteria is shown in the
charts in Figures 3.5 and 3.6. Compared to the absence of any EPI, reserpine significantly
showed an increase in the fluorescence in all the MDR bacteria (p <0.05) which after a
time still increases but at a very slow rate. This was true in the case of SA1199 wild type
strains also, which also shows a sharp accumulation initially and then a gradual slow
increase in fluorescence.
The effect of goldenseal leaf extract is shown in the chart in Figure 3.6.
Goldenseal leaf extract showed an opposite effect of reserpine. The goldenseal leaf
51
extract did not show any effect on the EtBr uptake in the wild type SA1199, which showed a similar line as in with just the SA1199 bacteria without EPIs. Similar was the case with the MDR bacterial strains on which the goldenseal leaf extract did not show an increase in the EtBr accumulation. One deviation observed was the sudden sharp increase and decrease in fluorescence in the case of the MsrA pump RN4220.
Effect of Reserpine on EtBr uptake by bacteria
200 SA1199 SA1199B
150 SAK2068 Reserpine RN4220 100 50 Fluorescence in arbitrary units arbitrary in Fluorescence 0 0 20 40 60 Time in min
Figure 3.5: Effect of reserpine on EtBr uptake of S. aureus strains, reserpine was added 10 min after EtBr exposure. n=6
52
Effect of Goldenseal on EtBr uptake by bacteria 150 SA1199 Goldenseal SA1199B
100 SAK2068 RN4220
50 Fluorescence in arbitrary units arbitrary in Fluorescence 0 0 20 40 60 Time in Min
Figure 3.6: Effect of goldenseal leaf extract on EtBr uptake of S. aureus strains, extract was added 10 min after exposure to EtBr, n=6
The EtBr uptake by C. jejuni 82-176 bacteria is shown in the chart in Figure 3.7.
The EPIs were added 10 min after the bacteria had been exposed to EtBr. All the three samples showed a similar increase in fluorescence initially. After 10 min the fluorescence of the untreated C. jejuni 81-176 stopped increasing and decreased slightly after 50 min and leveled again. The bacteria to which reserpine was added continued to show a significant increase (p < 0.05) in comparison to the bacteria without EPIs in fluorescence before falling slightly at 50 min. The bacteria treated with goldenseal leaf extract however showed a significant decrease in the fluorescence right after it was added and continued decreasing before leveling off at 40 min in comparison to the bacteria without any EPI.
53
EtBr uptake of C. jejuni 81-176
40 EPI 81-176 + Reserpine
81-176 + Goldenseal
30 81-176 20 10 Fluorescence in arbitrary units arbitrary in Fluorescence 0 0 20 40 60 80 100 Time in min
Figure 3.7: Effect of goldenseal leaf extract and reserpine on the EtBr uptake of C. jejuni 81-176 bacteria n=6
3.3.5 Ethidium Bromide efflux:
For the EtBr efflux studies the bacteria had to be first primed with an EPI such as reserpine which would enable the bacteria to accumulate EtBr without effluxing it out.
These bacteria were then washed and resuspended in fresh medium without any EPI. The efflux of EtBr from the bacteria was then observed along with the effect of reserpine
(20µg/mL) and goldenseal leaf extract (500µg/mL) on the efflux of ethidium bromide from the bacteria.
54
Ethidium bromide efflux in S. aureus strains 150 SA1199 SA1199B + goldenseal 100 SA1199B SA1199 + reserpine
50 Fluorescence in arbitrary units arbitrary in Fluorescence 0 0 5 10 15 20 25 Time in min
Figure 3.8: Ebro efflux of strains SA1199 and SA1199B in the presence and absence of MDR pump inhibitors n=6
Proserpine inhibited the efflux of Ebro as indicated by no decrease in fluorescence in the SA1199B (Figure 3.8). While goldenseal leaf extract did not inhibit the Ebro efflux, as the fluorescence decreased gradually with time. There was no effect of reserpine or goldenseal leaf extract on the efflux of EtBr from the wild type SA1199 bacteria.
55
3.4 Discussion
Goldenseal leaf extract, though limited in its antimicrobial activity, potentates the
activity of other antimicrobials. There was a higher EPI activity of goldenseal leaf extract
observed on the SA1199B (NorA- MFS pump super family) and the SAK2068 (MepA-
MATE pump super family) with more than 4-fold decrease in the MIC of ciprofloxacin
seen. Limited activity was seen against the MsrA pump (RND pump super family)
carrying RN4220 with only a 2-fold decrease in the MIC of macrolide tested
(erythromycin).
Goldenseal leaf extract increases the susceptibility of the CmeABC pump
carrying strain of C. jejuni: 81-176 towards ciprofloxacin and erythromycin, by repressing the gene encoding the pump. Goldenseal leaf extract decreases the MIC of ciprofloxacin on C. jejuni by 16 folds.
The MDR pump inhibitory activity of n leaf extract at half MIC was comparable to that of reserpine. Reserpine has been demonstrated by other groups as an inhibitor of
various MDR pumps including the P-glycoprotein, NorA and MepA (Kaatz, 2006).
Reserpine at the concentrations required to obtain the desired MDR pump inhibitory
activity has been cited to have some side effects such as neurotoxic effects (Moudgal,
2003). The use of goldenseal leaf extract as an EPI could overcome this problem.
Currently many groups are trying to develop EPIs to market as combination therapies.
There are many ways an EPI could act on the MDR pump, three main possibilities are: reduction in mRNA production (gene repression), interference in the protein pump function, and/or changing the biochemical structure of the protein pump. The real-time
56
RT-PCR and ethidium bromide studies were conducted to analyze this property.
Reserpine reduces NorA mediated EtBr efflux as is demonstrated by the EtBr studies. In
similar assay the goldenseal leaf extract did not show any effect on the EtBr efflux by the
NorA pump.
The mRNA production was determined after incubating the bacteria with sub
lethal doses of goldenseal leaf extract with the MDR bacteria. There was a decrease in the mdr genes of all the MDR bacteria and C. jejuni. This indicates that there was gene repression seen when the bacteria were exposed to goldenseal leaf extract. Reserpine showed an opposite effect on the MDR bacteria. While it reduces the efflux pump mediated EtBr efflux, there was no significant change in gene expression of the mdr genes.
The conclusion that can be derived from these observations is that goldenseal increases the susceptibility of the MDR bacteria to different antimicrobials by decreasing the mRNA production of the MDR pump genes and does not affect the pump efflux.
There maybe one or more components in the crude goldenseal leaf extract which causes
these effects on the bacteria.
Specifically in the case of the MsrA pump of S. aureus, belonging to the RND
family, until recently no known EPI was available, in 2007, diterpene totaral has been
shown to inhibit the pump (Kaatz, 2007). Goldenseal exhibited an inhibition of this pump
as indicated by the result of synergy studies. Further evaluation of goldenseal leaf extract on the Gram- negative bacteria C. jejuni that carries the MDR pump CmeABC and MsrA pump of S. aureus, both of which belong to the RND family determine that goldenseal
57 leaf extract has a higher synergistic activity on the CmeABC pump when compared to the
MsrA pump. A more thorough analysis is required to understand the variations in the effect of goldenseal on pumps belonging to the same family in both Gram positive and
Gram negative bacteria.
58
Chapter 4
Separation and Identification of Goldenseal Leaf Extract Constituents
4.1 Introduction
Many active compounds have been previously reported in goldenseal including
alkaloids berberine, hydrastine and canadine (Figure 1.6), secondary metabolites such as protoanemonin and glycosides, berberastine, meconin, chlorogenic acid, phytosterins, and resins, albumin, starch, fatty acids, sugars, lignins, and volatile oils. (Van Berkel,
2007). Berberine extracts and salts have been demonstrated to exhibit growth inhibition
of intestinal parasites like Giardia lamblia, Entamoeba histolytica, Trichomonas
vaginalis, (Kaneda, 1990) and Leishmania donovani, (Abidi, 2005) with crude extracts
being more effective than berberine salts (Kong, 2004).
Canadine is known for its sedative and muscle relaxant properties. The third alkaloid hydrastine is a valuable drug for treatment of skin diseases, both taken internally and used as topical applications. It is especially useful as a stomachic tonic, and as a hepatic stimulant in cutaneous infections. It exhibits better activity when used as a topical application than taken internally (Beckstrom-Sternberg, 1997).
Two new C-methyl flavonoids, 6,8-di-C-methylluteolin 7-methyl ether and 6-C- methylluteolin 7-methyl ether have been isolated and have activity against oral pathogens such as Streptococcus mutans and Fusobacterium nucleatum (Hwang, 2003).
Quinic acid feruloyl esters have also been identified and their activity against
59
Mycobacterium tuberculosis was evaluated but showed no significant effect (Gentry,
1999).
The objective of this study was to isolate and identify the constituent(s) in goldenseal leaf extract which may be associated with the MDR efflux pump inhibitory activities previously observed.
4.2 Materials and Methods
4.2.1 Goldenseal Leaf Extract Sample
The goldenseal leaf extract was supplied by the Sleepy Hollow Farm and it was a
60% grain alcohol extract with a dry weight of 13mg/mL. A volume of 1mL of the
goldenseal leaf extract was concentrated in using a Speed-Vac and then its final
concentration adjusted to 130mg/mL with 60% grain alcohol.
4.2.2 Bacterial Strains
The S. aureus strains, SA1199B, SAK2068 and RN4220 were used to test for
growth inhibition using thin-layer chromatography (TLC) bioautography were provided
by Dr. Glen Kaatz (Wayne State University School of Medicine, Detroit, MI). The
bacteria were maintained in Mueller Hinton II (MH II) (BD-Difco) medium at 35°C
under aerobic conditions.
4.2.3 Thin Layer Chromatography (TLC)
Preparative thin layer silica gel based glass plates (size 20cm × 20cm) (EMD
Chemicals) incorporated with a fluorescent indicator F254 were used for the separation of
goldenseal leaf extract constituents. Different amounts of the concentrated goldenseal
60
leaf extract (1.3mg, 2.6mg and 3.9mg) and berberine sulfate (0.067mg, 0.134mg and
0.201mg) were spotted onto the TLC plates and developed in ascending phase. Four
different solvent systems, i.e. ethyl acetate:methanol (1:1), acetone:ethanol (1:1), butanol:acetic acid/water (7:1:2) and chloroform:methanol (9:1) were tested to determine the best solvent system for separation. The TLC chamber was filled with the solvent mixture, lined with filter paper and allowed to saturate. Spotted TLC plates were then
placed vertically in the chamber and allowed to develop for 15cm. The plates were then
removed and allowed to dry and observed under the fluorescent light immediately. All
the solvents were obtained from OmniSolv EMD Chemicals.
4.2.4 Bioautographic Studies:
To test the antimicrobial activity of various constituents separated on the TLC
plates, TLC bioautographic assay was done as described previously (Choma, 2005) with
slight modifications. The developed TLC plates were dried in the 37°C oven for 4 hours.
The plates were then sprayed with 108cell/mL of the bacteria to be tested, with or without
a sub lethal dose of ciprofloxacin. The plates were then incubated for overnight at 35°C in a humidified box to prevent the plates from drying. The incubated plates were then
sprayed with 2mg/mL triphenyl tetrazolium chloride (TTC) salt solution and incubated at
37°C for 4hrs and TTC was used to facilitate the detection of the zone of inhibition (ZOI) of the bacteria.
4.2.5 Sample Preparation For Analysis:
Five concentrated goldenseal samples (13mg each) were spotted onto the TLC plate and developed in chloroform/methanol (9:1) solvent system. Identical bands among
61 the 5 lanes on the developed TLC silica gel were scraped off, resuspended in the same solvent mixture, and pooled together. Each pooled sample was then vortexed and filtered through 1.2 followed by 0.2µ PTFE syringe filters.
4.2.6 Gas Chromatography/Mass Spectrometry (GC/MS)
An Agilent 7890 GC system interfaced with an Agilent 5975 mass selective detector was used (Agilent Technologies, Newark DE). GC/MS analysis of each of the pooled sample was conducted by injecting 2µL HP-5 MS column (30m x 250µm,
0.25µm). Gas chromatographic operating conditions were as follows: split injection mode; injector temperature, 250 °C oven temperature, 80°C for 6 min, then programmed at 5°C/min to 130 °C, and held for 5 min and then 15°C/min to 300°C. The carrier gas was helium set at a constant flow of 0.4mL/min. The mass spectrometer was turned on at
4min. The mass range scanned was 35-500 amu and the source temperature, 250 °C.
Mass spectral data were processed using the Agilent GC/MSD ChemStation software.
4.2.7 Liquid Chromatography/Mass Spectrometry (LC/MS)
LC/MS analysis was performed on an Agilent 6100 series LC/MS in which a quadruple mass spectrometer was coupled to an Agilent 1200 HPLC (Agilent
Technologies, Newark DE) that consisted of a G1329A high performance autosampler
(HP-ALS-SL), a G1312A binary pump (BIN-SL), a G1379B vacuum degasser, a
G1316A thermostatted column compartment (TCC-SL) and a G1314B variable wavelength detector (VWD-SL). The quadruple mass spectrometer was operated with an atmospheric pressure electrospray ionization (API-ES) source in positive mode. The flow rate of HPLC was maintained at 1 mL/min through a Kromasil RP C18 column ( column
62 size of 150mm × 4.6mm p 5µm particle size, Alltech Associates, Inc. Deerfield, IL). The mobile phase is an isocratic elution consisted of methanol and water (v/v=87:13) containing 0.1% H3PO4. Mass spectra were recorded within the m/z range of 100-1000.
The dry gas flow for the MS was 13.0 L/min, the nebulizer pressure was 30 psi, dry gas temperature was 350°C, and the Vcap voltage was 3500 V. Data was acquired from the and processed by the Agilent LC/MSD ChemStation software.
4.3 Results
4.3.1 TLC:
Four different solvent systems were evaluated for the separation: chloroform/methanol (9:1), butanol:acetic acid:water (7:1:2), acetone:ethanol (1:1) and ethyl acetate:methanol (1:1) (Figure 4.1). Better separation was achieved with chloroform/methanol with 10 bands resolved on the TLC plate. Separation was also good on the butanol/acetic/acid/water plate, while the other two solvent systems did not yield satisfactory separation.
63
* #
*
*
*
a b c d
Figure 4.1: TLC separation of goldenseal leaf extract using (a) ethyl acetate:methanol, (b) acetone:ethanol, (c) butanol:acetic acid/water and (d) (c) chloroform: methanol * band of berberine # hydrastine (identified by GC/MS)
Separation of goldenseal leaf extract yielded in the appearance of 10 bands with
the chloroform:methanol (9:1) solvent system. The third band (Rf =0.4) was the berberine
alkaloid and the seventh band (Rf =0.76) was identified by GC/MS analysis as the
hydrastine alkaloid.
4.3.2 TLC Bioautography:
Triphenyl tetrazolium chloride (TTC) salt is a dehydrogenase sensitive
compound. The dehydrogenases produced by live cells convert TTC to a brightly colored
formazon. This property helps in observing the clear zone-of-inhibition which resulted from cell death due to antimicrobial activity by individual constituents present in
64
goldenseal leaf extract by themselves or in synergy with sub lethal dose of ciprofloxacin
(Figure 4.2).
a bc
Figure 4.2: Zone of inhibition (ZOI) of a) goldenseal leaf extract, (b) berberine sulfate and (c) ciprofloxacin prior to separation
Of all the solvent systems, bacteria were able to grow only on the TLC plates
developed in chloroform:methanol solvent system. Identification of active compounds in goldenseal leaf extract was not possible on TLC plates developed in the other solvent systems as the bacteria sprayed on these plates did not survive.
Goldenseal leaf extract showed a ZOI before separation by chloroform/methanol but no zones of inhibition were observed after separation with chloroform/methanol
(Figure 4.2). Berberine sulfate and ciprofloxacin gave rise to zones of inhibition before
and after development of the TLC plates. TLC plates of goldenseal leaf extract (1.3mg,
2.6mg and 3.9mg) developed in chloroform:methanol then sprayed with bacterial
suspension of NorA over expresser SA1199B, seeded with sub lethal dose of
ciprofloxacin (1µg/mL, one eighth of its MIC) gave rise to 4 ZOIs. These ZOIs were not
caused by the band where berberine typically is located at but other components (Figure
4.3). This was confirmed by developing TLC plates spotted with an equivalent
65 concentration of berberine sulfate (0.067mg, 0.134mg and 0.201mg) as to that of the goldenseal leaf extract.
* * **
1 2 3 4
Figure 4.3: TLC bioautographic studies of SA1199B: • Plate 1:SA1199B sprayed on developed TLC plate spotted with goldenseal leaf extract • Plate 2: SA1199B + sub lethal dose of ciprofloxacin on developed TLC plate spotted with goldenseal leaf extract • Plate 3: SA1199B sprayed on developed TLC plate spotted with beberine sulfate in equivalent concentration to that in the leaf extract spotted in earlier plates • Plate 4: SA1199B + sub lethal dose of ciprofloxacin sprayed on developed TLC plate spotted with beberine sulfate in equivalent concentration to that in the leaf extract spotted in earlier plates * Band of berberine
66
ZOIs were also seen on bioautographic TLC plates with other MDR bacteria.
Table 4.1 lists the retention factors (Rf) of the bands around which zones of inhibition were observed. The number of zones of inhibition was different for different bacteria.
Table 4.1: ZOIs on TLC plates sprayed with indicator bacteria seeded with sub lethal dose of ciprofloxacin
Band Rf ZOI on SA1199B ZOI on SAK2068 1 0.13 Yes Yes 2 0.33 Yes No 3 0.41 Yes No 4 0.58 Yes Yes 5 0.66 Yes Yes
67
Berberine
Figure 4.4: Number of ZOIs on SA1199B + sub lethal dose of ciprofloxacin sprayed on developed TLC plate spotted with goldenseal leaf extract and developed in chloroform:methanol (9:1)
There were 3 ZOIs seen on TLC plates for SAK2068 (Figure 4.6) when sprayed with bacterial suspension seeded with sub lethal dose of ciprofloxacin. No ZOIs were observed when the developed TLC plate was sprayed with RN4220 seeded with sub lethal dose of ciprofloxacin.
68
ZOI-5
ZOI-4
Berberine ZOI-1
Figure 4.5: TLC bioautographic studies of SAK2068: • Plate 1: SAK2068 sprayed on developed TLC plate spotted with goldenseal leaf extract • Plate 2: SAK2068+ sub lethal dose of ciprofloxacin on developed TLC plate spotted with goldenseal leaf extract
4.3.3 GC/MS:
The five active bands (Figure 4.4) isolated from the TLC plate developed in chloroform:methanol were analyzed in GC/MS. The presence of hydrastine (band 7 on
TLC) in the goldenseal leaf extract was confirmed by the GC/MS. No other compounds were detected by GC/MS possibly due to lack of volatility of the compounds.
4.3.4 LC/MS: * *
In the spectra of LC/MS1 analysis of bands2 causing ZOI on the TLC plate, more than one compound appeared to be present in the samples. The list of possible compounds associated with ZOI bands, with their retention time, is given in Table 4.2.
69
Table 4.2: List of compounds predicted by LC/MS data
Peak Retention List of possible compounds CAS time number 1 5.349 1. Oxayohimban-16-carboxylic acid, 483-04-5 min 16,17-didehydro-19-methyl-, methyl ZOI-1 ester, (19α)-(ajmalicine) 2034-69- 2. 2H-1-Benzopyran-2-one, 7-hydroxy-6- 7 methoxy-3-[(2-oxo-2H-1-benzopyran- 7-yl)oxy]- (coumarin) 2 6.576 1. 2,6-Pyridinedicarboxylic acid, 4-[2- 94272- min (2,3-dihydro-1H-indol-1-yl)ethenyl]-, 40-9 dimethyl ester, (E)- (9CI) (betalain) 1 5.929 1. (E)-Secocholest-1(10)-EN-3,5- Dione - min 2. Tricyclo[10.2.2.25,8]octadeca- 87387- 5,7,12,14,15,17-hexaene-6,17- 04-0 ZOI-2 diacetonitrile, 13,15- bis(dimethylamino)-, stereoisomer 2 9.173 1. Estra-1,3,5(10)-trien-17-one, 3,11- 69688- min bis[(trimethylsilyl)oxy]-, (11β)- (9CI) 38-6 2. 5, 10-dihexyl-5, 10-dihydroindolo[3, 2- - B] 64042- 3. 1(3H)-Isobenzofuranone, 3,3'-(4,6- 52-0 dimethoxy-1,3-phenylene)bis[3- - methyl- (9CI) 4. Dimethyl 2-(1’, 4’-dimethoxy-9’, 10’ - dioxo ZOI-3 0 - No peaks were observed in the third band - during LC/MS analysis ZOI-4 1 9.161 1. 2-[3-methyl-6-(1-methylethenyl)-2- - min cyclohexan ZOI-5 1 9.234 1. 13-oxa-16-aza- - min hexacyclo[9.6.3.2.[4.7]0[1
70
4.4 Discussion
The TLC bioautographic studies clearly indicated that one or more constituents in goldenseal leaf extract act in synergy with ciprofloxacin in increasing its potency towards
MDR bacteria. The MDR strains SA1199B (NorA) and SAK2068 (MepA) showed ZOIs on the developed TLC plates spotted with goldenseal leaf extract, then sprayed with sub lethal dose of ciprofloxacin and indicator bacteria. No ZOI was exhibited by the RN4220 strain which might be due to the fact that the concentration of the potential EPI might not be enough or the synergistic activity is due to more than one component.
None of these constituents which caused the ZOIs could be detected by GC/MS, possibly due to the volatility of the compounds, as they might be non-volatile and many of the active components of goldenseal cannot be analyzed using GC/MS. Berberine is one such example which cannot be detected by GC/MC (Weber H, 2003). Further analysis involving derivitization of these compounds is involved in order to assay using
GC/MS.
The samples detected by LCMS had one or more peaks typical to the presence of one or more compounds. Most notable of these is the alkaloid ajmalicine, produced by many other plants such as Rauwolfia serpentina (Bein, 1956). One interesting fact to be noted is that reserpine is also an alkaloid produced by the Rauwolfia sps (Saxena, 2009).
The anti tumor properties of ajmalicine has been evaluated by one group (Xiuwei, 2009).
Another compound, estra, is known to be used as a contraceptive. Coumarin another compound detected by LC/MS, has been reported for its anticoagulatory properties and
71 its potential application in medicine (Wang, 2006). Another compound betalain, used as a red colored dye, is also being investigated for its anti-tumor activity (Zakharova, 2000).
The other compounds which could not be identified by LC/MS need to be further analyzed as they could be derivatives of some known compounds and their activity assayed.
72
Conclusion
Multi-drug-resistance due to efflux pumps in bacteria has become an important
problem that needs to be addressed urgently. The study of efflux pump inhibitors
suggests new applications in the treatment of multi-drug-resistant bacterial infections.
Several efflux pump inhibitors have been identified, some are being investigated on
clinical trials and some cannot be used due to harmful side effects. The identification and
development of safe and effective inhibitors of bacterial efflux pumps is needed. Plants
can be excellent sources for efflux pump inhibitors and this source needs to be
investigated thoroughly for the identification of potential efflux pump inhibitors.
Alternative therapy for the treatment of infections caused by different micro organisms has been applied since ancient times, especially using phytochemicals. Goldenseal is one such phytochemical which has been used for different ailments.
The goal of this project is to evaluate the antimicrobial activity and possible multi-drug efflux pump inhibitory effects of crude grain alcohol goldenseal leaf extract.
The antimicrobial properties of the goldenseal leaf extract were determined. It is evident that one or more constituents in the extract work in synergy to produce the antimicrobial effect. It is also evident that L. acidophilus, a human intestinal beneficial bacterium, although equally susceptible to berberine, ciprofloxacin, and reserpine when compared to the pathogens evaluated, it is much less susceptible to goldenseal. This is favorable since
the impacts on the beneficial microflora exerted by therapeutic agents should be
minimized. The efflux pump inhibitory activities of goldenseal leaf extract were
73 evaluated with results indicating that goldenseal leaf extract increases the susceptibility of the MDR bacteria towards various antimicrobials. Some of these bacteria overexpress
MDR pumps which belong to different MDR pump superfamilies. Goldenseal leaf extract effectively decreased the MIC of ciprofloxacin against the pumps NorA (MFS) and
MepA (MATE) in S. aureus (≥ 4 folds) and CmeABC (RND) in C. jejuni (16 folds).
Synergy studies of the goldenseal leaf extract clearly indicate that it represses the genes encoding for these MDR efflux pumps, which is in contrast to that of reserpine.
Reserpine shows a very limited or no gene repression of these MDR pumps. These synergy studies also indicate that reserpine inhibits the protein MDR pump by interfering with its function and goldenseal leaf extract does not show this property. This property of goldenseal leaf extract has to be further evaluated as it is the balanced overall effects of its constituents rather than the effects of individual constituent are being observed.
Subsequent isolation, and evaluation of purified individual constituent is required for insight into the mechanism of action in order to optimize the use of such agents to overcome multi-drug resistance.
The resistance of C. jejuni to multiple drugs is not due to its overexpression of
CmeABC pumps (Mamelli, 2005) but it may work in synergy with other mutations to confer the resistance. Goldenseal leaf extract seems to overcome all these factors since it effectively decreases the MIC of ciprofloxacin and erythromycin by at least 2 folds. It also decreases the MIC of erythromycin in the MsrA pump (RND) carrying strain of S. aureus by at least 2 folds. As previously mentioned, no EPI that inhibits the MsrA pump efflux has been identified until recently (Kaatz, 2007). Kaatz et al have identified a
74
compound diterpene totarol which they have shown to inhibit MsrA efflux. Goldenseal
leaf extract shows an efflux pump inhibitory activity against both the RND pumps used in
this study, i.e., MsrA of S. aureus and CmeABC of C. jejuni. The positive control used
for the efflux pump inhibitory activity, reserpine did not inhibit either of these pumps.
Lastly, an initial separation and identification of the constituent(s) responsible for this behavior was attempted. The TLC bioautographic studies indicated more than one band that showed a possible anti efflux pump activity against the NorA (MFS) and MepA
(MATE) pump carrying strains of S. aureus. No active bands could be isolated with the
MsrA pump strain of S. aureus, indicating that one or more constituents maybe acting
together to show the inhibition.
Further studies are needed to purify, identify, and characterize these specific
constituents. The evaluation and characterization of these individual constituents could
lead to the development of combination therapies that combine goldenseal constituents
and therapeutic agents with improved antimicrobial qualities, i.e., increased potency with
reduced side effects, for use in clinical trials to treat multi-drug resistant bacterial infections.
75
References:
1. Abidi P, Chen W, Kraemer FB, Li H, Liu J. The medicinal plant goldenseal is a
natural LDL-lowering agent with multiple bioactive components and new action
mechanisms: J Lipid Res. 2006 Oct;47(10):2134-47.
2. Allos BM. Association between Campylobacter infection and Guillain-Barré
syndrome. J Infect Dis 1997;176:S125-8.
3. Ambudkar, S. Dey, C.A. Hrycyna, M. Ramacandra, I. Pastan and M.M.
Gottesman, Biochemical, cellular and pharmacological aspects of the multidrug
transporter, Annu Rev Pharmacol Toxicol 39 (1999), pp. 361–398.
4. Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M., Pastan, I., and
Gottesman, M.M. (1999) Biochemical, cellular, and pharmacological aspects of
the multidrug transporter. Annu Rev Pharmacol Toxicol 39: 361–398.
5. American Herbal Pharmacopoeia and Therapeutic Compendium. Goldenseal Root
(Hydrastis canadensis): Standard of Analysis, Quality Control, and Therapeutics.
Santa Cruz, CA: 2001. p. 10-18.
6. Archer GL, Scott J. Conjugative transfer genes in staphylococcal isolates from the
United States. Antimicrob Agents Chemother 1991;35:2500–4.
7. Archer LG, Staphylococcus aureus: A Well-Armed Pathogen Clinical Infectious
Diseases 1998;26:1179–81.
8. Bein HJ. The pharmacology of Rauwolfia. Pharmacol Rev. 1956 Sep;8(3):435-83.
76
9. Beneveniste. R, Davies. J, 1973, Mechanisms of Antibiotic Resistance in
Bacteria. Annual Review of Biochemistry 42;471-506.
10. Birdsall TC, Kelly GS. Berberine: Therapeutic potential of an alkaloid found in
several medicinal plants. Altern Med Rev 1997;2:94-103.
11. Blumberg HM, Rimland D, Carroll DJ et al. Rapid development of ciprofloxacin
resistance in methicillin-susceptible and –resistant Staphylococcus aureus. J
Infect Dis 1991; 163: 1279–85.
12. Borchers AT, Keen CL, Stern JS, Gershwin EM. Am J Clin Nutr 2000;72:339–
347.
13. Borgess-Walmsley, M. I., K. S. McKeegan, and A. R. Walmsley. 2003. Structure
and function of efflux pumps that confer resistance to drugs. Biochem.J. 376:313–
338.
14. Borges-Walmsley MI, McKeegan KS, Walmsley AR. Structure and function of
efflux pumps that confer resistance to drugs. Biochem J. 2003 Dec 1;376(Pt
2):313-38.
15. CDC. Staphylococcus aureus resistant to vancomycin. Morbid Mortal Weekly
Rep 2002; 51: 565–7.
16. Chambers, H.F. 2001. The changing epidemiology of Staphylococcus aureus?
Emerg. Infect. Dis. 7:178–182.
17. Chung YJ & Saier Jr MH (2001) SMR-type multidrug resistance pumps. Curr
Opin Drug Disc 4: 237–245.
77
18. Coronado VG, Edwards JR, Culver DH et al. Ciprofloxacin resistance among
nosocomial Pseudomonas aeruginosa and Staphylococcus aureus in the United
States. Infect Control Hosp Epidemiol 1995; 16: 71–5.
19. DeLeo FR, Chambers HFReemergence of antibiotic-resistant Staphylococcus
aureus in the genomics era. J Clin Invest. 2009 Sep;119(9):2464-74.
20. Doern, G.V. et al., 2001. Antimicrobial resistance among clinical isolates of
Streptococcus pneumoniae in the United States during 1999_2000, including a
comparison of resistance rates since 1994-1995. Antimicrobial Agents and
Chemotherapy 45(6)1721-1729.
21. Edwards DJ, Draper EJ. Variations in alkaloid content of herbal products
containing goldenseal. J Am Pharm Assoc (Wash DC). 2003 May-Jun;43(3):419-
23.
22. Eileen C. J. Smith, Glenn W. Kaatz, Susan M. Seo, Neale Wareham, Elizabeth M.
Williamson, and Simon Gibbons. The Phenolic Diterpene Totarol Inhibits
Multidrug Efflux Pump Activity in Staphylococcus aureus. Antimicrob Agents
Chemother. 2007 December; 51(12): 4480–4483.
23. Esposito S, Noviello S. In-vitro sensitivity of amoxicillin/clavulanic acid
(Augmentin) to isolated beta-lactamases and in-vitro antibacterial activity. J
Chemother. 1990 Jun;2(3):167-70.
78
24. Foster, S. 2000. Goldenseal, Hydrastis canadensis: Goldenseal's future. Steven
Foster Group, Fayetteville, AR,
Websitewww.herbphoto.com/education/monograph/goldenseal.html
25. Gentry EJ, Jampani HB, Keshavarz-Shokri A, Morton MD, Velde DV, Telikepalli
H, Mitscher LA, Shawar R, Humble D, Baker W Antitubercular natural products:
berberine from the roots of commercial Hydrastis canadensis powder. Isolation of
inactive 8-oxotetrahydrothalifendine, canadine, beta-hydrastine, and two new
quinic acid esters, hycandinic acid esters-1 and -2. J Nat Prod. 1998
Oct;61(10):1187-93.
26. Choma I, Antibiotics: Analysis by TLC: Encyclopedia of Chromatography, 2005.
27. Georgiev, Membrane transporters and antifungal drug resistance, Curr Drug
Targets 1 (2000), pp. 261–284.
28. Ghosh AK, Bhattacharyya FK, Ghosh DK. Leismania donovani: amastigote
inhibition and mode of action of berberine. Exp Parasitol 1985;60:404-413.
29. Gibreel, A., and D. E. Taylor. 2006. Macrolide resistance in Campylobacter jejuni
and Campylobacter coli. J. Antimicrob. Chemother. 58:243–255.
30. Govindan M, Govindan G. A convenient method for the determination of the
quality of goldenseal. Fitoterapia . 2000;71(3):232-235.
31. Grieve, M. A Modern Herbal. Dover Publications, Inc.; New York, NY: 1971.
32. Hancock, R. E. W. (1997). The bacterial outer membrane as a drug barrier.
Trends Microbiol. 5: 37-42.
79
33. Hancock, R. E. W. (1998). Resistance mechanisms in Pseudomonas aeruginosa
and other non-fermentative bacteria. Clin. Infect. Dis. 27 (Suppl.1):S93-S99.
34. Harnett N, Brown S, Krishnan C. Emergence of quinolone resistance among
clinical isolates of methicillin-resistant Staphylococcus aureus in Ontario,
Canada. Antimicrob Agents Chemother 1991; 35: 1911–13.
35. Hooper, D.C. (2000). Mechanisms of action and resistance of older and newer
fluoroquinolones. Clin. Infect. Dis. 31 (Suppl. 2):S24-S28.
36. Hwang BY, Roberts SK, Chadwick LR, Wu CD, Kinghorn ADAntimicrobial
constituents from goldenseal (the Rhizomes of Hydrastis canadensis) against
selected oral pathogens. Planta Med. 2003 Jul;69(7):623-7.
37. IUCN. 1997. Inclusion of Goldenseal Hydrastis canadensis in Appendix 11
(Convention on International Trade in Endangered Species of Wild Fauna and
Flora), U.S.A. April. International Union on the Conservation of Nature, Gland,
Switzerland.
38. Jack, D. L., Yang, N. M. and Saier, M. H. (2001) The drug/metabolite transporter
superfamily. Eur. J. Biochem. 68, 3620–3639.
39. Jensen, S.O. and Lyon, B.R. Genetics of antimicrobial resistance in
Staphylococcus aureus. 2009, Future Microbiology. 4: 565-582.
40. Jevons, M.P., and Parker, M.T. 1964. The evolution of new hospital strains of
Staphylococcus aureus. J. Clin. Pathol. 17:243–250.
80
41. Juliano RL, Ling V. A surface glycoprotein modulating drug permeability in
Chinese hamster ovary cell mutants. Biochim Biophys Acta. 1976 Nov
11;455(1):152-62.
42. Jun Yu, Limin Wang, Rosemary L. Walzem, Edward G. Miller, Leonard M. Pike,
and Bhimanagouda S. Patil, Antioxidant Activity of Citrus Limonoids,
Flavonoids, and Coumarins, J. Agric. Food Chem., 2005, 53 (6), pp 2009–2014.
43. Kaatz GW, DeMarco CE, Seo SM, MepR, a repressor of the Staphylococcus
aureus MATE family multidrug efflux pump MepA, is a substrate-responsive
regulatory protein. Antimicrob Agents Chemother. 2006 Apr;50(4):1276-81.
44. Kaatz GW, Seo SM, Ruble CA. Efflux-mediated fluoroquinolone resistance in
Staphylococcus aureus. Antimicrob Agents Chemother. 1993 May;37(5):1086–
1094.
45. Kaatz GW, Seo SM, Ruble CA. Mechanisms of fluoroquinolone resistance in
Staphylococcus aureus. J Infect Dis. 1991 May;163(5):1080–1086.
46. Kaneda Y, Tanaka T, Saw T. Effects of berberine, a plant alkaloid, on the growth
of anaerobic protozoa in axenic culture. Tokai J Exp Clin Med 1990;15:417-
47. Kaneda Y, Torii M, Tanaka T, Aikawa M. In vitro effects of berberine sulfate on
the growth and structure of Entamoeba histolytica, Giardia lamblia, and
Trichomonas vaginalis. Ann Trop Med Parasitol 1991;85:417-425.
48. Kist M. The historical background of Campylobacter infection: new aspects. In:
Pearson AD, editor. Proceedings of the 3rd International Workshop on
81
Campylobacter Infections; Ottawa;1985 Jul 7-10. London: Public Health
Laboratory Service;1985. p.23-7.
49. Klevens RM, Edwards JR, Tenover FC, McDonald LC, Horan T, Gaynes R:
Changes in the epidemiology of methicillin-resistant Staphylococcus aureus in
intensive care units in US hospitals, 1992-2003. Clin. Infect. Dis. 42(3), 389-391
(2006).
50. Kong, W., J. Wei, P. Abidi, M. Lin, S. Inaba, C. Li, Y. Wang, Z. Wang, S. Si, H.
Pan, et al. 2004. Berberine is a promising novel cholesterollowering drug working
through a unique mechanism distinct from statins. Nat. Med. 10: 1344–1352.
51. Kruse, H., B.K. Johansen, L.M. Rorvik, and G. Schaller. 1999. The use of
avoparcin as a growth promoter and the occurrence of vancomycin-resistant
Enterococcus species in Norwegian poultry and swine production. Microb. Drug
Resist. 5:135-139.
52. Kuehnert MJ, Kruszon-Moran D, Hill HA, McQuillan G, McAllister SK, Fosheim
G, McDougal LK, Chaitram J, Jensen B, Fridkin SK, Killgore G, Tenover
FCPrevalence of Staphylococcus aureus nasal colonization in the United States,
2001-2002. J Infect Dis. 2006 Jan 15;193(2):172-9.
53. Law CJ, Maloney PC & Wang DN (2008) Ins and outs of major facilitator
superfamily antiporters. Annu Rev Microbiol 62: 289–305.
54. Lee MD, Galazzo JL, Staley AL et al. Microbial fermentationderived inhibitors of
efflux-pump-mediated drug resistance. Farmaco 2001; 56: 81–5.
82
55. Lee S, Sivakumar K, Shin WS, Xie F, Wang Q.Synthesis and anti-angiogenesis
activity of coumarin derivatives. Bioorg Med Chem Lett. 2006 Sep
1;16(17):4596-9.
56. Lewis, K. 1994. Multidrug resistance pumps in bacteria: Variations on a theme.
Trends Biochem. Sei. 19:119-123.
57. Lin J, Michel LO, Zhang QCmeABC functions as a multidrug efflux system in
Campylobacter jejuni. Antimicrob Agents Chemother. 2002 Jul;46(7):2124-31.
58. Livermore. DM β-Lactamases in laboratory and clinical resistance. Clin
Microbiol Rev. 1995;8:557584.
59. Lomovskaya O. Lee A, Mao W, Warren MS, Mistry A, Hoshino K, Okumura R,
Ishida H, Interplay between efflux pumps may provide either additive or
multiplicative effects on drug resistance. J Bacteriol. 2000 Jun;182(11):3142-50.
60. Lubelski J, Konings WN & Driessen AJ (2007) Distribution and physiology of
ABC-type transporters contributing to multidrug resistance in bacteria. Microbiol
Mol Biol R 71: 463–476.
61. Luo, N., O. Sahin, J. Lin, L. O. Michel, and Q. Zhang. 2003. In vivo selection of
Campylobacter isolates with high levels of fluoroquinolone resistance associated
with gyrA mutations and the function of the CmeABC efflux pump. Antimicrob.
Agents Chemother. 47:390–394.
62. Mamelli, L., V. Prouzet-Mauleon, J. M. Pages, F. Megraud, and J. M. Bolla.
2005. Molecular basis of macrolide resistance in Campylobacter: role of efflux
pumps and target mutations. J. Antimicrob. Chemother. 56:491–497.
83
63. Markham PN, Neyfakh AA. Inhibition of the multi-drug transporter norA
prevents emergence of norfloxacin resistance in Staphylococcus aureus.
Antimicrob Agents Chemother 1996; 40: 2673–4.
64. Markham, P., E. Westhause, K. Klyachko, M. E. Johnson, and A. A. Neyfakh.
1999. Multiple novel inhibitors of the NorA multidrug transporter of
Staphylococcus aureus. Antimicrob. Agents Chemother. 43:2404–2408.
65. Michael Stavri, Laura J. V. Piddock, Simon Gibbons. Bacterial efflux pump
inhibitors from natural sources. Journal of Antimicrobial Chemotherapy (2007)
59, 1247–1260.
66. Michel M., Gutmann L. Methicillin-resistant Staphylococcus aureus and
vancomycin-resistant enterococci: therapeutic realities and possibilities. Lancet
1997 Jun 28;349(9069):1901-6.
67. Mills, S.; Bone, K. Principles and Practice of Phytotherapy. Churchill
Livingstone; Philadelphia, PA: 2000.
68. Moriyama Y, Hiasa M, Matsumoto T & Omote H (2008) Multidrug and toxic
compound extrusion (MATE)-type proteins as anchor transporters for the
excretion of metabolic waste products and xenobiotics. Xenobiotica 38: 1107–
1118.
69. Murakami, S., Nakashima, R., Yamashita, E. and Yamaguchi, A. (2002) Crystal
structure of the bacterial multidrug efflux transporter AcrB. Nature (London) 419,
587–593.
84
70. N. S. Zakharova and T. A. Petrova ß- Glucosidases from leaves and roots of the
common beet,Beta vulgaris Applied Biochemistry and Microbiology Vol. 36,
No. 4, 2000 p394-397.
71. Neyfakh AA, Bidnenko VE, Chen LB. Efflux-mediated multi-drug resistance in
Bacillus subtilis: similarities and dissimilarities with the mammalian system.
Proc Natl Acad Sci USA 1991; 88: 4781–5.
72. Neyfakh AA, Bidnenko VE, Chen LB. Efflux-mediated multidrug resistance in
Bacillus subtilis: similarities and dissimilarities with the mammalian system. Proc
Natl Acad Sci U S A. 1991 Jun 1;88(11):4781–4785.
73. Nielsen EM, Engberg J, Madsen M. Distribution of serotypes of Campylobacter
jejuni and C. coli from Danish patients, poultry, cattle, and swine. FEMS
Immunol Med Microbiol 1997;19:47-56.
74. Nikaido H, Multidrug resistance in bacteria. Annu Rev Biochem. 2009;78:119-
46.
75. Nikaido H, Basina M, Nguyen V, Rosenberg EY: Multidrug efflux pump AcrAB
of Salmonella typhimurium excretes only those beta-lactam antibiotics containing
lipophilic side chains. J Bacteriol 1998, 180:4686-4692.
76. Nikaido H, Saier MH Jr Transport proteins in bacteria: common themes in their
design. Science. 1992 Nov 6;258(5084):936-42.
77. Nikaido H. 1998a. Antibiotic resistance caused by gram-negative multidrug efflux
pumps. Clin. Infect. Dis. 27 Suppl 1: S32-41.
85
78. Nikaido H. 1998b. Multiple antibiotic resistance and efflux. Curr. Opin.
Microbiol. 1: 516-523.
79. Nikaido, H. 1994. Prevention of drug access to bacterial targets: Permeability
barriers and active efflux. Science 264:382-388.
80. Nikaido, H. 1996. Multidrug efflux pumps of gram-negative bacteria. J.
Bacteriol. 178:5853-5859.
81. North Carolina Medicinal Herbs: Goldenseal. University of North Carolina;
Chapel Hill:
http://www.med.unc.edu/phyrehab/ncmedicinalherbs/goldenseal/Goldenseal-
hp.pdf
82. Ogston A. Micrococcus poisoning. J Anal Physiol 1883;17:24–58.
83. Paulsen IT, Brown MH, Skurray RA.Proton-dependent multidrug efflux systems.
Microbiol Rev. 1996 Dec;60(4):575-608.
84. Paulsen IT, Lewis K: Microbial multidrug efflux: introduction. J Mol Microbiol
Biotechnol 2001, 3:143-144.
85. Paulsen IT, Saier MH Jr, Sliwinski MK, Pao SS, Skurray RA, Nikaido H
Evolutionary origins of multidrug and drug-specific efflux pumps in bacteria.
FASEB J. 1998 Mar;12(3):265-74.
86. Paulsen IT: Multidrug efflux pumps and resistance: regulation and evolution. Curr
Opin Microbiol 2003, 6(5):446-451.
87. Paulsen, I. T., Brown, M. H. and Skurray, R. A. (1996) Proton-dependent
multidrug efflux systems. Microbiol. Rev. 60, 575–608.
86
88. Perl TM. The threat of vancomycin resistance. Am J Med 1999; 106: 26–37S.
89. Perlman DJ, Ampel NM, Schifman RB, Cohn DL, Patton CM, Aguirre ML, et al.
Persistent Campylobacter jejuni infections in patients infected with the human
immunodeficiency virus (HIV). Ann Intern Med 1988;108:540-6.
90. Peter M Hawkey, 1998 The origins and molecular basis of antibiotic resistance.
BMJ. 1998 September 5; 317(7159): 657–660.
91. Poisson J, Le Hir A, Goutarel R et al. Isolation of reserpine from roots of
Rauwolfia vomitoria Afz. C R Hebd Seances Acad Sci 1954; 238: 1607–9.
92. Poole, K. (2000). Efflux mediated resistance to fluoroquinolones in Gram-
negative bacteria. Antimicrob Agents Chemothera. 44: 2233-2241.
93. Prats G, Mirelis B, Llovet T, Muñoz C, Miró E, Navarro F. Antibiotic resistance
trends in enteropathogenic bacteria isolated in 1985-1987 and 1995-1998 in
Barcelona. Antimicrob Agents Chemother. 2000 May;44(5):1140-5.
94. Praveen K. Saxena and S. Mohan Jain, In Vitro Propagation of Rauwolfia
serpentina Using Liquid Medium, Assessment of Genetic Fidelity of
Micropropagated Plants, and Simultaneous Quantitation of Reserpine, Ajmaline,
and Ajmalicine. 2009 Meth Mol Bio, 547 17-33.
95. Public Health Dispatch. Vancomycin-resistant Staphylococcus aureus. Morbid
Mortal Weekly Rep 2002; 51: 902.
96. Pumbwe L, Randall LP, Woodward MJ, Piddock LJ Expression of the efflux
pump genes cmeB, cmeF and the porin gene porA in multiple-antibiotic-resistant
87
Campylobacter jejuni. J Antimicrob Chemother. 2004 Aug;54(2):341-7. Epub
2004 Jun 16.
97. Putman, H.W. van Veen and W.N. Konings, Molecular properties of bacterial
multidrug transporters, Microbiol Mol Biol Rev 64 (2000), pp. 672–693.
98. Riley JC, 2001, Rising life expectancy: a global history
99. Robbins, C. 1996. Goldenseal-A candidate for CITES (Convention on
Intemational Trade in Endangered Species of Wild Fauna and Flora) Appendix 11
TRAFFIC USA 15:5-6.
100. Rotun SS, McMath V, Schoonmaker DJ et al. Staphylococcus aureus with
reduced susceptibility to vancomycin isolated from a patient with fatal
bacteremia. Emerg Infect Dis 1999; 5: 147–9.
101. Saier, M. H., Beatty, J. T., Goffeau, A., Harley, K. T., Heijne, W. H., Huang, S.
C., Jack, D. L., Jahn, P. S., Lew, K., Liu, J. et al. (1999) The major facilitator
superfamily. J. Mol. Microbiol. Biotechnol. 1, 257–279.
102. Scazzocchio F, Cometa MF, Palmery M. Fitoterapia 1998;69:58–59.
103. Schieffer GW, Kohn M. J Liq Chromatogr Rel Technol 2002;25:263–274.
104. Shoemaker, N.B. et al., 2001. Evidence for extensive resistance gene transfer
among Bacteriodes spp. and among Bacteriodes of other genera in the human
colon. Applied and Environmental Microbiology 67:561-568.
105. Simon Gibbons. Phytochemicals for Bacterial Resistance - Strengths, Weaknesses
and Opportunities Planta Med 2008 May;74(6):594-602.
88
106. Skinner D, Keefer CS. Significance of bacteremia caused by Staphyloco cus
aureus. Arch Intern Med 1941;68:851–75.
107. Slade O. Jensen; Bruce R. Lyon, Genetics of Antimicrobial Resistance in
Staphylococcus aureus. Future Microbiology. 2009;4(5):565-582.
108. Small, E., and P.M. Catling. 1999. Canadian Medicinal Crops. National Research
Council of Canada, Ottawa, Ontario.
109. Someya Y, Yamaguchi A. Bacterial drug efflux proteins Nippon Saikingaku
Zasshi. 1995;50(2):403-21.
110. Sorvillo FJ, Lieb LE, Waterman SH. Incidence of campylobacteriosis among
patients with AIDS in Los Angeles County. J Acquir Immune Defic Syndr Hum
Retrovirol 1991;4:598-602.
111. St Georgiev, V. (2000) Membrane transporters and antifungal drug resistance.
Curr Drug Targets 1: 261–284.
112. Stermitz FR, Lorenz P, Tawara JN, Zenewicz LA, Lewis K Synergy in a
medicinal plant: antimicrobial action of berberine potentiated by 5'-
methoxyhydnocarpin, a multidrug pump inhibitor. Proc Natl Acad Sci U S A.
2000 Feb 15;97(4):1433-7.
113. Sum PE, Sum FW, Projan SJ. Recent developments in tetracycline antibiotics.
Curr Pharm Des. 1998 Apr;4(2):119-32.
114. Thanassi D. G., Cheng L. W., and Nikaido H. 1997. Active efflux of bile salts by
Escherichia coli. J. Bacteriol. 179: 2512-2518.
89
115. Thomson, K.S. and Smith, M.E. (2000). Version 2000: thr new beta-lactamases of
gram-negative bacteria at the dawn of the new millennium. Microbes Infect 2:
1225-1235.
116. Tierra, M. The Way of Herbs. Pocket Books; New York, NY: 1998.
117. Trucksis M, Hooper DC, Wolfson JS. Emerging resistance to fluoroquino- lones
in staphylococci: an alert. Ann Intern Med 1991;114:424–6.
118. Tseng TT, Gratwick KS, Kollman J, Park D, Nies DH, Goffeau A & Saier Jr MH
(1999) The RND permease superfamily: an ancient, ubiquitous and diverse family
that includes human disease and development proteins. J Mol Microb Biotech 1:
107–125.
119. USFWS. 1997. Amendment to Appendix 11 of CITES (Convention on
International Trade in Endangered Species of Wild Fauna and Flora), U.S.A.-
Proposal to Include Hydrastis canadensis in Appendix 11, in Accordance with
Article 2, Paragraph 2A. U.S. Fish and Wildlife Service, Washington, DC.
120. Van Berkel GJ, Tomkins BA, Kertesz V. Thin-layer
chromatography/desorption electrospray ionization mass spectrometry:
investigation of goldenseal alkaloids. Anal Chem. 2007 Apr 1;79(7):2778-89.
121. Von Eiff C, Peters G, Heilmann C, Pathogenesis of infections due to coagulase-
negative staphylococci. Lancet Infect Dis. 2002 Nov;2(11):677-85.
122. Weber HA, Zart MK, Hodges AE, Molloy HM, O'Brien BM, Moody LA, Clark
AP, Harris RK, Overstreet JD, Smith CS. Chemical comparison of goldenseal
90
(Hydrastis canadensis L.) root powder from three commercial suppliers. J Agric
Food Chem. 2003 Dec 3;51(25):7352-8.
123. Wu Qi; Yang Xiu-Wei The constituents of Cibotium barometz and their
permeability in the human Caco-2 monolayer cell model. Journal of
ethnopharmacology 2009;125(3):417-22.
124. Yoshida H, Bogaki M, Nakamura S, Ubukata K, Konno M. Nucleotide sequence
and characterization of the Staphylococcus aureus norA gene, which confers
resistance to quinolones. J Bacteriol. 1990 Dec;172(12):6942–6949.
125. Zgurskaya H. I., and Nikaido H. 1999a. AcrA is a highly asymmetric protein
capable of spanning the periplasm. J. Mol. Biol. 285: 409-420.
126. Zgurskaya H. I., and Nikaido H. 1999b. Bypassing the periplasm: reconstitution
of the AcrAB multidrug efflux pump of Escherichia coli. Proc. Natl. Acad. Sci.
USA. 96: 7190-7195.
91