Investigation of Rice Diterpenoid Phytoalexin Biosynthesis Benjamin C

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2017 Investigation of rice diterpenoid phytoalexin biosynthesis Benjamin C. Brown Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Biochemistry Commons

Recommended Citation Brown, Benjamin C., "Investigation of rice diterpenoid phytoalexin biosynthesis" (2017). Graduate Theses and Dissertations. 16322. https://lib.dr.iastate.edu/etd/16322

This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Investigation of rice diterpenoid phytoalexin biosynthesis

Benjamin C. Brown

A thesis submitted to the graduate faculty

in partial fulfillment of the requirements for the degree

MASTER OF SCIENCE

Major: Biochemistry

Program of Study Committee: Reuben J. Peters, Major Professor Gustavo MacIntosh Bing Yang

The student author and the program of study committee are solely responsible for the content of this thesis. The graduate college will ensure this thesis is globally accessible and will not permit alterations once a degree is conferred.

Iowa State University

Ames, IA

2018

TABLE OF CONTENTS

ABSTRACT iv

CHAPTER 1. GENERAL INTRODUCTION 1 References 7 Figures 8

CHAPTER 2. MATERIALS AND METHODS 9 Materials 9 CRISPR/Cas9 Vectors 9 Plant Growth 10 Induction and Extraction of Diterpenoids 11 LC-MS/MS Analysis of Diterpenoids 12 References 15 Figures 15 Tables 30

CHAPTER 3. INFERRING ROLES IN DEFENSE FROM METABOLIC ALLOCATION-RICE DITERPENOIDS 32 Abstract 33 Introduction 34 Results 37 Discussion 43 Methods 46 References 51 Figures 55 Supplemental information 61

CHAPTER 4. INVESTIGATING MOMILACTONE BIOSYNTHESIS 73 Abstract 73 Introduction 73 Results 75 Discussion 76 References 77 Figures 78

iii

CHAPTER 5. INVESTIGATING ORYZALEXIN BIOSYNTHESIS 82 Abstract 82 Introduction 82 Results 84 Discussion 85 References 87 Figures 87

CHAPTER 6. INVESTIGATING PHYTOCASSANE BIOSYNTHESIS 92 Abstract 92 Introduction 92 Results 94 Discussion 94 References 95 Figures 96

CHAPTER 7. CONCLUSIONS AND FUTURE DIRECTIONS 98 Conclusion 98 Future directions 98 iv

ABSTRACT

When confronted with the prospect of microbial infection, plants are armed with a mighty selection of antibiotic natural products. Rice’s selection of antibiotic natural products primarily consists in its production of diterpenoids. These diterpenoids have been identified from microbial infection, and have been characterized in vitro but remain to be extensively studied in planta . These diterpenoids are primarily synthesized into ent- or syn-copalyl diphosphate (CPP) by CPP synthases (CPS). OsCPS4 , which makes syn-CPP, and OsCPS2, which makes ent-CPP, were both knocked out T-DNA insertions and infected with Magnaporthe oryzae and Xanthomonas oryzae. The Os-cps4 knockout is actually more resistant to X. oryzae , while the Os-cps2 knockout is more susceptible to pathogen attack. Further study indicated that Os-cps4 was susceptible to other non-host fungal strains. Though Os-cps2 was more susceptible to pathogen attack, the total amount of ent -derived diterpenoids was nearly equal to that of its wild type, leading to a hypothesis that there are spatial requirements for the production of phytocassanes and oryzalexins.

Using CRISPR/Cas9, knockouts of 8 other genes involved in phytoalexin biosynthesis were constructed and transformed into rice: Os-ksl10, Os-ksl7, Os-ksl4, Os- cyp76m7, Os-cyp76m7&m8, Os-cyp701a8, Os-cyp99a2, and Os-ms1. These lines will be used for future pathogenic experiments, and they provide new insight into the biosynthesis pathways even now.

Momilactone production was adversely affected in Os-cps4, Os-ksl4, Os- cyp76m7&m8, Os-cyp701a8, Os-cyp99a2, and Os-ms1. Oryzalexins were not reliably v detectable in the wild typesamples analyzed for this thesis, though an alternative induction method has been developed for future experiments. An upregulation of the detectable oryzalexins (A, C, D, & E) Os-cyp99a2 gave way to hypothesize its activity in the production of oryzalexin F. Phytocassane production was adversely affected in Os- ksl7, Os-cyp76m7&m8, Os-cyp701a8, and Os-ms1. Thus, as exemplified here with rice diterpenoids, examination of metabolic allocation provides important clues into physiological function.

CHAPTER ONE: GENERAL INTRODUCTION

Since the dawn of mankind’s dominion on earth, Oryza sativa (rice) has been one of the primary staple food sources. Billions have survived on this crop with its nutritious seeds for thousands of years. And unknown to most of these people over the millennia who have been harvesting it, rice has been deeply engaged in biochemical warfare against invasive pathogens.

As plants are burdened by immobility, one of their only hopes of defense against pathogen attack is through the production of biochemicals to disrupt the pathogens attacking. Because of humanity’s reliance on rice as a staple food crop, when rice cannot produce the correct selection of defense molecules at the proper time, the results can be devastating, as evidenced during the Bengal famine of 1943 where an estimated 2.1 million lives were lost (Ó Grada, 2007) due to local rice paddies’ widespread inabilities to defend against the pathogen Cochliobolus miyabeanus , a pathogen that causes brown spot disease in rice (Padmanabhan, 1973). In order to safeguard posterity from enduring such horrors again, a “second green” or a genetic revolution must occur, as pathogens evolve resistances to current methods of defense.

And in rice, the natural place to begin the investigation lies in the labdane related diterpenoids.

Gibberellic acid (GA) is a plant hormone necessary for normal plant growth and development. GA is derived from the olefin precursor geranyl geranyl diphosphate

(GGPP). GGPP is cyclized by the class II diterpene cyclase (DTC) copalyl diphosphate 2 synthase (CPS) into copalyl diphosphate (CPP). CPP is further cyclized into kaurene by the class I diterpene synthase (DTS) Kaurene Synthase (KS). Because there is strong evolutionary pressure to maintain these enzymes involved in the production of GA, their genes act as a genetic pool from which evolution can occur (Mafu et al., 2016).

Rice has utilized this genetic pool to build diterpenoids used in its biochemical arsenal for defense against pathogens. Rice has created three CPSs to convert GGPP to

CPP, with two different kinds of stereochemistry. CPS4 creates CPP with syn stereochemistry, whereas CPS1 and CPS2 both generate CPP with ent stereochemistry.

Acting on both types of CPP are a slew of class I DTS similar to KS. Due to their similarity, they are termed Kaurene Synthase Like (KSL) enzymes (Zi et al., 2014).

These KSLs act on ent and syn CPP to produce nine diterpenes. Cytochrome P450s

(CYPs) and short chain dehydrogenase reductase (SDR) enzymes further tailor these diterpenes to produce various diterpenoids. The known classes of diterpenoids produced from these KSL enzymes are Oryzalexins, momilactones, phytocassanes, and oryzalides (Figure 1). The enzymes involved in building these diterpenoids are induced by chitin (the polysaccharide incorporated into the fungal cell wall), attack by pathogens, heavy metals, UV irradiation, and drought (Cho and Lee, 2015).

Understanding the effectiveness of these compounds against rice pathogens and cognizance of how to build these compounds could open the door to new ways of combating rice disease, either through the use of these natural compounds or novel derivatives created similarly. Two methods present themselves to incorporate this: either genetically designing the rice to produce the best compounds at the proper amount and the right time, or using a heterologous host to produce the compounds at 3 high enough concentrations to be useful in the field. These compounds evolutionarily are targeted toward the specific miscreant pathogens and are much less likely to have such widespread off targeted species death and environmental pollution as our current set of inorganic pesticides.

In order to first understand the pathways involved in diterpenoid production, a metabolic engineering system was developed for the expression of rice enzymes in

Escherichia coli (E. coli) (Cyr et al., 2007). Using this system, a good understanding has been gained of enzymes’ substrates and the products they generate from each substrate. Novel products have even been generated, such as when rice KSLs were expressed with a wheat CPS that produces normal stereochemistry (Morrone et al.,

2011).

Nevertheless, it is necessary to study the genetic infrastructure in the host genome to truly interpret the role of each enzyme. Multiple enzymes could act together to generate a diterpenoid. Or there could be enzymes that are actually involved in diterpenoid production that aren’t in the published rice genome. There is found an example of this in OsKSL11. OsKSL11 is not found in the published genome of rice, yet it was found when cloning OsKSL8 , with which it shares a high sequence identity. When

OsKSL11 was expressed in E. coli with the relevant syn-CPS and GGPP, it produced syn - stemodene, a diterpenoid that is found in rice extracts (Morrone et al., 2011; Morrone et al., 2006). It could also be that while individual diterpenoids have a deleterious effect on pathogens, the most potent effect occurs when a mixture of diterpenoids act in concert. Gene knockouts can also give an idea of metabolic flux in the pathway. By selectively knocking out enzymes involved in diterpenoid production in the host 4 organism, it can be discovered which diterpenoids are bioactive against specific pathogens (or at least an individual diterpenoid’s effect in the array against pathogen attack), and also allow it to be known whether there are other enzymes that act similarly still hiding in the genome.

Previously a project had been undertaken to examine these gene knockouts in rice. This project was led by Xuan Lu in Dr. Reuben Peter’s laboratory in collaboration with Dr. Bing Yang’s group. However, this effort mainly used knockouts generated by random T-DNA insertions from agrobacterium to disrupt the genes. These knockouts were generated from different groups and had different genetic backgrounds, which confounded the results comparing different knockouts, and also required more labor to maintain distinct wild type lines for every knockout.

It was necessary, therefore, to create a method of selectively knocking out genes of interest in the same genetic background. Kitaake is becoming a model rice cultivar in the field (Kim et al., 2013), and so this cultivar was chosen for the genetic background.

Originally the project planned to use transcriptional activator-like effector nucleases

(TALENs). TALENs use transcription activator like (TAL)-effectors bound to a DNA nuclease to selectively cut DNA. TAL-effectors have a DNA binding domain and can be engineered to selectively bind the DNA sequence of interest (Li et al., 2016).

Unfortunately the TALENs system was unsuccessful in our all attempts to use it.

However, shortly after work started with TALENs, the scientific community saw the advent of the CRIPSR/Cas9 system. CRISPR (clustered regularly interspaced short palindromic repeats) uses a single guide RNA (sgRNA) to direct a nuclease (CRISPR associated protein 9 [CAS9]) to cut the DNA at the site of interest (Deltcheva et al., 5

2011). As the CRISPR/Cas9 system is much simpler to design than TALENs, since it utilizes an RNA platform rather than a protein platform, CRISPR was used to generate the rice gene knockouts in the common genetic background of the Kitaake cultivar rather than TALENs.

The CRISPR Cas9 system has quickly become the gene editing method of choice by scientists. Dr. Yang’s group recently developed a CRISPR/Cas9 system unique to rice which has been previously described (Zhou et al., 2014). Nevertheless, a short section here concerning this system has been requested.

CRISPR/Cas9 was originally derived from Haloferax mediterranei (Mojica et al.,

1993) , a bacteria that utilized the system as a defense response in a sort of adaptive immunity. CRISPR/Cas9 takes short sequences (~20 nucleotides) of invading viruses and incorporates them into their own genome next to the clustered regularly interspaced short palindromic sequences. These palindromic sequences act as bookends of the viral sequences incorporated. The incorporated viral sequences are then transcribed that act as a guide to the Cas9 nuclease to find the corresponding DNA sequence with the protospacer adjacent motif (PAM), NGG. The Cas9 then cuts the sequence with a double strand break (DSB), effectively neutralizing the viral attack.

This system has been used by scientists in plants and other higher orders of life to selectively find genes and disrupt them by inducing a DSB. DSBs induce a DNA repair mechanism known as nonhomologous end joining (NHEJ) that is error prone. These errors can lead to function disrupting mutations in the gene.

Single guide RNAs (sgRNAs) are the short sequences in the CRISPR complex that lead Cas9 to the DNA of interest. sgRNAs are composed of three regions: CRISPR RNA 6

(crRNA) which is the base pairing sequence (~20 nucleotides) from the host organism where a DSB is being induced, a Cas9 binding sequence (~42 nucleotides), and a terminator (~40 nucleotides) (Larson et al., 2013). The host must have the same DNA base pairing sequence (with the sequence following the formula G+19N) followed by the protospacer adjacent motif (PAM) (Deveau, et al., 2008), which for the Cas9 used in this project, has the sequence NGG. When modifying the sgRNA, only the crRNA needs to be changed from construct to construct.

In this dissertation the hope is to analyze and explain the results, conclusions, and future directions in the work of building these knockouts. Previously work was done using agrobacterium T-DNA inserts to knock out genes of interest; and indeed, this is the method used in Chapter three with the CPS genes. With CRISPR/Cas9, all foreign DNA can be segregated out, allowing any mutant plants without the remaining

T-DNA to be classified as non-GMO plants according to the USDA.

Chapter two is a materials and methods chapter, explaining the protocols used to obtain the data for the rest of the chapters. Chapter three is a manuscript for a paper that will be submitted to the Plant Cell Journal. It will discuss the work done in knocking out CPS 2 and 4, the class II DTCs involved in the first cyclization step from

GGPP. This chapter discusses work done in T-DNA knockouts and RNAi lines, but not with CRISPR/Cas9. A colleague, Juan Zhang, is working on the CRISPR lines for these

CPS enzymes. My contribution to this paper involved the chemotype analyses, and the development of the methods for the LC-MS/MS and phytoalexin extraction as described in chapter two. The following chapters four, five, and six have been broken up to discuss the three main categories of phytoalexins being analyzed for antibiotic 7 properties: momilactones, oryzalexins, and phytocassanes, respectively. They will explain the background on each class of phytoalexins, how they are built, discuss the genes that were chosen to be knocked out, the generation of individual CRISPR lines, and the chemotypic analysis of each of those lines. The seventh and final chapter discusses future directions with the project.

Refences

Cho, M., and Lee, S. (2015). Phenolic Phytoalexins in Rice: Biological Functions and Biosynthesis. International Jounral of Molecular Sciences. 16: 29120-29133. Cyr, A., Wilderman, PR., Determan, M., and Peters, R.J. (2007). A modular approach for facile biosynthesis of labdane-related diterpenes. J Am Chem Soc. 129: 6684- 6685. Deltcheva, E., Chylinski, K., Sharma, C.M., Gonzales, K., Chao, Y., Pirzada, Z.A., Eckert, M.R., Vogel, J., and Charpentier, E. (2011). CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature. 471: 602-607. Deveau, H., Barrangou, R., Garneau, J.E., Labonté, J., Fremaux, C., Boyaval, P., Romero, D.A., Horvath, P., and Moineau, S. (2008). Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J. Bacteriol. 190: 1390-1400. Kim, S. L., Choi, M., Jung, K., and An, G. (2013). Analysis of the early flowering mechanisms and generation of T-DNA tagging lines in Kitaake, a model rice cultivar. Journal of Experimental Botany. 64: 4169-4182. Larson, M.H., Gilbert, L.A., Wang, X., Lim, W., Weissman, J.S., and Qi, L.S. (2013). CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nature Protocols. 8: 2180-2196. Li, T., Liu, B., Chen, C.Y., and Yang, B. (2016). TALEN-Mediated Homologous Recombination Produces Site-Directed DNA Base Change and Herbicide- Resistant Rice. Journal of Genetics and Genomics. 43: 297-305. Mafu, S. , Jia, M., Zi, J., Morrone, D., Wu, Y., Xu, M., Hillwig, M., and Peters, R. J. (2016). Probing the prosmiscuity of ent -kaurene oxidases via combinatorial biosynthesis. PNAS. 113: 2526-2531. Miyamoto, K., Fujita, M., Shenton, M., Akashi, S., Sugawara, C., Sakai, A., Horie, K., Hasegawa, M., Kawaide, H., Mitsuhashi, W., Nojiri, H., Yamane, H., Kurata, N., Okada, K., and Toyomasu, T. (2016). Evolutionary trajectory of phytoalexin biosynthetic gene clusters in rice. The plant journal. 87, 293-304. Mojica, R.J.M, Ferrer, C., Juez, G., and Rodriguez-Valera, F. (1993). Transcription at different salinities of Haloferax mediterranei sequences adjacent to partially modified Pstl sites. Mol. Microbiol. 9: 613-621. 8

Morrone, D., Hillwig, ML., Mead, ME., Lowry, L., Fulton, DB., and Peters R.J. (2011). Evident and latent plasticity across the rice diterpene synthase family with potential implications for the evolution of diterpenoid metabolism in the cereals. Biochem J. 435:589-595. Morrone D. , Jin, Y., Xu, M., Choi, S.Y., Coates, R.M., and Peters R. J. (2006). An unexpected diterpene cyclase from rice: functional identification of a stemodene synthase. Biochem Biophys. 448: 133-140. Ó Grada, C. (2007). Making Famine History. Journal of Economic Literature. 45: 5-38. Padmanabhan, S. Y. (1973). The Great Bengal Famine. Annual Review of Phytopathology. 11:11-24. Toyomasu, T. (2008). Recent Advances Regarding Diterpene Cyclase Genes in Higher Plants and Fungi. Biosci. Biotechnol. Biochem. 72, 1168-1175. Zhou, H., Liu, B., Weeks, D. P., Spalding, M. H., and Yang, B. (2014). Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Research. 42: 10903-10914. Zi, J., Mafu, S., and Peters, R. J. (2014). To Gibberellins and Beyond! Surveying the Evolution of (Di)terpenoid Metabolism. Annu Rev Plant Biol. 65: 259-286.

Figures

OPP OsCPS4 OsCPS1 OPP OPP GGPP OsCPS2

H H syn -CPP OsKSL10 OsKSL5 ent -CPP OsKS1 OsKSL11 OsKSL6 OsKSL8 OsKSL7 OsKSL4 H OsKSL10 syn -labda-8(17), H 12 E,14-triene ent -pimara-8(14), H 15-diene H H H ent -isokaurene H H H H H H syn -stemod- syn -pimara- ent -cassa-12, ent -kaurene syn -stemar- 13(17)-ene ent -sandaraco- 15-diene 13-ene 7,15-diene pimaradiene

Momilactones A & B ??? ??? ??? Oryzalides A-C Phytocassanes A-F Oryzalexin S Oryzalexins A-F GA

Figure 1. Rice labdane-related diterpenoid biosynthetic network (CPS, copalyl diphosphate synthase; KSL, kaurene synthase-like). Thicker arrow indicates enzymatic reactions specifically involved in gibberellin phytohormone metabolism. Dashed arrows indicate multiple enzymatic reactions leading to families of diterpenoid natural products derived from the shown diterpene olefins where known (??? indicates presumed unknown derivatives). 9

CHAPTER TWO: MATERIALS AND METHODS

Materials

All primers were ordered from the DNA facility in the office of biotechnology at

Iowa State University (Table 1). RNA was extracted from rice leaves using the RNeasy

Plant minikit from Qiagen. Genomic DNA was extracted using the plant DNAzol reagent procured from Thermo Fisher Scientific. Liquid nitrogen was purchased from Iowa

State University’s chemistry stores.

CRISPR Cas9 Vectors

Two vectors have been built for rice genome editing here. The first, pENTR4, includes two sites for insertion of the base pairing region of sgRNAs by restriction enzyme cutting and pasting. Mulitplexing capabilities have been demonstrated with

CRISPR/Cas9, which allows multiple gene knockouts at once (Wang et al., 2015; Zhou et al., 2014). However, in this project the two sequences from the same gene were included in the two sites to give greater assurance that the gene of interest would be knocked out in a single transformation event, except for one case where a double knockout was generated from a single sgRNA ( Os-cyp76m7&m8). Both sgRNAs are driven by a rice ubiquitin promoter. The first sgRNA site is opened with the restriction enzyme BtgzI, the second by cutting with BsaI. The two sgRNA regions in pENTR4 are flanked on either side by attL sites (Figure 1) for simple incorporation into the 10 following destination pUbi-Cas9 vector by an LR reaction. The forward and reverse base pairing sgRNA portions are ligated together, with the matching overhang sites for where the restriction enzymes cut, which is tgtt/aaac for BtzgI and gtgt/aaac for BsaI.

For this project, every CRISPR construct contained two sgRNAs for the same gene, to give a greater chance of knockout (Table 2).

The pUbi-Cas9 vector (also known in Reuben’s lab as pBYO2-Cas9) contains attR sites flanking a ccdb sequence, a rice codon optimized version of Streptococcus pyogenes

Cas9 sequence driven by a Zea mays (maize) ubiquitin promoter, and the HPTII gene that confers hygromycine resistance driven by the cauliflower mosaic virus 35S ribosomal promoter (Figure 2). This pUbi-Cas9 vector, after having received the sgRNAs from pENTR4, is then transformed into Agrobacterium tumefaciens

(Agrobacterium ), which in turn is used to transform rice.

Using this system, 8 genes were successfully knocked out (Table 3), for a total of

12 plant lines that chemotypic data was obtained. Os-cyp99a2 had one homozygous mutant line, Os-ms1 had two, Os-ksl4 had one, Os-kol4 had two, Os-cyp76m7&m8 was a double knockout with one homozygous mutant line, Os-ksl10 had one, Os-cyp76m7 had one, and Os-ksl7 had two homozygous mutant lines (Table 4). These CRISPR lines are the same ones that were analyzed in chapters 4, 5, and 6.

Plant Growth

Rice was germinated on Murashige and Skoog (MS) plates in growth chambers cycling 12 h light 28°C/12 h dark 24°C for one week before being transferred to small 4 inch pots. These settings are used by all growth chambers in this dissertation. Two 11 weeks post germination (wpg) the rice was transferred to large plastic boxes filled with

Iowa field soil. The rice was kept in similar growth chambers or a greenhouse for the duration of growth. Two cubic centimeters of Peters Excel All-Purpose Formulation fertilizer (15%N-5%P-15%K) in 7 L of water was added weekly to water the rice.

Induction and Extraction of Diterpenoids

To extract the diterpenoids exuded by roots, after germination the rice seedlings would be placed in glass tubes, five seedlings in each tube, with ample amounts of rice growth media consisting of 1.43 mM NH 4NO 3, 1.0 mM CaCl 2, 0.32 mM NaH 2PO 4·2H 2O,

0.51 mM K2SO 4, 1.64 mM MgSO4·7H 2O, 9.47 μM MnCl 2·4H 2O, 0.075 μM (NH4) 6Mo 7O24

·4H 2O, 0.018 mM H 3BO 3, 0.15 μM ZnSO4·7H 2O, 0.155 μM CuSO₄·5H₂O, 0.036 mM

FeCl 3.6H 2O, and 0.077 mM C 6H8O7. Seedlings were kept in the growth chambers. Two wpg the seedlings would be induced, and 72 h later diterpenoids were extracted from the exudate by filtering the exudates through a 0.1 g Bond Elut C18 spin-cartridge

(Agilent, Santa Clara, CA, USA) and eluting with 100% methanol. This was dried down under a stream of N2 and resuspended in 80% methanol. Ethyl acetate was used to extract the diterpenoids, but due to large error bars the decision was made to use C18 columns. Induction was performed either with 500 μM methyl jasmonate (MeJa) or 500

μM CuCl 2 and so throughout this dissertation. Sometimes 8.9mM MeJa was sprayed

(~2ml) onto rice seedling leaves to systemically induce the plant. This is annotated as

MeJa spray throughout.

Six wpg 0.1 g of the basal portion of the uppermost leaf was cut into 5cm pieces and induced by floating in 25 ml of the induction solution in an Erlenmeyer flask kept in 12 the growth chamber. 72 h later the diterpenoids were extracted. The exudates from the leaves were filtered through C18 columns and washed with 100% methanol. The leaf tissue was ground in liquid nitrogen and placed in a borosilicate test tube with 1ml of methanol for 24 h on a shaker at 4°C. The methanol was pushed through a 0.25μm nylon filter using a glass syringe, dried under a stream of N 2, and resuspended in 1 ml of

80% methanol to be run on the LCMS.

LC-MS/MS Analyses of Rice Phytoalexins

In order to accurately depict which compounds’ biosynthesis is affected by directed gene knockout, a method needed to be developed on an LC-MS/MS. Only certain standards were available on hand, the other compounds discovered in this method have yet to be verified by any standard and are only included because they match the characteristic mass spectra in the literature or through careful calculation estimating what the expected mass spectra should be. The available standards included: momilactones A and B; phytocassanes A, D, and E; and oryzalexins A, C, D, and

10 μL of rice extract was subjected to LC-MS/MS using an Agilent 1200 LC-MS coupled to a Bruker Solarix FT-ICR MS located at Iowa State University in the W. M.

Keck Metabolomics Research Laboratory on a Supelco (Sigma-Aldrich, St. Louis, MO,

USA) Ascentis C18 column (10 cm X 2.1 mm; 3 μm). A binary gradient was used, consisting of acetonitrile with 0.1% acetic acid v/v (buffer A) and water with 0.1% acetic acid v/v (buffer B). The solvent gradient elution was programmed as follows: initial, 40% buffer A; 0-2 min isocratic elution by 40% buffer A; 2-17 min, a linear 13 gradient from 40% buffer A to 100% buffer A; 17-20 min isocratic elution by 100% buffer A; 20-22 min a linear gradient from 100% buffer A to 40% buffer A. Flow rate was 0.3 ml/min for the entirety of the program. Molecules were ionized in positive mode with 0.5 V. Rice phytoalexins were isolated based on the calculated monoisotopic mass of each ion plus one [M+H] + with an isolation selection window of +/-2 m/z. The isolated masses were reionized, and the mass spectra observed.

The parent ions isolated and secondary ions chased for the rice phytoalexins with their corresponding retention times (RT) in the above described method were as follows: momilactone A, m/z 315.2 ‰271.2, RT 11.85min (Figure 3); momilactone B, m/z 331.2 ‰269.2, RT 9.93min (Figure 4); oryzalexin A, m/z 303.3 ‰285.2, RT

10.98min (Figure 5); oryzalexin C, m/z 301.2 ‰283.2, RT 12.41min (Figure 6); oryzalexin D, m/z 287.2 ‰269.2, RT 10.33min (Figure 7); oryzalexin E, m/z

287.2 ‰269.2, RT 12.21min (Figure 8); oryzalexin S, 305.2 m/z 305.2 ‰287.2, RT

11.3min (Figure 9); phytocassane A, m/z 317.2 ‰299.2, RT 9.39min (Figure 10); phytocassane B, m/z 335.2 ‰317.2, RT 8.11min (Figure 11); phytocassane C, m/z

319.2 ‰301.2, RT 7.57min (Figure 12); phytocassane D, m/z 317.2 ‰299.2, RT

10.78min (Figure 13); phytocassane E, m/z 317.2 ‰299.2, RT 10.17min (Figure 14); phytocassane F, m/z 333.3 ‰315.2 RT 8.1min (Figure 15) (Miyamoto et al., 2016;

Riemann et al., 2013; Horie et al., 2015).

For oryzalexin D and oryzalexin E no compound was found when isolating their monoisotopic mass of m/z 305.2 (Figure 16). After searching the literature, other researchers had isolated oryzalexin S (which has the same chemical formula and carries the same m/z of 305.2) by isolating m/z 287, which is a fragment of oryzalexin S, and 14 chasing m/z 105 (Horie et al., 2015; Toyomasu, et al., 2013)). This was tried first on the oryzalexin D and E standards, and after positive results was incorporated into our method. Unfortunately two oryzalexins, B and F, were unable to be isolated in this project, due to the lack of authentic standards.

Due to the coelution of some compounds at the same RT (Figure 17), two different methods were needed, each isolating half of the phytoalexins, and thus requiring dual runs for each rice extract. The first method isolated phytocassane C at 0-

7.72 min; phytocassane B at 7.72-8.5 min; phytocassanes A, D, and E at 8.5-10.71 min; oryzalexin A at 10.71-11.47 min, momilactone A at 11.47-11.95 min, and oryzalexin E at

11.95 min to the end of the program. The second method isolated phytocassane C at 0-

7.72 min, phytocassane F at 7.72-8.5 min, momilactone B at 8.5-10.1 min, oryzalexin D at 10.1-10.71 min, oryzalexin S at 10.71-11.47 min, momilactone A at 11.47-11.95 min, and oryzalexin C at 11.95 min to the end of the program.

Oryzalexins were only regularly and reliably detectable in CuCl 2 induced leaves.

Otherwise they were quite difficult to find even in the wild types.

Samples were run at a minimum in triplicate per line. Momilactone A is the largest and most regular peak that appears in every sample (except for Os-cps4/Os- ksl4). Because of this, if a sample had an amount of momilactone A that differed by a factor of 3 from the average amount of momilactone A for that specific knockout, it was excluded from the dataset as an outlier. The student’s one-tailed two samples with heteroscedastic t-test was used to determine statistically relevant significance on all data sets.

References Horie, K., Inoue, Y., Sakai, M., Yao, Q., Tanimoto, Y., Koga, J., Toshima, H., and Hasegawa, M. (2015). Identification of UV-Induced Diterpenes Including a New Diterpene Phytoalexin, Phytocassane F, from Rice Leaves by Complementary GC/MS and LC/MS Approaches. J. Agric. Food Chem. 63: 4050-4059. Miyamoto, K., Fujita, M., Shenton, M., Akashi, S., Sugawara, C., Sakai, A., Horie, K., Hasegawa, M., Kawaide, H., Mitsuhashi, W., Nojiri, H., Yamane, H., Kurata, N., Okada, K., and Toyomasu, T. (2016). Evolutionary trajectory of phytoalexin biosynthetic gene clusters in rice. The plant journal. 87, 293-304. Riemann, M., Haga, K., Shimizu, T., Okada, K., Ando, S., Mochizuki, S., Nishizawa, Y., Yamanouchi, U., Nick, P., Yano, M., Minami, E., Takano, M., Yamane, H., and Iino, M. (2013). Identification of rice Allene Oxide Cyclase mutants and the function of jasmonate for defence against Magnaporthe oryzae. Plant J 74, 226- 238. Toyomasu, T. , Usui, M., Sugawara, C., Otomo, K., Hirose, Y., Miyao, A., Hirochika, H., Okada, K., Shimizu, T., Koga, J., Hasegawa, M., Chuba, M., Kawana, Y., Kuroda, M., Minami, E., Misuhashi, W., and Yamane, H. (2013). Reverse-genetic approach to verify physiological roles of rice phytoalexins: characterization of a knockdown mutant of OsCPS4 phytoalexin biosynthetic gene in rice. Physiol. Plant. 150: 55-62. Wang, C., Shen, L., Fu, Y., Yan, C., and Wang, K. (2015). A Simple CRISPR/Cas9 System for Multiplex Genome Editing in Rice. Journal of Genetics and Genomics. 42: 703-706. Zhou, H., Liu, B., Weeks, D. P., Spalding, M. H., and Yang, B. (2014). Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Research. 42: 10903-10914.

Figures

Figure 1. The pertinent section of the pENTR4 construct used to construct the CRISPR/Cas9 knockouts.

Figure 2. The pertinent section of the pUbi-Cas9 vector used to transform into the agrobacterium.

Figure 3. Kitaake wild type CuCl 2 leaf tissue extract (top) with momilactone A standard (bottom) showing characteristic mass spectra.

Figure 4. Momilactone B standard (top) with Kitaake wild type CuCl 2 leaf tissue extract (bottom) showing characteristic mass spectra.

Figure 5. Oryzalexin A standard (top) with Kitaake wild type CuCl 2 leaf tissue extract (bottom) showing characteristic mass spectra.

Figure 6. Kitaake wild type CuCl 2 leaf extract (bottom/blue) and oryzalexin C standard (top/orange) with characteristic oryzalexin C mass spectra.

Figure 7. Kitaake wild type CuCl 2 leaf extract (top/brown) and oryzalexin D standard (bottom/orange) with characteristic oryzalexin D mass spectra.

Figure 8. Kitaake wild type CuCl 2 leaf extract (top/brown) and oryzalexin E standard (bottom/grey) with characteristic oryzalexin E mass spectra.

Figure 9. Kitaake wild type CuCl 2 leaf extract with characteristic oryzalexin S mass spectra.

Figure 10. Kitaake wild type CuCl 2 leaf extract (top/blue) and phytocassane A standard (bottom/purple) with characteristic phytocassane A mass spectra.

Figure 11. Kitaake wild type CuCl 2 leaf extract with characteristic phytocassane B mass spectra.

Figure 12. Kitaake wild type CuCl 2 leaf extract with characteristic phytocassane C mass spectra.

Figure 13. Kitaake wild type CuCl 2 leaf extract with characteristic phytocassane D mass spectra (bottom/blue) with the phytocasane D standard (top/green).

Figure 14. Kitaake wild type CuCl 2 leaf extract with characteristic phytocassane E mass spectra.

Figure 15. Kitaake wild type CuCl 2 leaf extract with characteristic phytocassane F mass spectra.

Figure 16. Isolating m/z 305 and chasing m/z 287 gave no signal for the standard of oryzalexins D and E.

Figure 17. Coelution of phytocassane B and phytocassane F in the LC-MS method. The yellow chromatogram is the extracted ion 335 m/z, the monoisotopic mass of phytocassane B, while the blue chromatogram is the extracted ion 333 m/z, the monoisotopic mass of phytocassane F. This occurs with a number of compounds being isolated in this project, which is the reason for needing dual methods. 30

Tables

Table 1. Primers ordered to sequence the genes both prior to and after mutation. Gene Forward Primer Reverse Primer OsKSL4 AGGGAATGCAAGGATGGCAA CTAGTTGCCTCTAGTTTTCA OsKSL7 GCATGGAGAACTACCGAATG AGTCTTACCGTCGCTTGCAG OsKSL10 ATGGTGCAGGCAACTACGAT GTGTGCCACGTAAGCTGAAA OSKOL4 GTGCGTGTGATCAGATCGTG GTTTGTGCACAATAGGTGTG CYP76M7 CCTGGCTCACATCCGCGACGG GCGCTCCGCCAGCGGCAGCCCG OsCYP76M7&M8 (M7) CTACGCCGGCGGCAAACCCC ACGAGGTTGAGGAGGCCAGT OsCYP76M7&M8 (M8) ATGGAGAATAGCCAGATGTG TGCCCGTGTACATGGCGTGG OsMS1 GGGTATGCATTACGTTAAG GCTCACGTACCGGCCGTCGT OsCYP99A2 TCAGGAACATCAAGGCCGCC GTGGAACATATCCTGCACAAT OsCYP99A2 AGAGACGACGTCGTCGGCCG CCAGTACTCGGGGCTCCTCG

Table 2. The variable portion of the sgRNA known as crRNA was specifically modified for every gene knockout that used the CRISPR/Cas9 system. Two pairs of primers were created for every knockout. Gene crRNA Forward primer crRNA Reverse primer OsKOL4 tgttGGCCGTCGGGGGCCTCGTCG aaacCGACGAGGCCCCCGACGGCC OsKOL4 gtgtGCTCGCCGACAAGCTCGTCG aaacCGACGAGCTTGTCGGCGAGC OsKSL4 tggtGTGTTCTACTCTCAGGCCGA aaac TCGGCCTGAGAGTAGAACAC OsKSL4 gtgtTAGAAGAGAGTTGCTACGGT aaac ACCGTAGCAACTCTCTTCTA OsKSL7 tgttGGCTACGGCGGAAAATTCGC aaacGCGAATTTTCCGCCGTAGCC OsKSL7 gtgtGCCGTAGCCGCCGGACGAAG aaacCTTCGTCCGGCGGCTACGGC OsKSL10 tgttGGGGTGAAATTCTTGGGATT aaacAATCCCAAGAATTTCACCCC OsKSL10 gtgtGGTCCTTTGCTCATCTGCTT aaacAAGCAGATGAGCAAAGGACC OsCYP76M7 tgttGTCACCCCCGCTGGACTTCA aaacTGAAGTCCAGCGGGGGTGAC OsCYP76M7 gtgtGGACACCATGGCCCTCACCC aaacGGGTGAGGGCCATGGTGTCC OsCYP76M7&M8 tgttGCGCCCCATCCGCGAGAGGA aaacTCCTCTCGCGGATGGGGCGC OsCYP76M7&M8 gtgtGAGCTCCGACCCGCAGTGGA aaacTCCACTGCGGGTCGGAGCTC OsCYP99A2 tgttGGCGACCTCGAATTCCCCTT aaacAAGGGGAATTCGAGGTCGCC OsCYP99A2 gtgtGCAGGTCTCCCGGCAGAGAT aaacATCTCTGCCGGGAGACCTGC OsMS1 tgttGAAGGGCGCAGGCGCACTCA aaacTGAGTGCGCCTGCGCCCTTC OsMS1 gtgtGATGAGCGAGTGCACCAAGG aaacCCTTGGTGCACTCGCTCATC

Table 3. Included in this table are the RegSeq gene numbers for the 8 rice genes investigated in this study. Gene RefSeq Locus OsCYP76M7 Os02g0569900 OsCYP76M8 Os02g0569400 OsCYP99A2 Os04g0180400 OsCYP701A8 (KOL4) Os06g0569500 OsMS1 (OsMAS) Os04g0179200 OsKSL4 Os04g0179700 OsKSL7 Os02g0570400 OsKSL10 Os12g0491800

Table 4. Plant line gene mutations caused by the CRISPR/Cas9 system in the Kitaake cultivar of rice. “____ ” indicates missing nucleotides/amino acids relative to the wild type. Red letters indicate added or changed nucleotides/amino acids relative to the wild type. Mutation Mutation OsCas9 Gene Line 1 2 DNA Sequence Protein Sequence present? Met P H L P G D L R H W OsCYP99A2 4 -TC ATGCCCCATC __ TGCCGGGAGACCTGCGACAT W L Stop yes OsMS1 5 -CACC AG GATGAGCGAGTG ____ AAGGAGG ACTT R Met S E Stop R R T yes R Met S E C T R R T S S A OsMS1 15 -A diallelic AG GATGAGCGAGTGCACCA _GGAGG ACTT C S P Stop yes OsKSL4 8 -CTACGGT+GG GAGTTG ______GG TGGTTGTTAGAGA E L G G C Stop R no CTCG ___ CGG CGGCCGC GC ______AAGA L _A A A A Q E P R Q P A S OsKOL4 6 -TCG -35bp A R Stop yes ______CG OsKOL4 7-1 -68bp CCGCCGCCGCGCAAGAA G R A N P P P G N Stop yes OsCYP76M7 &M8 (M7) 10-2 +T TCCGACCCGCAG TTGGAAGGCCCTGCGCGGGA S D PQ L E G P A G no ATCCC GAGCTCCGACC ____ GTGGA AGGCCCTGCGGGGGATCCAC I P S S D R G R P C G G S T OsCYP76M7 GCCTCGCACGTCTTCACCCCGCGGGTGCTCGCCGCGGT GCGCCCC P R T S S P R G C S P R C A 31 &M8 (M8) 10-2 -CGCA +A ATCCGCGA AGAGGA AGGTGGGCGA P S A K R K V G no

Met G Q I P R I S P H Y Y G OsKSL10 5 +T CTGCCA AAG TCAGATGAGCAAAGGACA TCC Met L P K S D E Q R T S yes complete OsCYP76M7 7-1 KO GT GGACACCATGGCCCTCA ______V D T Met A L K S S yes OsKSL7 1 -C CCTT _GTCCGGCGGCTACGGCGGAAAATTCGC P C P A A T A E N S yes OsKSL7 2 -C CCTT _GTCCGGCGGCTACGGCGGAAAATTCGC P C P A A T A E N S yes 32

CHAPTER THREE: INFERRING ROLES IN DEFENSE FROM METABOLIC ALLOCATION-RICE DITERPENOIDS

Running title: Metabolic allocation and physiological function

Xuan Lu 1,† , Juan Zhang 1,2,† , Benjamin C. Brown 1, Meimei Xu 1, Riqing Li 3, Bo Liu 3, Julio Rodríguez-Romero 4, Dangping Luo 3, Zhiqiang Pan 5, Scott R. Baerson 5, Zhaohu Li 2, Ane Sesma 4, Bing Yang 3 and Reuben J. Peters 1, *

1Roy J. Carver Department of Biochemistry, Biophysics, and Molecular Biology, Iowa State University, Ames, IA 50011, USA 2State Key Laboratory of Plant Physiology and Biochemistry, College of Agronomy and Biotechnology, China Agricultural University, Beijing 100193, China 3Department of Genetics, Development and Cell Biology, Iowa State University, Ames, IA 50011, USA 4Centre for Plant Biotechnology and Genomics (CBGP), Universidad Politecnica de Madrid, Campus de Montegancedo, 28223 Pozuelo de Alarcon, Madrid, Spain 5U.S. Department of Agriculture, Agricultural Research Service, Natural Products Utilization Research Unit, Oxford, MS 38655, USA

*Address correspondence to Reuben J. Peters, [email protected] †These authors contributed equally.

Summary: Metabolic allocation of diterpenoids in rice leads to discovery of physiological function in plant disease resistance.

Abstract

Among their responses to microbial infection, plants deploy an arsenal of antibiotic natural products. While these historically have been identified on the basis of their antibiotic activity in vitro , this leaves open the question of their relevance to defense in planta . The vast majority of such natural products from the important crop plant rice ( Oryza sativa ) are diterpenoids whose biosynthesis proceeds via either ent - or syn - copalyl diphosphate (CPP) intermediates, and which were isolated on the basis of their antibiotic activity against the fungal blast pathogen Magnaporthe oryzae .

However, rice plants in which the gene for the syn -CPP synthase Os-CPS4 is knocked-out do not exhibit increased susceptibility to M. oryzae . Here it is further shown that knocking-out or knocking-down Os-CPS4 also actually decreases susceptibility to the bacterial leaf blight pathogen Xanthomonas oryzae . On the other hand, knocking-out or knocking-down the gene for the ent -CPP synthase Os-CPS2 is found to increase susceptibility to both M. oryzae and X. oryzae , while over-expressing Os-CPS2 decreases susceptibility to both. Nevertheless, rice plants allocate substantial metabolic resources towards syn - as well as ent -CPP derived diterpenoids upon infection/induction. On the basis of this observation further investigation was carried out, revealing that Os-CPS4 plays a role in fungal non-host disease resistance. Thus, as exemplified here with rice diterpenoids, examination of metabolic allocation provides important clues into physiological function.

Introduction

Plants deploy an arsenal of antimicrobial natural products during pathogen infection (Bednarek and Osbourn, 2009). This is considered to be an effective means of defense. However, historically the underlying studies most often rely on anti-microbial activity demonstrated with isolated compounds. Such antibiotics whose production is strongly induced by infection are termed phytoalexins, while those constitutively present are termed phytoanticipans (VanEtten et al., 1994). The relevance of such natural products to plant defense is most rigorously supported by genetic evidence using gene knockout lines in which the compound(s) of interest can no longer be produced, but the remainder of the plant defense response has been retained. Such evidence has been provided in at least a few cases (Ahuja et al., 2012). For example, camalexin and certain sesquiterpenes in Arabidopsis, as well as triterpenoid saponins in oats, all clearly play a role in plant defense against infection by certain pathogens

(Papadopoulou et al., 1999; Thomma et al., 1999; Huang et al., 2012). Nevertheless, in other cases such genetic analysis does not support the relevance of at least some phytoalexins to the plant defense response. Of particular relevance here, despite being the first identified rice phytoalexins against the fungal blast agent Magnaporthe oryzae

(Cartwright et al., 1981), the momilactones do not seem to play an important role in rice plant defense against this fungal pathogen (Xu et al., 2012).

Almost all of the identified antibiotic natural products from the important crop plant rice ( Oryza sativa ) are diterpenoids (Schmelz et al., 2014). In particular, labdane- related diterpenoids, whose biosynthesis can be traced back to that of the gibberellin phytohormones (Peters, 2010). Most of these compounds, specifically momilactones A

& B, oryzalexins A-F, oryzalexin S and phytocassanes A-F, were originally isolated and identified on the basis of their activity against M. oryzae (Peters, 2006). Infection by M. oryzae further strongly induces accumulation of these labdane-related diterpenoids

(Hasegawa et al., 2010), which then seem to be phytoalexins. The remaining labdane- related diterpenoid antibiotics, including oryzalide A and B, oryzalic acid A and B and oryzadione I to III (Toyomasu, 2008), all of which are termed oryzalide-related here, were isolated and identified on the basis of their activity against the bacterial leaf blight pathogen Xanthomonas oryzae pv. oryzae (Xoo ). The production of these labdane- related diterpenoids is only weakly induced by Xoo infection (Watanabe et al., 1996), and they then seem to be phytoanticipans.

As with the vast majority of phytoalexins, these rice labdane-related diterpenoids have been assumed to be relevant to plant defense on the basis of their antibiotic activity in vitro . However, it should be noted that the momilactones were actually first isolated on the basis of their plant growth suppressing activity (Kato et al.,

1973), and are constitutively secreted from the roots into the soil, where they have long been suggested to act as allelochemicals, most specifically momilactone B (Kato-

Noguchi and Peters, 2013). This offers an alternative rationale for the production of at least the momilactones. Nevertheless, momilactones, as well as phytocassanes, accumulate in leaves upon infection by M. oryzae (Hasegawa et al., 2010). In addition, both the momilactones and phytocassanes have recently been shown to accumulate specifically at the site of Xoo infection in rice leaves (Klein et al., 2015).

The defining characteristic of labdane-related diterpenoids is their biosynthetic origin from bicyclization of the general diterpenoid precursor ( E,E,E )-geranylgeranyl

36 diphosphate (GGPP) catalyzed by class II diterpene cyclases (Peters, 2010). This most often results in the production of the eponymous labdadienyl/copalyl diphosphate

(CPP), with the relevant enzymes then termed CPP synthases (CPSs; Fig. 1). All vascular plants seem to produce the labdane-related diterpenoid gibberellins as phytohormones, and this depends on the production of ent -CPP (Hedden and Thomas, 2012). Rice produces two different stereoisomers of CPP, both the requisite ent -CPP, and the diastereomer syn -CPP. The production of these is catalyzed by three distinct CPSs in rice. Two of these produce ent -CPP, both Os-CPS1 and Os-CPS2, while the third, Os-

CPS4, produces syn -CPP (Otomo et al., 2004; Prisic et al., 2004; Xu et al., 2004). Of the two ent -CPP producing CPSs, only Os-CPS1 seems to be involved in gibberellin metabolism (Sakamoto et al., 2004). On the other hand, transcript levels of Os-CPS2 and

Os-CPS4 are inducible, and both have been suggested to play a role in the production of more-specialized labdane-related diterpenoids that serve as phytoalexins and/or phytoanticipans (Peters, 2006; Toyomasu, 2008). The diterpenes whose hydrocarbon structures define the various families of derived diterpenoids are produced from ent - or syn - CPP by class I diterpene synthases, which are related to the ent -kaurene synthase

(KS) required for gibberellin phytohormone biosynthesis and have been termed kaurene synthase-like (KSLs; Fig. 1).

Given the potential redundancy stemming from the presence of two ent -CPP producing CPSs, previous work has focused on analysis of the syn -CPP derived labdane- related diterpenoids in rice, whose biosynthesis depends only on Os-CPS4 . However, of the identified antibiotic labdane-related diterpenoids from rice, only momilactones A &

B and oryzalexin S are derived from syn -CPP, while the rest are derived from ent -CPP

(Fig. 1). Previous work with a T-DNA insertion mutant of Os-CPS4 indicated that these knock-out Os-cps4ko plants are not more susceptible to infection with M. oryzae than the parental/wild-type (WT) line. Additional analyses, including the use of a mutant rice line in which the Os-KSL4 that acts downstream of Os-CPS4 in momilactone biosynthesis (Fig. 1) is similarly knocked-out by T-DNA insertion, indicates that these diterpenoids act as allelochemicals (Xu et al., 2012). However, another study, using rice plants in which Os-CPS4 expression is knocked-down, although not completely abolished, suggested that OsCPS4-dependent labdane-related diterpenoids do play a role in defense against M. oryzae (Toyomasu et al., 2014). This discrepancy may reflect the different genetic backgrounds of the rice lines and/or fungal strains used in each of these studies. For example, it has been noted that susceptible cultivars produce less momilactones and phytocassanes than resistant cultivars, at least at early time points

(Hasegawa et al., 2010; Klein et al., 2015), and Os-cps4ko is derived from a susceptible cultivar (ssp. japonica cv. Zhonghua 11). Accordingly, such reduced and/or delayed production (i.e., even in the parental/WT line) may underlie the observed lack of effect with Os-cps4 plants.

Here genetic evidence is provided indicating that Os-CPS2 dependent diterpenoids (i.e., those derived from ent -CPP) are relevant to rice plant defense against both the fungal pathogen M. oryzae and bacterial pathogen Xoo . In addition, although

Os-CPS4 dependent diterpenoids (i.e., those derived from syn -CPP) do not seem to be relevant to rice plant defense against either M. oryzae or Xoo , the equivalent metabolic allocation towards such natural products prompted further analysis, which indicated that Os-CPS4 is relevant to non-host disease resistance against Magnaporthe poae .

Accordingly, investigation of metabolic allocation has provided insight into the roles of diterpenoids in the microbial defense response of the important crop plant rice, and this approach may be applicable to inference of the physiological function of natural products more broadly.

Results

Os-cps2 rice does not produce CPS2, and the lack thereof does not impact plant growth

The production of ent -CPP for more-specialized diterpenoid metabolism in rice has been hypothesized to largely depend on Os-CPS2. Here a reverse genetics approach was undertaken to investigate the biological function of ent -CPP derived diterpenoids

(other than gibberellins). From the Salk Research Institute Rice Functional Genomic

Express database only a single rice plant line with an insertion in an exon of Os-CPS2 was identified (Krishnan et al., 2009). This was obtained and verified to be a homozygous Os-cps2ko line, as characterized by PCR analysis of the transposon inserted into the sixth exon of the gene. As expected, Os-CPS2 transcripts could no longer be detected in Os-cps2ko plants (Fig. S1A), even following induction with methyl jasmonate

(Me-JA), which has been shown to induce accumulation of transcripts for both Os-CPS2 and Os-CPS4 (Prisic et al., 2004; Xu et al., 2004). To supplement this single knock-out line, Os-CPS2 was also targeted by RNAi to generate knock-down Os-cps2i lines. In order to compare this more directly to the previously reported Os-cps4 knockout line, these were constructed in that genetic background (i.e., ssp. japonica cv. Zhonghua 11). Three

Os-cps2i lines were selected for further analysis based on their reduced expression of

Os-CPS2 following Me-JA induction. Consistent with the previously suggested predominant role of Os-CPS1 in gibberellin metabolism (Sakamoto et al., 2004), none of these Os-cps2i lines were found to exhibit any significant reduction in growth, although there is a slight delay (~1 week) in flowering time (Fig. S2).

Os-cps2 rice exhibits increased susceptibility to M. oryzae and X. oryzae pv. oryzae

Given that some ent -CPP dependent diterpenoids have been suggested to serve as phytoalexins against M. oryzae (Peters, 2006), while others have been suggested to be phytoanticipans against Xoo (Toyomasu, 2008), the susceptibility of Os-cps2 rice relative to the parental/WT cultivar was investigated with both microbial pathogens.

Infecting leaves with a rice isolate of M. oryzae (Guy 11), causes disease symptoms on

Os-cps2 lines and the parental/WT cultivar. However, there was a significant difference in the percentage of infected/necrotic area of leaves from Os-cps2 plants relative to that for the parental/WT cultivar (Fig. 2A). Thus, ent -CPP derived diterpenoids seem to serve an effective role in rice plant defense against this fungal pathogen. In addition, when infected with Xoo via a leaf clipping method Os-cps2 rice generally exhibited significantly longer lesion lengths than the parental/WT cultivar (Fig. 2B). Accordingly, ent -CPP derived diterpenoids seem to serve an effective role in rice plant defense against this bacterial pathogen as well. These results are consistent with the reported anti-fungal activity of the ent -cassadiene derived phytocassanes and anti-bacterial activity of the ent -(iso)kaurene derived oryzalide-related diterpenoids.

Os -cps4 rice exhibits increased resistance to X. oryzae pv. oryzae

Previous results indicated that a T-DNA insertion (knock-out) mutant of Os-

CPS4 , Os-cps4ko , is no more susceptible than its parental/WT line (ssp. japonica cv.

Zhonghua 11) to infection with M. oryzae , as well as another rice fungal pathogen,

Fusarium fujikuroi (Xu et al., 2012). To investigate the role of syn -CPP derived diterpenoids in resistance to Xoo , analogous infections were carried out with Os-cps4ko and its parental/WT line. Intriguingly, Os -cps4 plants exhibited significantly shorter lesion length relative to those from its parental/WT line, indicating that this mutant has increased resistance to the bacterial leaf blight disease (Fig. 3A). To further support this surprising effect, Os-CPS4 was also targeted by RNAi to generate knock-down Os-cps4i lines. In order to compare this directly to Os-cps2ko rice, these were constructed in the same genetic background (i.e., ssp. japonica cv. Zhonghua 11). Again, three Os-cps4i lines were selected for further analysis based on their reduced expression of Os-CPS4 , even following Me-JA induction. Similar to Os-cps4ko , all three Os-cps4i lines also exhibited increased resistance to Xoo (Fig. 3C).

Os-CPS2 over-expressing rice exhibits increased resistance to X. oryzae pv. oryzae

The observation that Os-cps4 rice exhibits increased resistance to Xoo suggests the hypothesis that blocking metabolic flux to syn -CPP derived diterpenoids leads to re- allocation of GGPP towards the ent -CPP derived diterpenoids that are effective antibiotics against Xoo instead. To further explore this possibility, Os-CPS2 was over- expressed in ssp. japonica cv. Kitaake. A line whose enhanced expression of Os-CPS2 was verified by RT-PCR was then selected for further characterization (Fig. S1B). This

Os-CPS2OE rice exhibited normal growth and development, indicating that its gibberellin phytohormone levels were not affected. On the other hand, this also was found to exude much greater amounts of phytocassanes relative to the parental/WT line (~40-fold increase). When infected with Xoo , Os-CPS2OE rice further exhibited significantly shorter lesion lengths relative to the parental/WT line ( p < 0.01 in an unpaired t-test), indicating increased resistance to bacterial leaf blight (Fig. 4). This result further supports a role for ent -CPP derived diterpenoids as anti-bacterial agents in rice plant defense, at least against Xoo , consistent with the known anti-Xoo activity of the oryzalide-related diterpenoids, and also the hypothesis that the increased resistance of Os-cps4 rice to Xoo infection may be due to increased allocation towards these effective phytoanticipans.

Os-CPS4 plays a role in fungal non-host disease resistance

Strikingly, the results presented above indicate that syn -CPP derived diterpenoids do not have a role in defense against either M. oryzae or Xoo . Indeed, the most consistent role indicated for these is as allelochemicals (Xu et al., 2012; Toyomasu et al., 2014), which raises the question of why Os-CPS4 transcripts accumulate in response to either elicitation with the fungal cell wall component chitin (Okada et al.,

2007), or the defense signaling molecule Me-JA (Xu et al., 2004), along with further elaborated syn -CPP derived diterpenoids (Schmelz et al., 2014). Given that allelopathic activity has been convincingly assigned to the Os-KSL4 dependent momilactones (Xu et al., 2012), it also is unclear why rice produces additional syn -CPP derived diterpenoids

(Fig. 1). It has been shown that rice is resistant to a number of other fungal pathogens

42 from the Magnaporthe genus other than rice isolates of M. oryzae (Faivre-Rampant et al., 2008). Hypothesizing that Os-CPS4 might be a factor in such non-host disease resistance, a range of M. oryzae pathovars (isolated from alternative host plants), and other Magnaporthe species ( M. grisea , M. rhizophila and M. poae ) were tested with Os- cps4ko and its parental/WT line. Given that M. rhizophila and M. poae infect only underground tissues, and that M. oryzae can infect rice through the roots as well (Sesma and Osbourn, 2004), these infections were directed at the roots. As previously reported

(Xu et al., 2012), no significant differences were observed with the Guy 11 strain (rice isolate) of M. oryzae (Fig. 5A). However, with two other pathovars/strains of M. oryzae

(G22, isolated from Eragrostis curvula , and JP15, isolated from Elusine coracana ), as well as M. grisea (strain BR29, isolated from Digitaria sanguinalis ), M. rhizophila (strain

1, isolated from Poa pratensis ) and M. poae (strain 73-1, isolated from wheat, Triticum aestivum ), Os-cps4ko lines exhibited varying increases in susceptibility relative to the parental/WT cultivar (Fig. 5A), perhaps most strongly with M. poae (Fig. 5B). Similar significantly decreased resistance to M. poae was observed with the Os-cps4i lines as well (Fig. 5C). Thus, these results indicate a role for syn -CPP derived diterpenoids in the non-host disease resistance of rice, at least against fungi from the Magnaporthe genus, providing a role for Os-CPS4 and, hence, syn -CPP derived diterpenoids, in plant defense against microbial pathogens.

Os-cps2 rice is typically unchanged in phytoalexin content, while Os-cps2i has decreased phytocassanes

In the case of the Os-cps2 lines, consistent with the presence of the biochemically analogous (i.e., ent -CPP producing) Os-CPS1 , the amount of phytocassanes and momilactones were nearly unchanged (even in the Os-cps2ko line) with only a slight and statistically insignificant decrease in the phytocassanes in CuCl 2 root exudates, relative to the parental/WT cultivar (Fig. 2C). The same was true of Os-cps2 induced by

CuCl 2 and MeJa in the leaf tissue, leaf exudates, and root exudates (Fig. S4). Os-cps2 root exudates induced by spraying MeJa had decreased phytocassanes (Fig. S4F). The Os- cps2i lines had a decrease in phytocassanes in the root exudates when induced with

CuCl 2, and a slight decrease when induced by spraying MeJa (Fig. 2D).

Os-cps4 rice does not produce momilactones

The major labdane-related diterpenoids in rice are the syn -CPP derived momilactones and ent -CPP derived phytocassanes (Toyomasu et al., 2008). These can be detected in induced leaves, which was used here to analyze the effect of genetic manipulation on phytochemical accumulation. In the case of the Os-cps4 rice, consistent with the lack of any other syn -CPP producing CPS’s, the momilactones are gone under all induction conditions in any tissue (Fig. S5), while wild type plants containing CPS4 have an overabundance of constitutively expressed momilactones (Fig 3. D). No Os-cps4 analyses of phytoalexins had any significant change in oryzalexins or phytocassanes, the detectable ent-CPP derived diterpenoids. All three Os-cps4i lines had reduced amounts of momilactones in their spray MeJa induced root exudates (Fig. 3B).

Discussion

The sheer number of rice diterpenoid phytoalexins isolated on the basis of antibiotic activity against just M. oryzae raises questions regarding their relevance to plant defense. This was heightened by a report that the Os-CPS4 dependent diterpenoids do not appear to play a significant role against M. oryzae , instead acting as allelochemicals, a role which was more specifically assigned to the Os-KSL4 dependent momilactones (Xu et al., 2012). It was then unclear what role other syn -CPP derived diterpenoids might play. Moreover, the role of the many ent -CPP derived diterpenoids also had not yet been proven. Here, genetic manipulation of Os-CPS2 and Os-CPS4 was employed to demonstrate that, although Os-CPS4 further does not play a role in defense against the bacterial pathogen Xoo , Os-CPS2 is relevant to rice plant defense against both Xoo and the fungal pathogen M. oryzae .

Despite the potential for the ent -CPP product of Os-CPS2 to serve as a precursor to the gibberellin phytohormones, manipulation of Os-CPS2 does not seem to significantly affect normal rice plant growth and development. The lack of such effect in

Os-cps2 rice is consistent with the previously reported dominant role of Os-CPS1 in gibberellin metabolism (Sakamoto et al., 2004). In addition, the normal development of the Os-CPS2OE plants is consistent with previous results in Arabidopsis thaliana , where over-expression of the endogenous At-CPS led to increases in ent -kaurene, but no increase in gibberellins (Fleet et al., 2003). While similar increases in ent-kaurene were observed here (Fig. S3A), this also may serve as a precursor of the anti-bacterial oryzalide-related diterpenoids (Fig. S3B), providing an alternative metabolic fate that

45 would be consistent with the observed increased resistance of Os-CPS2OE rice to Xoo

(Fig. S3C).

The results reported here indicate that, at least in the Nipponbare cultivar, genetic manipulation of OsCPS2 has little effect on phytocassane and oryzalexin content, presumably due to the ability of OsCPS1 to act in the same manner as OsCPS2 .

Nevertheless, OsCP2 is important for plant defense, as evidenced by the Os-cps2 lines being more susceptible to both Xoo and M. oryzae . This disparity may reflect the differential expression of the ent-CPS genes in different tissues, as Os-CPS1 , required for gibberellin metabolism, is selectively expressed in the vascular bundle, while the biochemically analogous (i.e., ent -CPP producing) Os-CPS2 is largely expressed in epidermal cells (Toyomasu et al., 2015). And so while Os-CPS1 can do the work of Os-

CPS2 , the ent-phytocassanes were not produced in the epidermal tissue in the Os-cps2 lines, allowing the pathogens to break through the epidermal tissues and establish a foothold in the plant before ent-diterpenoids can be mobilized to the epidermal tissues.

Perhaps the ent-diterpenoids are useful only before the pathogens reach the interior of the plant. The disparity between the Os-cps2 and the Os-cps2i lines could come merely from the difference in genetic backgrounds (Nipponbare vs. Zhonghua 11), or the Os- cps2i lines may have been targeting OsCPS1 as well.

Notably, the observed significant metabolic allocation towards syn -CPP derived diterpenoids (which are dependent on Os-CPS4 ), indicated that these natural products must play some role in plant defense. This prompted studies that revealed at least some of these compounds are important in non-host disease resistance against Magnaporthe species of fungi that are not adapted to rice. Indeed, M. oryzae has already been shown

46 to metabolize momilactones (Hasegawa et al., 2010), which presumably is at least partially responsible for its ability to infect rice. Thus, rice labdane-related diterpenoid natural products seem to play a number of roles, including acting as antibiotics against adapted bacterial and fungal pathogens (i.e., Xoo and M. oryzae , respectively), as well as in fungal non-host disease resistance, along with acting as allelochemicals. Accordingly, the complexity of rice diterpenoid metabolism seems to be matched by the variety of physiological roles played by these natural products. It will now be of interest to determine if further dissection of the roles played by rice diterpenoids, and the clusters of biosynthetic genes that (at least partially) underlie the production of these natural products (Yamane, 2013; Zi et al., 2014), supports this hypothesis.

More broadly, the results reported here suggest that evolution is unlikely to allow allocation of significant metabolic effort without physiological function.

Accordingly, investigation of metabolic partitioning, particularly in combination with various stresses (e.g., biotic and/or abiotic elicitation), then provides a means of inferring potential roles. In conjunction with biochemical analyses defining the relevant enzymatic genes, the inferred relevance to various physiological functions can be further investigated via reverse genetic approaches. Critically, much as shown here for the role of Os-CPS4 in fungal non-host disease resistance, the inferred relevance can be used to stimulate further productive investigations even in the absence of evidence for the originally proposed function.

Methods

Chemicals

Unless otherwise noted, all molecular biology reagents were purchased from

Invitrogen (Carlsbad, CA, USA) and all other chemicals from Fischer Scientific

(Waltham, MA, USA).

Plant materials

Rice plants ( Orzya sativa L. ssp. japonica cv. Nipponbare, Kitaake or Zhonghua

11) were grown in standard growth chambers cycling between 12 h light at 28 °C and

12 h dark at 24 °C.

The Os-cps2 T-DNA insertion mutant RGT1043_5.1 (insert in the sixth exon of Os-

CPS2 ; TIGR ID, LOC_ Os02g36210) was obtained from the UC-Davis Transposable

Element Insertion Database. This mutant is in the ssp. japonica cv. Nipponbare background. Homozygous Os-cps2 plants were selected by RT-PCR of Os-CPS2 (i.e., the absence of any cDNA) from the obtained seeds. Homozygous Os-cps2 plants were verified in the next generation and propagated to provide seeds for the experiments described here.

The Os-cps4 T-DNA insertion mutant RMD_03Z11UZ33, and selection of a homozygous line, has been previously described (Xu et al., 2012). This mutant is in the ssp. japonica cv. Zhonghua 11 background.

RNAi vector construction and rice transformation

Binary vectors were developed for RNAi-mediated repression of Os-CPS2 and Os-

CPS4 transcription using target regions of 374 and 435 bp in length, respectively, cloned in both sense and antisense orientation, separated by a 1.13 kb intron sequence derived from the Arabidopsis FAD2 gene (Okuley et al., 1994) and positioned downstream of the constitutive polyubiquitin-1 promoter from Zea mays with its cognate intron (Christensen et al., 1992). The specific target sequences selected for

CPS2 (GenBank accession number AY602991) correspond to nucleotides 2386-2760 of the coding sequence plus an additional 153 bp of contiguous 3 ¢ UTR sequence; the specific target sequences selected for CPS4 (GenBank accession number AY530101) correspond to nucleotides 2192-2627 of the coding sequence plus an additional 224 bp of contiguous 3 ¢ UTR sequence. Os-CPS2 and Os-CPS4 target regions flanked by EcoRI (5 ¢ end) and BamHI (3 ¢ end) restriction sites were first generated by PCR amplification using O. sativa (cv. Nipponbare) genomic DNA as the template, to facilitate direct ligation with EcoRI- and BamHI-digested pUbi-IF2 (DNA Cloning Service, Hamburg,

Germany), with RNAi-1 primer pairs (Table S1). The resulting intermediate constructs were then digested with BsrGI and MluI, and Os-CPS2 and Os-CPS4 target regions flanked by BsrGI (5 ¢ end) and MluI (3 ¢ end) were also generated in a second round of

PCR amplifications with RNAi-2 primer pairs (Table S1). Following digestion with BsrGI and MluI, the PCR products were ligated with their corresponding intermediate vectors, resulting in the final intermediate vectors, pUbi-CPS2 and pUbi-CPS4, containing the complete hpRNA-generating transgene cassettes for Os-CPS2 and Os-CPS4 as confirmed by DNA sequencing. Finally, pUbi-CPS2 and pUbi-CPS4 were digested with SfiI, then the

RNAi cassette-containing fragments were gel-purified and ligated with SfiI-digested pLH7000 (Hausmann and Toepfer, 1999). The resulting binary vectors contain the hpRNA-generating cassettes arranged in a head-to-tail orientation with respect to the phosphinothricin N-acetyltransferase (PAT) selectable-marker cassette, and were designated pCPS2-RNAi and pCPS4-RNAi. For the generation of transgenic O. sativa events, A. tumefaciens strain EHA101 was transformed by electroporation with either pCPS2-RNAi or pCPS4-RNAi, and the resulting recombinant strains used to transform immature embryos of O. sativa , as previously described (Toki, 1997). Lines exhibiting decreased expression of Os-CPS2 were selected by RT-PCR and designated Os-cps2i , with seeds from T1 plants used in all subsequent analyses.

Over-expression vector construction and rice transformation

The open reading frame for Os-CPS2 was amplified from cDNA by PCR using

CPS2-OE primers (Table S1), which also introduced unique EcoRI and SpeI restriction sites at the 5 ¢ and 3 ¢ ends, respectively (Table S1). The PCR fragment was cloned into the EcoRI and SpeI restriction sites of the binary vector pBY02, such that expression is under the control of a cauliflower mosaic virus (CaMV) 35S promoter. The resulting pCPS2-OE construct was transformed into Agrobacterium tumefaciens EHA105 by electroporation. Immature embryo derived callus cells of rice (cv. Kitaake) were transformed by adapting a previously described protocol (Hiei et al., 1994). Briefly, transformed calli and regenerated plantlets were selected on media containing hygromycin B, with the resulting plants grown to seed, and Os-CPS2 overexpression confirmed by PCR. Selection was carried out for three more generations to obtain non-

50 segregating homozygous Os-CPS2OE plants. Two independent lines that exhibited strong over-expression of Os-CPS2 were selected for further analysis (Fig. S1B).

Disease resistance assays

Magnaporthe infection assays were carried out as previously described (Sesma and Osbourn, 2004). Briefly, for leaf infection assays, rice seedlings were grown until the stage of the third leaf emergence. All RNAi lines were pre-germinated in the presence of BASTA to ensure retention of the recombinant insert. Three pots of 10 plants were used per line and per experiment. Each pot was sprayed with 2 mL of a suspension of 10 5 conidia mL -1. The plants were further incubated at the same growth conditions (85% relative humidity, 25 ºC, and a 16 h light/8 h dark photoperiod) for 6 d to score disease symptoms. Leaf lesions were scanned and analysed with Assess 2.0 software (automatic parameters; American Phytopathological Society). For root infection assays, a 50 mL centrifuge tube was filled with 30 cm of moist vermiculite, followed by a mycelial plug of the same diameter as the centrifuge tube, a further layer of 5 cm of moist vermiculite, and five rice seeds covered with another 5 cm layer of moist vermiculite. Then, the tube was sealed with Parafilm to prevent loss of humidity.

Fungal lesions on roots were scored after 15 d of incubation at 25 °C and a 16 h light/8 h dark photoperiod. For the analysis of Os-cps4i lines, a total 153 seeds were analyzed

(33< n <43 per line). Disease symptoms on rice roots were scored at 15 dpi. Blast lesions were evaluated based on colour intensity (for roots), lesion number (for leaves) and lesion extension (for both) of disease symptoms as previously reported (Tucker et al., 2010). A Mann-Whitney (Wilcoxon) W-test with a p value cutoff of 0.01 was used to

51 compare medians that are statistically significant in Fig. 2A. The χ² test was applied to compare wild-type and different Os-cps4i lines using all the scores, and it highlighted significant differences with a p value <0.05 (Fig. 5A and 5C). When the same χ² test was applied a second time using the score groups independently and the Yates' correction

(applied for 2x2 data with less than five values as was the case for the data shown in

Fig. 5C), only “score 3” of Os-cps4i_5 and Os-cps4i_23 were significantly different with a p value<0.05, strongly supporting the significance found among these rice lines.

Xoo infections were carried out using the leaf-clipping method (Kauffman et al.,

1973), using the fully expanded leaves of 8 week old rice plants and inoculating with

Xoo strain PXO99 A. Xoo was grown for 2-3 days on TSA (1% wt/vol Tryptone, 1% sucrose, 0.1% glutamic acid, 1.5% agar, pH 6.6-6.8) plates at 28 °C, scraped off and resuspended in sterile dH 2O. This suspension was then adjusted to an optical density of

0.5 at 600 nm before use for infection. After clipping, symptoms consisting of grayish chlorotic coloration moved down the inoculated leaf along the main vein from the cut tip. Disease progression was analyzed by measuring the length of these lesions

(discoloration) 14 days after inoculation. Ten plants were used for infection and the disease assay was repeated thrice. One-way analysis of variance (ANOVA) statistical analyses were performed on the lesion measurements. The Tukey honest significant difference test was used for post-ANOVA pair-wise tested for significance, set at 5% ( p <

0.05).

References

Ahuja, I., Kissen, R., and Bones, A.M. (2012). Phytoalexins in defense against pathogens. Trends Plant Sci 17, 73-90.

Bednarek, P., and Osbourn, A. (2009). Plant-microbe interactions: chemical diversity in plant defense. Science 324, 746-748. Cartwright, D.W., Langcake, P., Pryce, R.J., Leworthy, D.P., and Ride, J.P. (1981). Isolation and characterization of two phytoalexins from rice as momilactones A and B. Phytochemistry 20, 535-537. Christensen, A.H., Sharrock, R.A., and Quail, P.H. (1992). Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol. Biol. 18, 675-689. Faivre-Rampant, O., Thomas, J., Allegre, M., Morel, J.B., Tharreau, D., Notteghem, J.L., Lebrun, M.H., Schaffrath, U., and Piffanelli, P. (2008). Characterization of the model system rice--Magnaporthe for the study of nonhost resistance in cereals. New Phytol 180, 899-910. Fleet, C.M., Yamaguchi, S., Hanada, A., Kawaide, H., David, C.J., Kamiya, Y., and Sun, T.-P. (2003). Overexpression of AtCPS and AtKS in Arabidopsis confers increased ent-kaurene production but no increase in bioactive gibberellins. Plant Physiol. 132, 830-839. Hasegawa, M., Mitsuhara, I., Seo, S., Imai, T., Koga, J., Okada, K., Yamane, H., and Ohashi, Y. (2010). Phytoalexin accumulation in the interaction between rice and the blast fungus. Mol Plant Microbe Interact 23, 1000-1011. Hausmann, L., and Toepfer, R. (1999). Development of Plasmid Vectors. In Bioengineering of Custom-Tailored Rape Varieties, D. Brauer, G. Roebbelen, and R. Toepfer, eds (Goettingen, Germany: Gesellschaft fuer Pflanzenzuechtung. Hedden, P., and Thomas, S.G. (2012). Gibberellin biosynthesis and its regulation. Biochem J 444, 11-25. Hiei, Y., Ohta, S., Komari, T., and Kumashiro, T. (1994). Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. The Plant journal : for cell and molecular biology 6, 271-282. Huang, M., Sanchez-Moreiras, A.M., Abel, C., Sohrabi, R., Lee, S., Gershenzon, J., and Tholl, D. (2012). The major volatile organic compound emitted from Arabidopsis thaliana flowers, the sesquiterpene (E)-beta-caryophyllene, is a defense against a bacterial pathogen. The New phytologist 193, 997-1008. Kato, T., Kabuto, C., Sasaki, N., Tsunagawa, M., Aizawa, H., Fujita, K., Kato, Y., Kitahara, Y., and Takahashi, N. (1973). Momilactones, growth inhibitors from rice, Oryza sativa L. Tetrahedron Lett. 14, 3861-3864. Kato-Noguchi, H., and Peters, R.J. (2013). The role of momilactones in rice allelopathy. J. Chem. Ecol. 39, 175-185. Kauffman, H.E., Reddy, A.P.K., Hsieh, S.P.Y., and Merca, S.D. (1973). Improved Technique for Evaluating Resistance of Rice Varieties to Xanthomonas-Oryzae. Plant Dis Rep 57, 537-541. Klein, A.T., Yagnik, G.B., Hohenstein, J.D., Ji, Z., Zi, J., Reichert, M.D., MacIntosh, G.C., Yang, B., Peters, R.J., Vela, J., and Lee, Y.J. (2015). Investigation of the Chemical Interface in the Soybean-Aphid and Rice-Bacteria Interactions Using MALDI- Mass Spectrometry Imaging. Anal Chem 87, 5294-5301.

Koga, J., Shimura, M., Oshima, K., Ogawa, N., Yamauchi, T., and Ogasawara, N. (1995). Phytocassanes A, B, C, and D, novel diterpene phytoalexins from rice, Oryza sativa L. Tetrahedron 51, 7907-7918. Koga, J., Ogawa, N., Yamauchi, T., Kikuchi, N., Ogasawara, N., and Shimura, M. (1997). Functional moiety for the antifungal activity of phytocassane E, a diterpene phytoalexin from rice. Phytochemistry 44, 249-253. Krishnan, A., Guiderdoni, E., An, G., Hsing, Y.I., Han, C.D., Lee, M.C., Yu, S.M., Upadhyaya, N., Ramachandran, S., Zhang, Q., Sundaresan, V., Hirochika, H., Leung, H., and Pereira, A. (2009). Mutant resources in rice for functional genomics of the grasses. Plant Physiol 149, 165-170. Okada, A., Shimizu, T., Okada, K., Kuzuyama, T., Koga, J., Shibuya, N., Nojiri, H., and Yamane, H. (2007). Elicitor induced activation of the methylerythritol phosphate pathway towards phytoalexin biosynthesis in rice. Plant Mol Biol 65, 177-187. Okuley, J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., and Browse, J. (1994). Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 6, 147-158. Otomo, K., Kenmoku, H., Oikawa, H., Konig, W.A., Toshima, H., Mitsuhashi, W., Yamane, H., Sassa, T., and Toyomasu, T. (2004). Biological functions of ent - and syn -copalyl diphosphate synthases in rice: key enzymes for the branch point of gibberellin and phytoalexin biosynthesis. Plant J. 39, 886-893. Papadopoulou, K., Melton, R.E., Leggett, M., Daniels, M.J., and Osbourn, A.E. (1999). Compromised disease resistance in saponin-deficient plants. Proceedings of the National Academy of Sciences of the United States of America 96, 12923-12928. Peters, R.J. (2006). Uncovering the complex metabolic network underlying diterpenoid phytoalexin biosynthesis in rice and other cereal crop plants. Phytochemistry 67, 2307-2317. Peters, R.J. (2010). Two rings in them all: The labdane-related diterpenoids. Nat. Prod. Rep. 27, 1521-1530. Prisic, S., Xu, M., Wilderman, P.R., and Peters, R.J. (2004). Rice contains two disparate ent -copalyl diphosphate synthases with distinct metabolic functions. Plant Physiol. 136, 4228-4236. Riemann, M., Haga, K., Shimizu, T., Okada, K., Ando, S., Mochizuki, S., Nishizawa, Y., Yamanouchi, U., Nick, P., Yano, M., Minami, E., Takano, M., Yamane, H., and Iino, M. (2013). Identification of rice Allene Oxide Cyclase mutants and the function of jasmonate for defence against Magnaporthe oryzae. Plant J 74, 226- 238. Sakamoto, T., Miura, K., Itoh, H., Tatsumi, T., Ueguchi-Tanaka, M., Ishiyama, K., Kobayashi, M., Agrawal, G.K., Takeda, S., Abe, K., Miyao, A., Hirochika, H., Kitano, H., Ashikari, M., and Matsuoka, M. (2004). An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol. 134, 1642-1653. Schmelz, E.A., Huffaker, A., Sims, J.W., Christensen, S.A., Lu, X., Okada, K., and Peters, R.J. (2014). Biosynthesis, elicitation and roles of monocot terpenoid phytoalexins. Plant J 79, 659-678.

Sesma, A., and Osbourn, A.E. (2004). The rice leaf blast pathogen undergoes developmental processes typical of root-infecting fungi. Nature 431, 582-586. Thomma, B.P., Nelissen, I., Eggermont, K., and Broekaert, W.F. (1999). Deficiency in phytoalexin production causes enhanced susceptibility of Arabidopsis thaliana to the fungus Alternaria brassicicola. The Plant journal : for cell and molecular biology 19, 163-171. Toki, S. (1997). Rapid and efficient Agrobacterium-mediated transformation in rice. Plant Mol. Biol. Rep. 15, 16-21. Toyomasu, T. (2008). Recent Advances Regarding Diterpene Cyclase Genes in Higher Plants and Fungi. Biosci. Biotechnol. Biochem. 72, 1168-1175. Toyomasu, T., Kagahara, T., Okada, K., Koga, J., Hasegawa, M., Mitsuhashi, W., Sassa, T., and Yamane, H. (2008). Diterpene Phytoalexins Are Biosynthesized in and Exuded from the Roots of Rice Seedlings. Biosci. Biotechnol. Biochem. 72, 562-567. Toyomasu, T., Usui, M., Sugawara, C., Kanno, Y., Sakai, A., Takahashi, H., Nakazono, M., Kuroda, M., Miyamoto, K., Morimoto, Y., Mitsuhashi, W., Okada, K., Yamaguchi, S., and Yamane, H. (2015). Transcripts of two ent-copalyl diphosphate synthase genes differentially localize in rice plants according to their distinct biological roles. J Exp Bot 66, 369-376. Toyomasu, T., Usui, M., Sugawara, C., Otomo, K., Hirose, Y., Miyao, A., Hirochika, H., Okada, K., Shimizu, T., Koga, J., Hasegawa, M., Chuba, M., Kawana, Y., Kuroda, M., Minami, E., Mitsuhashi, W., and Yamane, H. (2014). Reverse-genetic approach to verify physiological roles of rice phytoalexins: characterization of a knockdown mutant of OsCPS4 phytoalexin biosynthetic gene in rice. Physiologia plantarum 150, 55-62. Tucker, S.L., Besi, M.I., Galhano, R., Franceschetti, M., Goetz, S., Lenhert, S., Osbourn, A., and Sesma, A. (2010). Common genetic pathways regulate organ- specific infection-related development in the rice blast fungus. Plant Cell 22, 953-972. VanEtten, H.D., Mansfield, J.W., Bailey, J.A., and Farmer, E.E. (1994). Two Classes of Plant Antibiotics: Phytoalexins versus "Phytoanticipins". The Plant cell 6, 1191- 1192. Watanabe, M., Kono, Y., Esumi, Y., Teraoka, T., Hosokawa, D., Suzuki, Y., Sakurai, A., and Watanabe, M. (1996). Studies on a Quantitative Analysis of Oryzalides and Oryzalic Acids in Rice Plants by GC-SIM. Biosci. Biotechnol. Biochem. 60, 1460- 1463. Xu, M., Hillwig, M.L., Prisic, S., Coates, R.M., and Peters, R.J. (2004). Functional identification of rice syn -copalyl diphosphate synthase and its role in initiating biosynthesis of diterpenoid phytoalexin/allelopathic natural products. Plant J. 39, 309-318. Xu, M., Galhano, R., Wiemann, P., Bueno, E., Tiernan, M., Wu, W., Chung, I.M., Gershenzon, J., Tudzynski, B., Sesma, A., and Peters, R.J. (2012). Genetic evidence for natural product-mediated plant-plant allelopathy in rice ( Oryza sativa ). New Phytol. 193, 570-575. Yamane, H. (2013). Biosynthesis of phytoalexins and regulatory mechanisms of it in rice. Biosci Biotechnol Biochem 77, 1141-1148.

Zi, J., Mafu, S., and Peters, R.J. (2014). To Gibberellins and Beyond! Surveying the Evolution of (Di)Terpenoid Metabolism. Annu. Rev. Plant Biol. 65, 259-286.

Figures

OPP OsCPS4 OsCPS1 OPP OPP GGPP OsCPS2

Momilactones A & B ??? ??? ??? Oryzalides A-C Phytocassanes A-F Oryzalexin S Oryzalexins A-F GA

A) B)

500000000 Phytocassanes 1.2E+09 Momilactones 450000000

1E+09 400000000 WT

350000000 Os-cps2 800000000 300000000 WT 600000000 250000000 Os-cps2 Ion Count Ion Ion Count Ion 200000000 400000000 150000000

200000000 100000000

50000000 0 0

Figure continued on the following page.

70000000 1000000 CuCl RNAi CPS2 MeJa Spray 60000000 2 WT 800000 50000000 RNAi CPS2- CPS2 RNAi WT 115 MeJa 40000000 600000 RNAi CPS2- CPS2-161 RNAi 30000000 159 400000 MeJa Ion Count Ion 20000000 RNAi CPS2- Count Ion * * 161 200000 CPS2-115 RNAi 10000000 MeJa 0 0

Figure 2. Characterization of Os-cps2 knock-out ( Os-cps2ko ) and RNAi knock-down ( Os-cps2i ) rice plants relative to their parental/WT lines. A) Os -cps2 exhibits increased susceptibility to M. oryzae fungal blast disease. i) Representative leaves after M. oryzae infection for Os-cps2ko versus parental/WT plants (as indicated). ii) Percentage of diseased (discolored) area for Os-cps2ko compared with its parental/WT plants. iii) Percentage of diseased (discolored) area for Os-cps2i lines compared with their parental/WT plants. No statistically significant differences were found between Os-cps2ko and Os-cps2i lines (see material and methods). Disease grade score: 0, no symptoms; 1, weak symptoms; 2, dark symptoms; 3, strong dark symptoms. B) Os -cps2 plants exhibit increased susceptibility to Xoo bacterial blight disease. i) Representative leaves after Xoo infection of Os-cps2ko versus parental/WT plants (as indicated). ii) Lesion lengths for Os-cps2ko compared with its parental/WT plants. iii) Lesion lengths for Os-cps2i lines compared with their parental/WT plants. Note that * indicates p < 0.01 and **, p < 0.001, for Os-cps2 plants relative to the relevant parental/WT line. C) Os-cps2 exhibits no significant change relative to its wild type in phytocassane or momilactone content in the CuCl 2 root exudates. D) Os-cps2i lines showed a decrease in phytocassanes in the root exudates when treated by CuCl 2(left), and a slight decrease when treated by MeJa spray (right). * indicates a p-value of < 0.01.

A) B)

1E+09 Momilactones

900000000

800000000

700000000

600000000 RNAi CPS4 WT RNAi CPS4-5 500000000 RNAi CPS4-23 Ion Count Ion 400000000 RNAi CPS4-31

300000000

200000000

100000000 ***

Figure continued on the next page.

C) D)

300000000 Momilactones

250000000

200000000

WT 150000000 Os-cps4 Ion Count Ion 100000000

50000000 not present 0

Figure 3. Characterization of Os-cps4 knock-out ( ko ) and RNAi knock-down ( i) rice plants relative to their parental/WT lines. A) Os -cps4ko exhibits reduced susceptibility to Xoo bacterial blight disease. Histogram depicting lesion lengths for Os-cps2ko compared with its parental/WT line. B) Reduced momilactone content of MeJa root exudates from Os-cps4i lines relative to their parental/WT. C) Os -cps4i lines exhibit reduced susceptibility to Xoo bacterial blight disease. Histogram depicting lesion lengths for Os-cps2i lines compared with their parental/WT. D) Os-cps4 lines have no momilactone production. Pictured is the analysis from CuCl 2 root exudates for Os-cps4. Note that * indicates p < 0.05 and **, p < 0.01, relative to the wild type.

Figure 4. Decreased susceptibility of Os-CPS2OE lines to Xoo blight disease. Box plot contrasting lesion lengths of Os-CPS2OE versus its parental/WT line infected with Xoo (p < 0.01).

Figure continued on the next page.

Figure 5. Effect of Os-cps4 on non-host disease resistance. A) Infection of Os-cps4ko and wild-type (WT) rice lines (17 < n < 46) with different Magnaporthe species and strains. Numbers indicate the degree of infection area (% indicates the proportion of the total disease degree). B) Representative effect of Os- cps4ko on Magnaporthe poae non-host disease susceptibility. M. o. indicates Magnaporthe oryzae . M. p . indicates Magnaporthe poae . C) Os-cps4i lines (33 < n < 43) exhibit increased susceptibility to infection with M. poae relative to their parental/WT plants (% indicates the proportion to the total disease degree of each score. n = number of total seeds analysed. ** p value < 0.005; * p value < 0.05).

Supplemental Information for:

Inferring Roles in Defense from Metabolic Allocation – Rice Diterpenoids

Running title: Metabolic allocation and physiological function

Figure S1. A) Transcriptional identification of Os-cps2. After MeJa treatment, transcriptional expression of OsCPS2 in the wild type and Os-cps2. Actin expression was used as a control. B)Transcriptional expression of Os-CPS2 in its wild-type and over-expression (OE) lines. Actin expression was used as a control. KitWT indicates the Kitaake cultivar wild-type rice.

100 CPS2 90 cps2 80 70 60 50 40 30 Plant Plant height (cm) 20 10 0 Days 0 10 20 30 40 50 60

Figure S2. Relative growth of Os-cps2 plants (n = 17) versus its parental/wild-type line (n = 20). Shown is plant height measured at indicated times after germination (error bars show standard deviation). Plants grown in greenhouse.

B) C)

Figure S3. A) The chemical analysis of Os-CPS2OE with MeJa treatment. Gas chromatograph verification of increase in OsCPS2 dependent diterpenes in MeJa induced Os-CPSOE and un-induced OsCPSOE rice leaves respectively. 1. internal standard (cembrene) 2. syn-pimara-7,15-diene 3. casbene 4. ent-pimara- 8(14), 15-diene 5. ent-sandaracopimaradiene 6. ent-isokaurene 7. syn-stemar-13-ene 8. ent-kaurene 9. syn-stemo-12-ene 10. putative syn-exo-stemar-13-ene 11. ent-cassa-12, 15-diene 12. syn-stemo-13(17)- ene. B) Representative of putative oryzalide-related diterpenoid biosynthetic pathway, dashed arrows indicate multiple enzymatic reactions. C) Effect of Os-CPS2OE on Xoo blight resistance. Comparison of lesion length of wild type and Os-CPS2OE infected with Xoo . P-value: **<0.01, n=15.

40000000 6E+09 A) Momilactones A) Oryzalexins

35000000 5E+09

30000000

4E+09 25000000

WT WT 3E+09 20000000 Os-cps2 Os-cps2 Ion Count Ion Ion Count Ion 15000000 2E+09

10000000

1E+09 5000000

0 0

400000000 A) Phytocassanes 4E+09 B) Momilactones

350000000 3.5E+09

300000000 3E+09

250000000 2.5E+09

WT WT 200000000 2E+09 Os-cps2 Os-cps2 Ion Count Ion Ion Count Ion 150000000 1.5E+09

100000000 1E+09

50000000 500000000

0 0

Figure continued on the following page. 65

900000000 B) Oryzalexins 1.6E+09 B) Phytocassanes

800000000 1.4E+09 700000000 1.2E+09 600000000 1E+09 500000000 WT WT 800000000 400000000 Os-cps2 Os-cps2 Ion Count Ion 600000000 300000000 400000000 200000000

100000000 200000000

0 0

800000 300000000 C) Momilactones C) Oryzalexins 700000 250000000 600000 200000000 500000 WT WT 150000000 400000 Os-cps2 Os-cps2 Ion Count Ion Ion Count Ion 300000 100000000 200000 50000000 100000

0 0

140000000 D) Momilactones 6000000 C) Phytocassanes

120000000 5000000

100000000 4000000

80000000 WT WT 3000000 Os-cps2 Os-csp2

Ion Count Ion 60000000 Ion Count Ion

2000000 40000000

1000000 20000000

0 0

Figure continued on the following page. 66

2000000 D) Oryzalexins 9000000 D) Phytocassanes 1800000 8000000 1600000 7000000 1400000 6000000 1200000 WT 5000000 1000000 WT Os-csp2 4000000 Os-csp2 Ion Count Ion

800000 Count Ion

600000 3000000

400000 2000000

200000 1000000

0 0

1.2E+09 E) Momilactones 200000000 E) Phytocassanes 180000000 1E+09 160000000

140000000 800000000

120000000 WT WT 600000000 100000000 Os-cps2 Os-cps2 Ion Count Ion Ion Count Ion 80000000 400000000 60000000

40000000 200000000 20000000

0 0

Figure continued on the following page. 67

30000000 F) Momilactones 12000000 F) Phytocassanes

25000000 10000000

20000000 8000000

WT WT 15000000 6000000 Os-cps2 Os-cps2 Ion Count Ion Ion Count Ion

10000000 4000000

5000000 2000000 *

0 0

250000000 G) Momilactones 4000000 G) Oryzalexins * 200000000 3500000

3000000

150000000 2500000 WT WT Os-cps2 2000000 Ion Count Ion Os-cps2 100000000 Ion Count Ion 1500000

1000000 50000000

500000

0 0

Figure continued on the following page. 68

250000000 G) Phytocassanes 1.2E+09 H) Momilactones

1E+09 200000000

800000000

150000000

WT WT 600000000 Os-cps2 Os-cps2 Ion Count Ion Ion Count Ion 100000000

400000000

50000000 200000000

0 0

70000000 H) Oryzalexins 500000000 60000000 H) Phytocassanes 450000000

50000000 400000000 350000000 40000000 WT 300000000 WT Os-cps2 250000000 30000000 Ion Count Ion Os-cps2

Ion Count Ion 200000000

20000000 150000000

100000000 10000000 50000000

0 0

Figure continued on the following page. 69

180000000 J) Momilactones

3000000 I) Momilactones 160000000 140000000 2500000 CPS2 RNAi WT MeJa 120000000 RNAi CPS2 WT 2000000 CPS2-161 RNAi 100000000 RNAi CPS2-115 MeJa 1500000 80000000 RNAi CPS2-159 CPS2-115 RNAi Count Ion 60000000 RNAi CPS2-161 Ion Count Ion MeJa 1000000 CPS2-159 RNAi 40000000 500000 MeJa 20000000 * 0 0

350000 * J) Oryzalexins 300000

250000 RNAi CPS2 WT 200000 RNAi CPS2-115

150000 RNAi CPS2-159 Ion Count Ion RNAi CPS2-161 100000

50000

Figure S4. The phytochemical analyses of Os-cps2 relative to its wild type: A) MeJa leaf exudate, LS-MS. B) MeJa leaf tissue, LS-MS. C) Root exudates, not induced, LC-MS. D) MeJa sprayed root exudates, LC-MS. E) CuCl 2 leaf tissue, LC-MS/MS. F) MeJa spray root exudates, LC-MS/MS. G) MeJa root exudates, LC- MS/MS. H) CuCl 2 root exudates, LC-MS/MS. The momilactone and oryzalexin content of Os-cps2i as analyzed by LC-MS/MS : I) MeJa root exudates. J) CuCl 2 root exudates. Note that * indicates a p-value of <0.05.

1.4E+09 A) Momilactones 45000000 A) Oryzalexins

40000000 1.2E+09 35000000 1E+09 30000000

800000000 WT 25000000 WT Os-cps4 Os-cps4 600000000 20000000 Ion Count Ion Ion Count Ion

15000000 400000000 10000000 200000000 * 5000000

0 0

160000000 A) Phytocassanes 18000000 B) Momilatones 140000000 16000000

120000000 14000000 12000000 100000000 WT 10000000 CPS4 WT 80000000 Os-cps4 8000000 CPS4 KO

Ion Count Ion 60000000 Count Ion 6000000

40000000 4000000

20000000 2000000 Not present 0 0

3000000 B) Phytocassanes 2E+09 C) Momilactones

1.8E+09 2500000 1.6E+09

1.4E+09 2000000 1.2E+09 CPS4 WT WT 1500000 1E+09 CPS4 KO Os-cps4 Ion Count Ion Ion Count Ion 800000000 1000000 600000000

400000000 500000 200000000

0 0

Figure continued on the following page. 71

80000000 C) Oryzalexins 600000000 C) Phytocassanes 70000000 500000000 60000000

50000000 400000000

WT WT 40000000 300000000 Os-cps4 Os-cps4 Ion Count Ion 30000000 Count Ion 200000000 20000000 100000000 10000000

0 0

140000000 D) Momilactones 10000000 D) Oryzalexins 9000000 120000000 8000000 100000000 7000000

80000000 6000000 CPS4 WT CPS4 WT 5000000 CPS4 KO 60000000 CPS4 KO Ion Count Ion Ion Count Ion 4000000

40000000 3000000

2000000 20000000 1000000 Not present 0 0

2500000 1E+09 D) Phytocassanes E) Oryzalexins

900000000

800000000 2000000

700000000

600000000 1500000 CPS4 WT WT 500000000 CPS4 KO Os-cps4 Ion Count Ion 400000000 Count Ion 1000000

300000000

200000000 500000 100000000

0 0

Figure continued on the following page. 72

600000000 E) Phytocassanes 30000000 F) Oryzalexins * 500000000 25000000

400000000 20000000 RNAi CPS4 WT WT RNAi CPS4-5 300000000 15000000 Os-cps4 RNAi CPS4-23 Ion Count Ion Ion Count Ion RNAi CPS4-31 200000000 10000000

100000000 5000000

0 0

1.4E+09 F) Phytocassanes 250000000 G) Momilactones

1.2E+09 200000000 1E+09 RNAi CPS4 WT RNAi CPS4 WT 800000000 150000000 RNAi CPS4-5 RNAi CPS4-5 600000000 RNAi CPS4-23 RNAi CPS4-23 Ion Count Ion

Ion Count Ion 100000000 RNAi CPS4-31 400000000 RNAi CPS4-31

200000000 50000000

0 ** 0

1400000 G) Oryzalexins 140000000 G) Phytocassanes 1200000 120000000 1000000 100000000 RNAi CPS4 WT RNAi CPS4 WT 800000 RNAi CPS4-5 80000000 RNAi CPS4-5 RNAi CPS4-23 600000 60000000 RNAi CPS4-23 Ion Count Ion Ion Count Ion RNAi CPS4-31 RNAi CPS4-31 400000 40000000

200000 20000000

0 0

Figure S5. The phytochemical analyses of Os-cps4 relative to its wild type: A) CuCl 2 leaf exudate, LC-MS. B) Root exudates, not induced, LC-MS/MS. C) CuCl 2 leaf tissue, LC-MS/MS. D) MeJa root exudates, LC- MS/MS. E) CuCl 2 root exudates, LC-MS/MS (Momilactone content shown in Figure 3D). The phytochemical analyses of Os-cps4i: F) MeJa spray root exudates, LC-MS/MS (Momilactone content displayed Figure 3B). G) CuCl 2 root exudates, LC-MS/MS.

CHAPTER FOUR: INVESTIGATING MOMILACTONE BIOSYNTHESIS

Abstract

Using CRISPR/Cas9 genome editing in rice, five rice genes were knocked out in planta that were expected to be involved in momilactone biosynthesis based on past metabolic engineering experiments: OsCPS4, OsKSL4, OsKOL4, OsCYP76M7&M8 (double knockout), OsMS1 , and OsCYP99A2. OsCPS4, OsKSL4 , and OsCYP99A2 are all incorporated into a biosynthetic gene cluster believed to be involved in momilactone biosynthesis. All of these genes decreased momilactone production to varying degrees when knocked out which gives further confidence that these genes are indeed involved in momilactone biosynthesis.

Introduction

Momilactones act as allelochemicals against other plant species encroaching on the territory claimed by a rice plant (Xu et al., 2012; Kato et al., 1973). They also play some role in rice defense against pathogens. There are two known momilactones, A and B, in rice (Cartwright et al., 1981). These momilactones differ in the presence of a lactol ring in B where there is a carbonyl in A (Figure 1). The momilactones are presumed to be derived from syn -pimara-7,15-diene since they only differ from this carbon backbone in the placement of oxygenated species. Syn -pimara-7,15-diene is derived from syn-CPP by OsKSL4 , and syn-CPP is cyclized from GGPP by OsCPS4 (Wang

74 et al., 2010). The enzymes used to build momilactones have been studied in E. coli through metabolic engineering, but have remained to be extensively studied in planta.

The exact order and enzymes used in planta after syn -pimaradiene is a little less clear, though metabolic engineering does give some ideas.

There are two biosynthetic gene clusters in rice involved in diterpenoid biosynthesis. These clusters are sets of genes close in proximity to each other in the genome that are involved in a similar purpose. There is a 170 kilobase gene cluster on the fourth chromosome in rice (Sakamoto, 2004) that contains OsCPS4, OsKSL4,

OsCYP99A2, OsCYP99A3, and OsMS1 (formerly known as Momilactone A synthase or

OsMAS ) (Figure 2). Knowing that OsCPS4 and OsKSL4 are the enzymes that generate the precursors to the momilactones, it is hypothesized that the remaining genes in this biosynthetic gene cluster are involved in momilactone synthesis.

Previously a double RNAi knockdown of the genes OsCYP99A2 and OsCYP99A3 showed a decrease in momilactone levels, leading us to believe that at least one of these enzymes is involved in momilactone biosynthesis (Shimura, et al., 2007). OsCYP99A3 acts on syn -pimara-7,15-diene, making syn-pimaradien-19-oic acid (Figure 3), that can act as a precursor to form the lactone ring common to both momilactones (Wang et al.,

2010). Later on using recombinant expression, OsCYP99A2 was shown to be able to perform the same reaction as OsCYP99A3 on syn -pimaradiene (Kitaoka et al., 2015).

OsMS1 acts on syn -pimara-7,15-diene, making the penultimate intermediate to momilactone A (Shimura et al., 2007). OsMS1 can also catalyze the final reaction to create momilactone A from 3β-hydroxy-syn -pimaradien-19,6,β-olide; though the homologous OsMS2 , also found in the chromosome 4 biosynthetic gene cluster, can

75 catalyze this step more efficiently according to recent kinetics data (Miyamoto et al.,

2016; Kitaoka et al., 2016).

Other genes not in the chromosome 4 biosynthetic gene cluster also appear like they may be involved in momilactone biosynthesis. OsCYP701A8 , also known as kaurene oxidase like ( OsKOL ) enzyme 4, also acts on syn -pimara-7,15-diene to place a hydroxyl at the 3β position; this is the same position as the hydroxyl in momilactone B and as a ketone in momilactone A (Kitaoka and Wu et al., 2015) (Figure 4). OsCYP76M8 can hydroxylate syn -pimaradiene at the C6β position (Figure 5) and this could be important to form the lactone ring at this position in the momilactones (Wang et al.,

2012). OsMS3 and Monocot I ( OsMI3 ) 3, also could catalyze the same final step to form momilactone A as OsMS1 and OsMS2 (Kitaoka et al., 2016).

Therefore these ten genes: OsCPS4, OsKSL4, OsCYP99A2, OsCYP99A3, OsCYP76M8,

OsKOL4, OsMS1, OsMS2, OsMS3, and OsMI3 are crucial targets for gene knockouts in order to understand momilactone biosynthesis. A knockout of any one of these genes should negatively affect the production of momilactones. Five of these have been individually knocked out in this project and their diterpenoid content analyzed;

OsCYP99A3, OsMS2, OsMS3, and OsMI3 remain to be transformed into rice, and

OsCYP76M8 was knocked out in tandem with OsCYP76M7 .

Results

Data for OsMS1 and OsCYP99A2 was analyzed for CuCl 2 leaf tissue extracts, while the remaining gene knockouts were analyzed using CuCl 2 root exudates. These are the same experiments that were performed for these lines throughout the dissertation.

The Os-ksl4 line had significantly decreased momilactones (Figure 6). The Os- cyp99a2 line is knocked down in momilactones and increased in oryzalexins (Figure 7).

Both Os-kol4 lines are significantly decreased in both momilactone A and B though some still remains of each (Figure 8). Both Os-ms1 lines show a decrease in momilactones, though only one is significant (Figure 9). There is no change in either the phytocassanes or oryzalexins for the Os-ms1 lines. Os-cyp76m7&m8 had a complete knockout of momilactone B and a knockdown in momilactone A as well. Meanwhile, the single knockout line of Os-cyp76m7 had no change in momilactone production (Figure

10).

Discussion

The extreme knockdown in both momilactones A and B the Os-ksl4 line shows the necessity of OsKSL4 in momilactone production. This aligns with what has previously been shown that OsKSL4 is the enzyme responsible for syn -pimaradiene production. There are trace amounts of momilactones in every sample, which means that another KSL could be making negligent amounts of syn -pimaradiene. The knockdown in momilactones by the Os-cyp99a2 leads to the conclusion that OsCYP99A2 is also involved in momilactone biosynthesis, presumably alongside its tandem partner

OsCYP99A3 . It cannot yet be ruled out that OsCYP99A2 is not redundant in action to

OsCYP99A3 . A follow-up experiment would be to finish the Os-cyp99a3 knockout, and then look at a double knockout of the two genes. A knockdown in momilactone production by a knockout of OsKOL4 shows that OsKOL4 does typically act as the 3β hydroxylase in both momilactone A and B production; however, clearly OsKOL4 is not

77 the only enzyme capable of catalyzing this reaction as there are still momilactones A and B in the rice root exudates. The fact that little difference occurred from the Os-ms1 lines displays that OsMS1 is not necessary for momilactone production, and is probably redundant in its roles with OsMS2 and OsMS3 . By looking at the single knockout Os- cyp76m7 and comparing it to the double knockout of Os-cyp76m7&m8 , we can say with reasonable confidence if OsCYP76M8 is necessary for the production of the momilactones, but OsCYP76M7 isn’t used in the process of building them.

References

Cartwright, D.W., Langcake, P., Pryce, R.J., Leworthy, D.P., and Ride, J.P. (1981). Isolation and characterization of two phytoalexins from rice as momilactones A and B. Phytochemistry. 20: 535-537. Kato, T., Kabuto, C., Sasaki, N., Tsunagawa, M., Aizawa, H., Fujita, K., Kato, Y., Kitahara, Y., and Takahashi, N. (1973). Momilactones, growth inhibitors from rice, Oryza sativa L. Tetrahedron Lett. 14: 3861-3864. Kitaoka, N., Wu, Y., Xu, M., and Peters, R.J. (2015). Optimization of recombinant expression enables discovery of novel cytochrome P450 activity in rice diterpenoid biosynthesis. Appl Microbiol Biotechnol. 99:7549-7558. Kitaoka, N., Wu, Y., Zi, J., and Peters, R.J. (2016). Investigating inducible short-chain alcohol dehydrogenases/reductases clarifies rice oryzalexin biosynthesis. The plant journal. 88: 271-279. Miyamoto, K., Fujita, M., Shenton, M., Akashi, S., Sugawara, C., Sakai, A., Horie, K., Hasegawa, M., Kawaide, H., Mitsuhashi, W., Nojiri, H., Yamane, H., Kurata, N., Okada, K., and Toyomasu, T. (2016). Evolutionary trajectory of phytoalexin biosynthetic gene clusters in rice. The plant journal. 87, 293-304. Sakamoto, T., Miura, K., Itoh, H., Tatsumi, T., Ueguchi-Tanaka, M., Ishiyama, K., Kobayashi, M., Agrawal, G.K., Takeda, S., Abe, K., Miyao, A., Hirochika, H., Kitano, H., Ashikari, M., and Matsuoka, M. (2004). An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol. 134, 1642-1653. Shimura, K., Okada, A., Okada, K., Jikumaru, Y., Ko, K.-W., Toyomasu, T., Sassa, T., Hasegawa, M., Kodama, O., Shibuya, N., Koga, J., Nojiri, H., and Yamane, H . 2007. Identification of a biosynthetic gene cluster in rice for momilactones. J. Biol. Chem. 282:34013–34018.

Wang, Q., Hillwig, M.L., Okada, K., Yamazaki, K., Wu, Y., Swaminathan, S., Yamane, H. and Peters, R.J. (2012). Characterization of CYP76M5-8 indicates metabolic plasticity within a plant biosynthetic gene cluster. J. Biol. Chem. 287:6159-6168. Wang, Q., Hillwig, M., and Peters, R.J. (2010). CYP99A3: functional identification of a diterpene oxidase from the momilactone biosynthetic gene cluster in rice. The plant journal. 65 , 87-95. Xu, M., Galhano, R., Wiemann, P., Bueno, E., Tiernan, M., Wu, W., Chung, I.M., Gershenzon, J., Tudzynski, B., Sesma, A., and Peters, R.J. (2012). Genetic evidence for natural product-mediated plant-plant allelopathy in rice ( Oryza sativa ). New Phytol. 193, 570-575.

Figures

Figure 1. Momilactone A (left) and momilactone B (right).

Figure 2. The biosynthetic gene cluster on chromosome 4 in rice contains 1 CPS, 1 KSL, 2 SDRs, and 2 CYPs.

Figure 3. The sequential reactions performed by OsCYP99A3 on syn-pimaradiene.

Figure 4. OsKOL4 acts on syn pimaradiene to add a 3β hydroxyl group.

Figure 5. OsCYP76M8 hydroxylates syn -pimaradiene at the C6β position.

300000000 Momilactones

250000000 Kit WT CuCl2 200000000 Root exudates

150000000 CRKSL4

Ion Ion Count 100000000

50000000 ** 0

Figure 6. LC-MS/MS analysis for momilactones Os-ksl4 . ** indicates a p-value < 0.01.

160000000 Momilactones 2500000 Oryzalexins 140000000

120000000 Kit WT 2000000 *

100000000 1500000 Kit WT 80000000 ** CRA2-4 #5 CRA2-4 #5

Ion Count Ion 60000000 1000000 Ion Count Ion

40000000 500000 20000000

0 0

250000000 Phytocassanes

200000000

150000000 Kit WT

100000000

Ion Ion Count CRA2- 4 #5 50000000

Figure 7. LC-MS/MS analysis of phytoalexins in Os-cyp99a2 . * indicates p-value < 0.5. ** indicates p- value < 0.01.

300000000 Momilactones

250000000 Kit WT CuCl2 Root 200000000 exudates CRKOL4-6 150000000

Ion Count Ion CRKOL4-7-1 100000000 ** 50000000 **

Figure 8. LC-MS/MS analysis of momilactones in Os-kol4 . ** indicates p-value < 0.01.

160000000 Momilactones 140000000 120000000 100000000 Kit WT 80000000 ** CRMS1-5

Ion Count Ion 60000000 CRMS1-15 40000000 20000000 0

Figure 9. LC-MS/MS analysis of momilactones in the Os-ms1 . No change was seen in the phytocassanes or oryzalexins, and therefore they are not shown here. ** indicates p-value of < 0.01.

900000000 Momilactones 800000000

700000000 Kit WT 600000000 CuCl2 Root 500000000 exudates CRM7&M 400000000 8-10-2 Ion Count Ion 300000000

200000000 CRM7-7-1 100000000 ** 0

Figure 10. LC-MS/MS analysis of momilactones in Os-cyp76m7&m8 double knockout (middle/red) with Os-cyp76m7 single knockout (right/green). ** indicates p-value of < 0.01.

CHAPTER FIVE: INVESTIGATING ORYZALEXIN BIOSYNTHESIS

Abstract

Four rice genes expected to be involved in oryzalexin biosynthesis based on previous metabolic engineering experiments were knocked out in planta : OsKSL10,

OsCYP76M7&M8 (double knockout), OsCYP701A8/OsKOL4, and OsMS1 . Unfortunately, due to fiscal strains, data was unable to be obtained for an induction that produces ample amounts of oryzalexins. However, two gene knockouts that were not expected to be involved in oryzalexin biosynthesis, Os-cyp99a2 and Os-cyp76m7 , showed higher detectable amounts of oryzalexins leading to new hypotheses about their reactivity with substrates in the oryzalexin biosynthesis pathway.

Introduction

Oryzalexins are a class of phytoalexins derived from ent-sandaracopimaradiene which in turn is formed from ent-CPP by OsKSL10 , and ent -CPP is cyclized from GGPP by

OsCPS2 (Otomo et al., 2004). OsCPS1 also cyclizes the same reaction as OsCPS2 but was previously thought to be set apart for GA biosynthesis. Oryzalexin S has a different base structure and a very different biosynthesis pathway and therefore will not be discussed in this chapter with the other oryzalexins. In this work, when discussing oryzalexins, the author is referring to the oryzalexins A-F only. Oryzalexins A, C, D, and E were able

83 to be isolated in this project; oryzalexins B and F remain to be found and confirmed in the current LC-MS/MS method.

In addition to the biosynthetic gene cluster on chromosome 4 in rice mentioned in chapter four, there is another biosynthetic gene cluster on chromosome 2 associated with the derivatives of ent-CPP (Prisic, 2004). This 245 kb biosynthetic gene cluster includes the genes OsCYP76M6-8, OsKSL7, OsCYP71Z6-7, OsCPS2, OsKSL5, and OsKSL6

(Figure 1). The oryzalexins, phytocassanes, and oryzalides are derived from ent-CPP, and genes found in this gene cluster have been found to help build all three of these classes of compounds (Wu et al., 2011, 2013).

Great work has been done through metabolic engineering in E. coli to elucidate the biosynthetic pathways of the oryzalexins. OsCYP701A8/OsKOL4 acts on ent- sandaracopimaradiene by adding a hydroxyl group at the 3α position (Wang et al.,

2012; Wang and Okada et al., 2012) (Figure 2). 3α-hydroxyl-ent-sandaracopimaradiene acts as the substrate for the two P450s OsCYP76M6 & M8. OsCYP76M6 takes 3α- hydroxyl-ent-sandaracopimaradiene and hydroxylates at the 9β position to form a diol known as oryzalexin E (Figure 3). OsCYP76M8 takes 3α-hydroxyl-ent- sandaracopimaradiene and hydroxylates at the 7β position to form a diol known as oryzalexin D (Figure 4). OsCYP76M5 can also perform the same reaction as OsCYP76M8 with 3α-hydroxyl-ent-sandaracopimaradiene (Wu et. al, 2013). Oryzalexin D is the precursor to oryzalexins A, B, and C. OsMS3 , from the same family as OsMS1 and OsMS2, can catalyze the dehydrogenase reactions necessary to go from oryzalexin D to oryzalexins A, B, and C, while OsMS1 and OsMI3 have been shown to be able to oxidize oryzalexin D to become oryzalexin B (Kitaoka et al., 2016) (Figure 5). It is not currently

84 known the exact path taken to biosynthesize oryzalexin F, though presumably it could be made from 3α-hydroxyl-ent-sandaracopimaradiene as well since it only differs by a single hydroxyl group added to the C18 carbon (Figure 6) (Peters, 2006).

Therefore these nine genes are crucial targets for gene knockout in order to understand oryzalexin biosynthesis in planta : OsCPS2, OsKSL10, OsCYP76M8,

OsCYP76M6, OsCYP76M5, OsCYP701A8/OsKOL4, OsMS1, OsMS3, and OsMI3 . Five of these genes have been targeted in this project; work has also been done on OsCYP76M5,

OsCYP76M6, and OsMS3 , nevertheless these gene knockouts were not completed in time for the write-up of this dissertation. OsCYP76M8 was not knocked out alone, it was simultaneously knocked out with OsCYP76M7 . Work has also been started to construct a single gene knockout for OsCYP76M8 .

Results

The oryzalexins in general are hard to find from rice extracts. They were most easily found in CuCl 2 induced leaf extracts (Figure 7). Unfortunately, the project ran out of money hours before CuCl 2 leaf tissue extracts were finished being prepared for analysis and they are currently resting in a -80°C freezer awaiting the day they can present the realities of their metabolic profile to the scientific world. Because of this, barely discernable amounts of oryzalexins were quantified in the CuCl 2 root exudates, and the error bars are near to the base line. However, if oryzalexins were upregulated, this would be noticeable.

Os-kol4, Os-ms1, Os-cyp76m7&m8, and Osksl10 had no change in the level of oryzalexins (Figures 8 & 9). However, two gene knockouts had an upregulation in oryzalexins, which was detectable: Os-cyp99a2 and Os-cyp76m7 (Figure 10).

Discussion

Data was not obtained for oryzalexin B, which is the final product OsMS1 creates.

So the lack of any change in observable oryzalexins is no surprise. Though oryzalexin C can be derived from oryzalexin D, it can also be derived from oryzalexin A, so it is understandable that oryzalexin C content was not affected by Os-ms1 . If the LC-MS/MS method can be further optimized to isolate oryzalexin B, there will probably be a noticeable change in this oryzalexin content.

For all the genes in which decreased production was expected and no actual change was seen, it is assumed that this is because of the difficulty in finding oryzalexins in the rice extracts. For OsKSL10 we also garner confidence that it is still the generator of ent -sandaracopimiradiene because the CR knockout has an increase in the phytocassane content. This metabolic flux toward ent-cassadiene is what would be expected from an Os-ksl10 knockout if there were no other generator of ent - sandaracopimaradiene.

We currently cannot detect and verify oryzalexin F on the LC-MS/MS. But once it is found it will be important to look at Os-kol4 , because it seems likely that this gene will be directly involved in oryzalexin F biosynthesis and Os-kol4 will severely inhibit if not knockout oryzalexin F biosynthesis. And since it also seems likely that, similar to oryzalexin E, its biosynthesis is not tied to the biosynthesis of any of the other

86 oryzalexins, little information can be gained by looking at how gene knockouts affect the other five oryzalexins.

If oryzalexins are increased when OsCYP76M7 is knocked out, then the most reasonable explanation is that OsCYP76M7 acts on a precursor to the oryzalexins to form a different compound, and when it is knocked out, metabolic flux drives the production of oryzalexins. The known diterpene substrate used by OsCYP76M7 is ent - cassadiene, not ent-sandaracopimaradiene, even though its subfamily member

OsCYP76M5, 6, and 8 can hydroxylate ent-sandaracopimaradiene (Wang and Okada et al., 2012). However, since it is known that the universal precursor to oryzalexin biosynthesis after ent-sandaracopimaradiene is 3α-hydroxyl-ent- sandaracopimaradiene, it is reasonable to hypothesize that OsCYP76M7 might act on

3α-hydroxyl-ent-sandaracopimaradiene.

As seen in the previous chapter, Os-cyp99a2 had a large increase in oryzalexins relative to the wild type. This was not due to metabolic flux from syn to ent stereochemistry diterpenoids, because the amounts of phytocassanes were unchanged

(Chapter 4, Figure 7). This would lead to the conclusion that OsCYP99A2 directly acts on the precursors for oryzalexins. Oryzalexin F has a C18 hydroxyl group. Since

OsCYP99A2 has been shown to act on C19 for syn -pimaradiene, it is not hard to believe that it could act on the same position for ent -sandaracopimradiene (or 3α-hydroxyl-ent- sandaracopimaradiene) to catalyze the final step in the biosynthesis of oryzalexin F

(Figure 11). Once oryzalexin F is verified in the LC-MS/MS method, then this hypothesis can be tested.

References

Kitaoka, N., Wu, Y., Zi, J., and Peters, R.J. (2016). Investigating inducible short-chain alcohol dehydrogenases/reductases clarifies rice oryzalexin biosynthesis. The plant journal. 88: 271-279. Otomo, K. , Kenmoku, H., Oikawa, H., König, W., Toshima, H., Mitsuhashi, W., Yamane, H., Sassa, T., and Toyomasu, T. (2004). Biological functions of ent- and syn -copalyl diphosphate synthases in rice: key enzymes for the branch point of gibberellin and phytoalexin biosynthesis. The Plant Journal. 39: 886-893. Peters, R. J. (2006). Uncovering the complex metabolic network underlying diterpenoid phytoalexin biosynthesis in rice and other cerea crop plants. Phytochemistry. 67: 2307-2317. Prisic, S., Xu, M., Wilderman, P.R., and Peters, R.J. (2004). Rice contains two disparate ent-copalyl diphsphate synthases with distinct metabolic functions. Plant Physiol. 136: 4228-4236. Swaminathan, S., Morrone, D., Wang, Q., Fulton, D., and Peters, R.J. (2009). CYP76M7 is an ent -Cassadiene C11α-Hydroxylase Defining a Second Multifunctional Diterpenoid Biosynthetic gene Cluster in Rice. The Plant Cell. 21: 3315-3325. Wang, Q., Hillwig, M., Wu, Y., and Peters, R.J. (2012). CYP701A8-A Rice ent-Kaurene Oxidase Diverted to More Specialized Diterpenoid Metabolism. Plant Physiology. 158: 1418-1425. Wang, Q., Hillwig, M.L., Okada, K., Yamazaki, K., Wu, Y., Swaminathan, S., Yamane, H. and Peters, R.J. (2012). Characterization of CYP76M5-8 indicates metabolic plasticity within a plant biosynthetic gene cluster. J. Biol. Chem. 287:6159-6168. Wu, Y. , Hillwig, M., Wang, Q., and Peters, R.J. (2011). Parsing a multifunctional biosynthetic gene cluster from rice: Biochemical characterization of CYP71Z6 & 7. FEBS. 585: 3446-3451. Wu, Y., Wang, Q., Hillwig, M., and Peters, R.J. (2013). Picking Sides: Distinct roles for CYP76M6 and -8 in rice oryzalexin biosynthesis. Biochem J. 454(2): 209-216.

Figures

Figure 1. The biosynthetic gene cluster in rice that contains some of the enzymes necessary for oryzalexin, oryzalide, and phytocassane biosynthesis. Genes that are colored in black are those that are induced by chitin, the polysaccharide in fungal cell walls.

Figure 2. OsKOL4 hydroxylates on the 3α position of ent -sandaracopimaradiene, the precursor to the oryzalexins.

Figure 3. OsCYP76M6 acts sequentially after OsCYP701A8 to form oryzalexin E.

Figure 4. OsCYP76M5&M8 can hydroxylate the product of OsKOL4 with ent -sandaracopimaradiene to form oryzalexin D.

Figure 5. The oryzalexin biosynthesis pathway from oryzalexin D through oryzalexins A and B to oryzalexin C.

Figure 6. The structure of oryzalexin F with the numbering scheme for each carbon.

7000000 Oryzalexin Total Kit WT MeJa spray root exudates 6000000 Kit WT Not Induced Leaf tissue 5000000 Kit WT UV leaf Tissue

Kit WT CuCl2 leaf Tissue 4000000 Kit WT MeJa Leaf Tissue

Ion Count Ion 3000000 Kit WT CuCl2 Leaf Exudates

2000000 Kit WT MeJa Leaf Exudate

Kit WT CuCl2 Root exudates 1000000 Kit WT MeJa root exudates 0

Figure 7. LC-MS/MS analysis of various induction methods on different tissues of Kitaake rice looking for the oryzalexins. Two methods allow for quantifiable amounts of oryzalexins with reasonable error bars, CuCl 2 leaf tissue, and MeJa root exudates.

7000000 250000 Oryzalexins, KOL4 Oryzalexins, MS1 6000000 Kit WT CuCl2 200000 5000000 Root exudates CRKOL4-6 150000 Kit WT 4000000

CRMS1-5 3000000 CRKOL4-7-1 100000 Count Ion Ion Count Ion CRMS1-15 2000000

50000 1000000

0 0

3000000 Oryzalexins, M7&M8 2500000

2000000 Kit WT CuCl2 Root exudates 1500000 CRM7&M8-10-2 Ion Count Ion 1000000

500000

Figure 8. LC-MS/MS analysis of the oryzalexin content in Os-ms1, Os-ksl10, Os-kol4, and Os-cyp76m7&m8.

500000000 3000000 Oryzalexins Phytocassanes 450000000 2500000 400000000 Kit WT 350000000 2000000 CuCl2 Kit WT Root 300000000 CuCl2 Root exudates * 1500000 250000000 exudates CRKSL10- CRKSL10-5 Ion Count Ion 5 Count Ion 200000000 1000000 150000000

500000 100000000 50000000 0 0

Figure 9. LC-MS/MS analysis of the oryzalexin (left) and phytocassane (right) contents in Os-ksl10 . * indicates a p-value of < 0.05.

Oryzalexins, M7 2500000 4500000 Oryzalexins, A2 4000000 * 2000000 * 3500000 Kit WT CuCl2 3000000 Root 1500000 exudates Kit WT 2500000 CRM7-7- CRA2-4 #5 2000000 1000000 1 Count Ion Ion Count Ion 1500000 1000000 500000 500000 0 0

Figure 10. LC-MS/MS analysis for oryzalexins in Os-cyp76m7 CuCl 2 root exudates (left) and Os-cyp99a2 CuCl 2 leaf tissue extracts (right). * indicates p-value < 0.05.

Figure 11. The proposed pathway for the biosynthesis of oryzalexin F in rice.

CHAPTER SIX: INVESTIGATING PHYTOCASSANE BIOSYNTHESIS

Abstract

CRISPR/Cas9 knockouts of OsKSL7, OsCYP701A8/OsKOL4, OsCYP76M7, and

OsCYP76M8 were built, and the phytocassane contents analyzed on an LC-MS/MS. Os- ksl7, Os-cyp701a8, and a double knockout of Os-cyp76m7&m8 had a reduction in the amount of phytocassanes produced, whereas the Os-cyp76m7 knockout had no change in phytocassanes.

Introduction

Phytocassanes are a group of rice phytoalexins derived from ent -cassa-12,15- diene. There are six known phytocassanes, A-F, that share the same ent-cassadiene backbone. Ent -cassa-12,15-diene is formed from ent-CPP by OsKSL7 . Ent -CPP, as described in the previous chapter, is cyclized by OsCPS2 from GGPP (Peters, 2006). Ent - cassa-12,15-diene can be acted upon by both OsCYP76M7 and OsCYP701A8. OsCYP76M7 is a C11α-hydroxylase for ent -cassa-12,15-diene (Swaminathan et al., 2009) as well as

OsCYP76M8 (Wang and Okada et al., 2012), while OsCYP701A8 is a C3α-hydroxylase for ent -cassa-12,15-diene. Both alcohols are components of every phytocassane, though neither OsCYP701A8 nor OsCYP76M7 can use as a substrate the direct product of the other enzyme (Wang et al., 2012). OsMS1, OsMS2, and OsMS3 do not appear to be relevant to the oxidation of the 11α-hydroxyl cassadiene hydroxylated by OsCYP76M7/8

93 to form the 11-keto group that is in every phytocassane, though they might play a different role in phytocassane biosynthesis by oxidizing at another position (Kitaoka et al., 2016).

OsCYP71Z7 catalyzes a 2α-hydroxylation (Kitaoka and Wu et al., 2015) that presumably occurs after the hydroxylations of OsCYP76M7/M8 and OsCYP701A8 based on unpublished OsCYP71Z7 RNAi data that down-regulated the production of phytocassanes A, B, and D (those containing a 2α hydroxylation), while up-regulating production of phytocassanes C and E (those without 2α hydroxylation) ten times higher than that of the wild type (Okada, 2011). This idea of downstream hydroxylation is reinforced by kinetics data that shows that OsCYP71Z7 binds poorly to ent -cassa-12,15- diene (Wu et al., 2011). A study comparing Oryza sativa with the species Leersia perrieri (Lp), which lacks the OsCYP71Z7 ortholog, showed that Lp produced phytocassanes C and E, but not phytocassanes A, B, and D, consistent with the

OsCYP71Z7 RNAi data (Miyamoto et al., 2016) (Figure 1).

Therefore, in order to adequately understand the pathway for biosynthesis of all the phytocassanes, it is necessary to knock out the genes OsCYP701A8/OsKOL4,

OsCYP76M7, OsCYP76M8, OsCYP71Z7, OsCPS2, and OsKSL7 . These are only the beginning portions of the pathway; other genes than these 6 are likely involved in the full tailoring of the phytocassanes. All of these genes have been knocked out in this project, save for a single mutant of OsCYP76M8 and OsCYP71Z7 , but work has begun even on these genes.

Results

The two homozygous Os-ksl7 lines were significantly decreased in phytocassanes, but not entirely gone (Figure 2). Os-cyp701a8/Os-kol4 had significantly decreased phytocassanes in one out of two homozygous lines (Figure 3). The Os- cyp76M7 homozygous line had no significant change in total phytocassane content

(Figure 4). Meanwhile, the homozygous double knockout Os-cyp76m7&m8 had a decrease in the phytocassanes (Figure 5).

Discussion

The presence of phytocassanes in Os-ksl7 is concerning, because this implies that ent-cassadiene is being produced despite the missing KSL7 enzyme. Other KSLs

(perhaps one yet to be found in the genome) must be producing ent -cassadiene in planta , though which KSL is the culprit is unknown at this time. As to the necessity of

OsKOL4 in phytocassane production, since the phytocassanes are decreased, but not knocked out, it would appear that there is another enzyme catalyzing the same reaction as OsKOL4 in planta . This further supports what was discovered from the Os-kol4 momilactone data, and it is probable that this similar enzyme to OsKOL4 is acting both in momilactone and phytocassane biosynthesis. Nevertheless, the fact that there is a reduction in phytocassanes further lends support to the hypothesis that OsKOL4 is involved in phytocassane production to some degree.

The knockout in phytocassane production by Os-cyp76m7&m8 supports the hypothesis that these two P450s act as the C11 hydroxylases needed to form all of the phytocassanes. However, the data from Os-cyp76m7 is surprising in that not a single

95 phytocassane was significantly decreased. This implies that OsCYP76M8 is more than competent to generate all of the 11-keto-ent-cassadiene on its own without OsCYP76M7 .

Perhaps it is the primary, even the only, actor in C11 alpha hydroxylation of ent - cassadiene. The completion of the Os-cyp76m8 and its metabolic characterization will either lend its support or discredit the idea of whether OsCYP76M8 is the only actor or if just one of the two genes is needed.

References

Kitaoka, N., Wu, Y., Xu, M., and Peters, R.J. (2015). Optimization of recombinant expression enables discovery of novel cytochrome P450 activity in rice diterpenoid biosynthesis. Appl Microbiol Biotechnol. 99:7549-7558. Kitaoka, N., Wu, Y., Zi, J., and Peters, R.J. (2016). Investigating inducible short-chain alcohol dehydrogenases/reductases clarifies rice oryzalexin biosynthesis. The plant journal. 88: 271-279. Miyamoto, K., Fujita, M., Shenton, M., Akashi, S., Sugawara, C., Sakai, A., Horie, K., Hasegawa, M., Kawaide, H., Mitsuhashi, W., Nojiri, H., Yamane, H., Kurata, N., Okada, K., and Toyomasu, T. (2016). Evolutionary trajectory of phytoalexin biosynthetic gene clusters in rice. The plant journal. 87, 293-304. Okada, K. (2011). The Biosynthesis of Isoprenoids and the Mechanisms Regulating It in Plants. Bioscience, Biotechnology, and Biochemistry. 75: 1219-1225. Peters, R. J. (2006). Uncovering the complex metabolic network underlying diterpenoid phytoalexin biosynthesis in rice and other cerea crop plants. Phytochemistry. 67: 2307-2317. Swaminathan, S., Morrone, D., Wang, Q., Fulton, D., and Peters, R.J. (2009). CYP76M7 is an ent -Cassadiene C11α-Hydroxylase Defining a Second Multifunctional Diterpenoid Biosynthetic gene Cluster in Rice. The Plant Cell. 21: 3315-3325. Wang, Q., Hillwig, M.L., Okada, K., Yamazaki, K., Wu, Y., Swaminathan, S., Yamane, H. and Peters, R.J. (2012). Characterization of CYP76M5-8 indicates metabolic plasticity within a plant biosynthetic gene cluster. J. Biol. Chem. 287:6159-6168. Wang, Q., Hillwig, M., Wu, Y., and Peters, R.J. (2012). CYP701A8-A Rice ent-Kaurene Oxidase Diverted to More Specialized Diterpenoid Metabolism. Plant Physiology. 158: 1418-1425. Wu, Y. , Hillwig, M., Wang, Q., and Peters, R.J. (2011). Parsing a multifunctional biosynthetic gene cluster from rice: Biochemical characterization of CYP71Z6 & 7. FEBS. 585: 3446-3451.

Figures

Figure 1. The biosynthetic pathway of the phytocassanes. Dashed lines indicate the presence of the action of unknown enzymes.

80000000 Phytocassanes 70000000

60000000 Kit WT CuCl2 Root 50000000 exudates CRKSL7-1 40000000

Ion count Ion * 30000000 CRKSL7-2 20000000 10000000 * 0

Figure 2. LC-MS/MS analysis for the phytocassanes in Os-ksl7 . * indicates a p-value of < 0.05.

100000000 Phytocassanes 90000000 80000000 70000000 Kit WT CuCl2 Root exudates 60000000 CRKOL4-6 50000000

Ion Count Ion 40000000 CRKOL4-7-1 30000000 * 20000000 10000000 0

Figure 3. LC-MS/MS analysis for the phytocassanes in the Os-kol4 . * indicates a p-value of < 0.05.

500000000 Phytocassanes 450000000 400000000 350000000 Kit WT CuCl2 300000000 Root exudates 250000000 CRM7-7-1

Ion Count Ion 200000000 150000000 100000000 50000000 0

Figure 4. LC-MS/MS analysis for the phytocassanes in the Os-cyp76m7 .

80000000 Total Phytocassanes 70000000

60000000

50000000 Kit WT CuCl2 Root exudates 40000000 CRM7&M8-10-2

Ion Count Ion 30000000

20000000

10000000 * 0

Figure 5. LC-MS/MS analysis for the phytocassanes in Os-cyp76m7&m8 . * indicates a p-value of < 0.05.

CHAPTER SEVEN: CONCLUSION AND FUTURE DIRECTIONS

Conclusion

The utility of investigating metabolite production of rice enzymes in planta has clearly been demonstrated here. By analyzing in planta metabolite data, novel biosynthetic pathways have been hypothesized, such as is the case with OsCYP99A2 ; insight has been gained into the possibility of additional hidden enzymes with similar catalytic activity, such as is the case with OsKOL4 ; and further confirmation for previous hypotheses have been established.

Future directions

There are still many genes in momilactone, oryzalexin, and phytocassane biosynthesis that need to be investigated in order to understand the biosynthesis of these defense compounds, namely: the OsCYP76M subfamily that share similar identities in sequence, yet have widely varying activities, and have been shown already to be involved in defense diterpenoid biosynthesis, OsCYP76M5, OsCYP76M6,

OsCYP76M8, OsCYP76M14, OsCYP76M17 ; the SDRs , OsMS2, OsMS3 , as well as the whole tandem SDR array on chromosome 7; OsKOL5 , which is similar to OsKOL4 yet has not shown any activity in recombinant expression experiments; and OsCYP99A3 , which is similar to OsCYP99A2 and contained within the chromosome 4 momilactone biosynthetic gene cluster, and has already been linked to momilactone biosynthesis.

These are the targets of any future efforts to complete our lacking understanding of the rice genome’s arsenal against pathogens with these classes of diterpenoids.

Oryzalexin B and oryzalexin F, as well as the oryzalides, remain at large in the rice extraction and isolation method using the LC-MS/MS. One way to possibly find the oryzalides is to look at Os-ksl6 , which is involved in forming the precursor to the oryzalides, and comparing it on the LC-MS to the wild type, analyzing it to see what peaks drop out on the knockout. This could illuminate not only where the oryzalides are in the samples, but also what the intermediates are in their production.

In fact, using this method of analysis in combination with the different knockouts, the intermediates could also be found on the LC-MS or perhaps in combination with the GC-MS, rather than merely totaling the final products. This would allow a final ordering of the sequence of enzyme action in production of these diterpenoids to be elucidated. Finally, this method of analysis could allow us to find the final unknown products of certain genes like OsKSL5 and OsKSL11 .