Promoter Methylation Profiles Between Human Lung

1310 Regular Article Biol. Pharm. Bull. 36(8) 1310–1316 (2013) Vol. 36, No. 8

Promoter Methylation Profiles between Human Lung Adenocarcinoma Multidrug Resistant A549/Cisplatin (A549/DDP) Cells and Its Progenitor A549 Cells Ruiling Guo,*,a Guoming Wu,b,# Haidong Li,a Pin Qian,c Juan Han,d Feng Pan,a Wenbi Li,a Jin Li,b and Fuyun Ji*,b a Department of Respiratory Diseases, 324th Hospital of the People’s Liberation Army; d Department of Emergency Medicine, 324th Hospital of People’s Liberation Army; Chongqing 400020, China: b Institute of Human Respiratory Diseases, Xinqiao Hospital, Third Military Medical University; and c Institute of Field Internal Medicine, Xinqiao Hospital, Third Military Medical University; Chongqing 400037, China. Received February 19, 2013; accepted May 27, 2013

Although aberrant DNA methylation has been implicated in the pathophysiology of lung cancer, the role of methylation in multidrug resistance (MDR) of lung cancer has remained unclear. To investigate whether certain distinct DNA methylation pattern is associated with acquired MDR of lung adenocarcinoma, methylated-DNA immunoprecipitation-chromatin immunoprecipitation (MeDIP-ChIP) was utilised to compare the genome-wide promoter methylation of the human lung adenocarcinoma MDR A549/cisplatin (A549/DDP) cells with its progenitor A549 cells. The comparison identified 3617 genes with differentially methylated promoter, of which 1581 were hypermethylated and 2036 were hypomethylated. Then, bisulphite sequencing polymerase chain reaction (PCR) (BSP) and quantitative reverse transcription (RT)-PCR (Q-PCR) were used to validate the promoter methylation of five candidate genes and to determine whether the expression of genes was associated with the promoter methylation. BSP confirmed that the promoter methylation incidence of the hypermethylated genes, G protein-coupled receptor 56 isoform 3 (GPR56), metallothionein 1G (MT1G), and RAS association domain family gene 1 (RASSF1), was significantly higher in A549/DDP cells compared with A549 cells (p<0.001, p=0.0099, and p=0.0165), whereas no significant difference was found in that of the other two genes, CCNL2 and BAD (p=0.0594 and p=0.5546). Additionally, Q-PCR showed that the mRNA expression of the three hypermethylated genes was significantly lower in A549/DDP cells compared with A549 cells (all p<0.001). In conclusion, this study reported for the first time that a distinct promoter methylation pattern is associated with MDR of lung adenocarcinoma A549/DDP cells and suggested that GPR56, MT1G, and RASSF1 might be the potential methylation markers associated with acquired MDR of lung adenocarcinoma. Key words lung adenocarcinoma; multidrug resistance; DNA methylation; promoter

Lung cancer has replaced liver cancer to become the lead- ever, these chemotherapy resistance models are demonstrated ing cause of cancer-related deaths in China, accounting for to be relatively simplistic with the generally poor clinical 22.7% of all cancer deaths.1) The rates of morbidity and mor- outcomes.9,10) Interestingly, the growing evidences of epigen- tality continue to rise rapidly and the lung cancer patients will etic alterations in gene expression have provided an indication reach one million in 2025 if no effective control measures that DNA methylation status of a series of genes changed were taken.2) Currently, lung adenocarcinoma has become the either simultaneously or sequentially might be involved in the major pathologic type of lung cancer, the incidence of which chemotherapy-resistant phenotype of lung adenocarcinoma. accounts for 30 to 40% of all lung cancer cases in China and First, many studies showed that DNA methylation is far more exceeds 50% in many areas of Europe.1–3) Chemotherapy is vulnerable than the DNA sequence to external factors. These still an indispensable key factor in the standardised treatment alterations might be the earliest event in tumourigenesis, of lung adenocarcinoma presently, even though rise of target which could lead to a growth advantage for tumour cells and therapy has been greatly improved the treatment of certain influence the direction of transformation.11) Second, DNA group of lung adenocarcinoma patients such as people with methylation changes can occur rapidly, which results in resis- epidermal growth factor receptor (EGFR) mutation. However, tance arising quickly following chemotherapy treatment.12,13) regretfully, acquired multidrug resistance (MDR) induced by Furthermore, the expression of multiple genes could be simul- chemotherapy is the major barrier to the successful chemo- taneously affected by DNA methylation.14) Therefore, DNA therapeutic treatment.4) Hence, understanding of the potential methylation could be the driving force in acquired MDR,15,16) MDR mechanisms of lung adenocarcinoma is essential to dis- which have been confirmed in resistant tumour cell line of cover novel chemotherapy drugs and improve the efficacy of breast adenocarcinoma,17) murine neuroblastoma cells,18) and chemotherapy treatment. drug-resistant ovarian and colon tumour xenografts.19) These So far, most of MDR studies have been focused on the findings gave us clue that the DNA methylation might also single genes to investigate the MDR mechanism of lung ad- play important roles in the development of the MDR polygenic enocarcinoma and obtained many important results.5–8) How- phenotype of lung adenocarcinoma cells. Until now, except a limited number of genomic regions or 20,21) The authors declare no conflict of interest. genes found to be methylated in MDR of lung cancer, few # Equal contribution with first author. studies have reported a genome-wide promoter methylation

* To whom correspondence should be addressed. e-mail: [email protected]; [email protected] © 2013 The Pharmaceutical Society of Japan August 2013 1311 analysis to investigate whether certain distinct promoter meth- whether the surrounding window is enriched for high-intensity ylation pattern is associated with MDR of lung adenocarcino- probes relative to the rest of the array. Each probe has a corre- ma. Thus, in the present study, to investigate the relationship sponding p-value score (−log 10) and a threshold with positive between DNA methylation and MDR of lung adenocarcinoma, signal difference is set to select regions that are enriched (i.e., methylated-DNA immunoprecipitation-chromatin immunopre- methylated) in the test sample. Thus, transfrags or differen- cipitation (MeDIP-ChIP) was utilised to compare the promoter tially methylated regions (DMRs) were generated by interval methylation profiles of the human lung adenocarcinoma MDR analysis with a p-value minimum threshold of 2, maximum A549/DDP cells with its progenitor A549 cells. Then, bisul- spacing between nearby probes within a peak of 500 bp. When phite sequencing polymerase chain reaction (PCR) (BSP) was we get the DMRs data, we map them with genomic transcripts performed to validate the results obtained from MeDIP-ChIP and make comparison analysis between 2 samples using and quantitative reverse transcription (RT)-PCR (Q-PCR) was NimbleGen SignalMap. Annotations of RefSeq were retrieved carried out to investigate whether the expression of the hy- from the NCBI website. The correlation of log 2 MeDIP/Input permethylated/hypomethylated genes was associated with the DNA ratios between replicates were computed using values promoter methylation. The study preliminarily established a from MaxTen calculations as described previously.26) distinct DNA methylation pattern of the lung adenocarcinoma Promoter Methylation Analysis by BSP Genomic bisul- MDR cells and revealed several epigenetically inactivated phite sequencing was performed to confirm the sensitivity of genes, which might be the potential candidate genes or meth- the observed DMRs. The genomic DNA was extracted from ylation markers involved in the MDR of lung adenocarcinoma. the A549 and A549/DDP cells using QIAamp DNA Blood Mini Kit according to the manufacturer’s recommendation Materials and Methods (QIAGEN, Maryland, U.S.A.), respectively, and 400 ng genomic DNA was treated with sodium bisulphite using EZ Cell Lines and Cell Culture The MDR cell line A549/ DNA Methylation-Gold Kit (Zymo Research, Orange, CA, DDP was established as described as Guo.22) Briefly, the pro- U.S.A.). Eighty to one hundred nanograms bisulphite-treated genitor A549 cells were first treated with a high-dose shock DNA was used for PCR amplification. The target regions of cisplatin (DDP) (1.0 µg/mL) and then stepwise selected for of the relevant gene promoters and the primers, which were more than 6 months with increasing concentrations of cisplat- designed using the MethPrimer programme (http://www. in at a range of 0.05 to 1.0 µg/mL in RPMI-1640 medium (Hy- urogene.org/methprimer/index1.html), were shown in Table 1. clone, Logan, UT, U.S.A.) with 10% foetal calf serum (Gibco, Then, the BSP products were cloned into a pMD®18-T vector NY, U.S.A.) in a 37°C humidified incubator supplied with 5% according to the manufacturer’s instructions (TaKaRa, Dalian,

CO2. Then, the selected cells that demonstrated cross-resis- China). For each cell line and each gene, five positive clones tance to hydroxycamptothecin, vincristine, and 5-fluorouracil were randomly selected for subsequent sequencing. After this, (MDR A549/DDP) and A549 cells were regularly maintained the amplicon sequence data were aligned to the human refer- in RPMI-1640 medium supplemented with 10% foetal calf ence genome, and the extent of methylation (DNA methylation serum in a 37°C humidified incubator supplied with 5% CO2. levels) was determined by comparing the total number of Cs MeDIP-ChIP MeDIP was performed as previously (methylated) to Ts (unmethylated) for each CpG site. described.23) Briefly, genomic DNA from A549/DDP cells Gene Expression by Q-PCR Total RNA was isolated and A549 cells were extracted using QIAamp DNA Blood using TRIzol according to the manufacturer’s recommenda- Mini Kit according to the manufacturer’s recommendation tion (Invitrogen, Carlsbad, CA, U.S.A.). Two milligrams (QIAGEN, Maryland, U.S.A.), respectively, and fragmented aliquots were reverse transcribed using an AMV First Strand by Bioruptor (Diagenode, Belgium). Immunoprecipitation of cDNA Synthesis Kit according to the manufacturer’s instruc- methylated DNA was performed using anti-5-methyl cytidine tions (Roche Applied Science, Mannheim, Germany). The (mouse) and Biomag™ magnetic beads coupled anti-mouse SYBR green-based Q-PCR was then performed in triplicate immunoglobulin G (IgG). After the immunoprecipitated DNA using an ABI StepOnePlus Real-Time PCR Systems (Applied was eluted and purified by phenol chloroform extraction, Biosystems, Foster, CA, U.S.A.) and the the level of gene Input and IP DNA were labelled with Cy5- and Cy3-labeled expression was normalised by glyceraldehyde 3-phosphate random 9-mers, respectively, and hybridised to NimbleGen dehydrogenase (GAPDH). The primers for Q-PCR were listed human genome annotations (HG18) RefSeq promoter arrays in Table 2. PCR cycling conditions consisted of 5 min at 95°C (Roche NimbleGen, Madison, WI, U.S.A.), which is single followed by 40 cycles of 15 s of denaturation at 95°C, 30 s of array design containing all known well-characterized 18028 annealing at 55°C and 30 s of extension at 72°C. The relative RefSeq promoter regions (from about −2200 to +500 bp of expression values were computed by the ΔΔCt method.27) the transcription start sites (TSSs)) totally covered by ca. Statistical Analysis Analysis for MeDIP-ChIP was per- 385000 probes. Triplicate sets of hybridisation were performed formed using the ACME algorithm as previously described.25) from three independent MeDIP experiments for each cell line. Analysis for BSP was performed using chi-square test four- Finally, scanning was performed using a GenePix 4000B Mi- fold table. The expression of the five candidate genes and croarray Scanner (Axon Instruments, Union City, CA, U.S.A.). GADPH in A549/DDP and A549 cells determined by Q-PCR Tiling Array Data Analysis The raw data were extracted was analysed by two-tailed Student’s t-test. p<0.05 was con- as pair files by NimbleScan software.24) Then, a modified sidered statistically significant. algorithm for capturing microarray enrichment (ACME) algorithm25) is employed where a fixed-length window (750 bp) Results is slid along the length of each chromosome, testing at each probe using a one-sided Kolmogorov–Smirnov (KS) test Identification of Differentially Methylated Genes in 1312 Vol. 36, No. 8

Table 1. Genomic Location of Five Candidate Genes with Hypermethylated or Hypomethylated Promoter for BSP Analysis

Distance from CpG sites in GenBank No. Genes Location (HG18) Primers (5′→3′) Size (bp) TSS assay NM_005682 GPR56 Chr16 +98 to +495 9 TAGGTAGGTGAGTTTGGTTTAGGA 398 11267781–11268178 CAAAACCACAAACACCCAATC NM_005950 MT1G Chr16 +82 to +309 6 GAGTTTGGTTAATAGGAAAGTATTGG 228 10315931–10316158 ACCCACTACCTCTTCCCTTCTC NM_170714 RASSF1A Chr3 +25 to +404 36 GTTTTAGATGAAGTYGTTATAGAGGT 380 50318015–50318394 CCTACACCCAAATTTCCATTAC NM_030937 CCNL2 Chr1 815176–815512 −2039 to −1703 9 GTGATGGAAGTTAGAAGGAATGAAG 337 ACTTCTCCCCTAATCTTTCTACCC NM_032989 BAD Chr11 −1988 to −1642 8 TTGAGGAGGAGGGGTTTGTTAG 347 9359635–9359981 CCAAAAACACCRTCTAATAACTAAAAC

Table 2. Primers Used for Q-PCR

Genes Sense (5′→3′) Antisense (5′→3′) Size (bp) GAPDH GTGGTCTCCTCTGACTTCAACA CCACCACCCTGTTGCTGTAG 136 GPR56 AAAGTAGCCAACCTCACGGA GCTCAATGTGGGGTCTTCAAC 108 MT1G TGTGGGCTGTGCCAAGTGT TTACGGGTCACTCTATTTGTACTTG 118 RASSF1 GAGTACAATGCCCAGATCAACA AGGGTGGCTTCTTGCTGGA 130 CCNL2 CCACCTGGCTTCCAAGATAGA AACCCAACTCTTTGAGAACTCGT 182 BAD GAGGATGAGTGACGAGTTTGTG GATCCCACCAGGACTGGAAG 125

Fig. 1. The Distribution of Genes with Differentially Methylated Promoters along the Chromosomes in A549/DDP Cells Compared with A549 Cells (A) Distribution of genes with hypermethylated promoters. (B) Distribution of genes with hypomethylated promoters.

A549/DDP Cells Compared with A549 Cells The com- across the genome. We observed that certain chromosomal prehensive promoter methylation profiles were compared were preferentially methylated or demethylated. For example, between A549/DDP and A549 cells using MeDIP-ChIP. The chromosomes 1, 2, 16, 17, and 19 were found to be intensively comparison identified 3617 genes with differentially methyl- hypermethylated, chromosomes 1, 2, 3, 7, 9, 11, 12, 16, 17, 19, ated promoters in A549/DDP cells compared with A549 cells and X were found to be more hypomethylated (>100 genes), (1581 hypermethylated and 2036 hypomethylated). Global dif- whereas chromosomes 13, 18, 21, and Y exhibited fewer differential methylation analysis revealed that the genes with differentially methylated genes (Fig. 1). The online GO analysis ferentially methylated promoters were not evenly distributed (http://gostat.wehi.edu.au/) categorized these genes with dif- August 2013 1313

Table 3. Signal Pathways Involved in Genes with Hypermethylated Pro- moter Identified by MeDIP-ChIP Analysis in Lung Adenocarcinoma MDR A549/DDP Cells Compared with Its Progenitor A549 Cells

Signal pathways Genes Wnt signaling path- WNT5B, PPP2R5B, WNT3A, CAMK2G, way CSNK1A1L, SMAD3, SMAD2, FZD5, DAAM2, RBX1, CSNK2A2, CCND1, CCND3, PPP2CA, RAC1, LRP6, CAMK2D, NFATC4, PPP3CA, WNT9A, WNT7A, APC, TBL1Y Tight junction PARD6A, CLDN7, RAB3B, CLDN18, MAGI2, CLDN5, MPP5, MYH6, ACTN3, PTEN, CLDN23, CSNK2A2, PPP2CA, RRAS2, ASH1L, CLDN1, EXOC3, MYH14, PPP2R2C, AKT2, SPTAN1 Adherens junction EGFR, CSNK2A2, PTPRF, PVRL3, TGFBR1, Fig. 2. Signal Pathways Involved in Genes with Differentially Methyl- PVRL2, RAC1, SMAD3, SMAD2, ACTN3, ated Promoters in A549/DDP Cells Compared with A549 Cells WASL, WAS (A) Number of genes with hypermethylated promoters. (B) Number of genes TGF-beta signaling E2F4, E2F5, TGFBR1, GDF5, TGFB3, with hypomethylated promoters. 1. Wnt signalling pathway; 2. Tight junction; 3. pathway SMAD3, SMAD2, RBX1, INHBB, ID2, Adherens junction; 4. TGF-beta signalling pathway; 5. Small cell lung cancer; 6. Neuroactive ligand–receptor interaction; 7. Glycerolipid metabolism; 8. Regulation ZFYVE16, PPP2CA, BMP8B of actin cytoskeleton; 9. Heparan sulphate biosynthesis; 10. Fc gamma R-mediated Small cell lung COL4A4, TRAF2, CCND1, COL4A2, phagocytosis; 11. Glycerophospholipid metabolism; 12. Basal cell carcinoma; 13. cancer COL4A1, NFKB1, APAF1, TRAF5, PTEN, Vibrio cholerae infection; 14. Neurotrophin signalling pathway; 15. Calcium sig- CHUK, TRAF3, AKT2 nalling pathway; 16. Axon guidance.

Table 4. Signal Pathways Involved in Genes with Hypomethylated Promoter Identified by MeDIP-ChIP Analysis in Lung Adenocarcinoma MDR A549/ DDP Cells Compared with Its Progenitor A549 Cells

Signal pathway Genes Neuroactive ligand–receptor interaction CALCR, DRD1, TSPO, THRB, GABRB2, GRIK2, NPY2R, DRD5, OPRK1, GABBR1, GRIN3B, GABBR2, VIPR1, P2RY8, S1PR3, AGTR1, P2RY6, KISS1R, HRH3, P2RY1, S1PR5, GABRQ, HTR1E, GHR, GABRA2, PTGER3, CCKBR, GRIA4, GRM1, NPY5R, CRHR1, SSTR4, CRHR2, SSTR2, PRLR, P2RX1, AVPR1B, HTR6, GPR50, UTS2R, HTR2C, ADRA1D, F2R Glycerolipid metabolism DGKA, CEL, AGPAT6, DGAT1, PPAP2C, DGKG, LIPG, DGKZ, AGPAT4, AGK, AGPAT3, AGPAT2 Regulation of actin cytoskeleton FGF19, FGFR2, FGD1, FGF18, ENAH, FGFR3, MYL5, FGF11, INSRR, ACTG1, PAK7, PAK3, GSN, CSK, TMSL3, GIT1, VAV3, ROCK1, LIMK1, MAP2K2, MYLK3, MYL12B, MYH9, FGF20, VAV1, PPP1CB, ARPC5L, CFL1, SCIN, PDGFRA, PDGFRB, TMSB4X, PIP4K2A, F2R Heparan sulphate biosynthesis B3GAT3, HS3ST3A1, B3GALT6, XYLT1, HS3ST2, HS3ST1, HS3ST3B1, GLCE Fc gamma R-mediated phagocytosis PRKCA, PLD2, VAV3, LYN, LIMK1, PPAP2C, NCF1C, VAV1, AMPH, JMJD7-PLA2G4B, DOCK2, PLCG1, GAB2, GSN, ARPC5L, SCIN, CFL1, INPP5D Glycerophospholipid metabolism PLD2, PPAP2C, LYPLA1, PISD, DGKA, GPD1L, JMJD7-PLA2G4B, AGPAT6, DGKG, DGKZ, PHOSPHO1, AGPAT4, AGPAT3, AGPAT2 Basal cell carcinoma FZD8, SMO, STK36, WNT11, PTCH2, HHIP, FZD2, AXIN2, WNT6, SHH, TCF7L1, DVL1 Vibrio cholerae infection PRKCA, ATP6V0C, TCIRG1, ACTG1, PRKACG, MUC2, ATP6V1C2, PLCG1, PDIA4, KCNQ1, PRKX, ATP6V1F Neurotrophin signalling pathway IRAK1, MAP2K2, MAPK11, FOXO3, BAD, PTPN11, MAGED1, NTRK3, BDNF, MAP3K5, CAMK4, PLCG1, RPS6KA2, NTRK1, NTRK2, YWHAQ, CALM3, SH2B3, SHC3, CSK, NGF Calcium signalling pathway GNA15, DRD1, GNA11, DRD5, PRKX, PRKACG, AGTR1, PDE1B, PRKCA, PTGER3, CCKBR, BST1, MYLK3, GRM1, CD38, PLCG1, P2RX1, CAMK4, HTR6, AVPR1B, PDGFRA, CALM3, PDGFRB, HTR2C, ADRA1D, F2R, CACNA1B Axon guidance ROCK1, EFNB3, LIMK1, GNAI1, PLXNB3, DPYSL2, CXCL12, EPHB1, PAK7, SEMA6A, SEMA5B, RGS3, EPHA8, UNC5A, PAK3, FYN, CFL1, SEMA4D, RHOD, UNC5C, NFATC2 ferentially methylated promoters into different biological func- lung cancer were detected in the present study. tions, including transcription factor activity, plasma membrane Validation of the Promoter Methylation in Five Can- part, sequence-specific DNA binding, transcription regulator didate Genes To validate the results obtained from the activity, intrinsic to plasma membrane, ion transport, integral MeDIP-ChIP analysis, five differentially methylated promot- to plasma membrane, embryonic morphogenesis, gastrulation er-associated genes, three of which were hypermethylated (Bonferroni p<0.05), and a series of signalling pathways with (GPR56, MT1G, and RASSF1) and two of which were hypo- p<0.05, including Wnt signalling pathway, tight junction, ad- methylated (CCNL2 and BAD), were selected for BSP due to herens junction, the TGF-beta signalling pathway, and others their special roles in tumorigenesis, tumour growth, or stress (Bonferroni p<0.05) (Fig. 2, Tables 3–4, supplementary Table reaction, BSP results confirmed significantly increased pro- 1–2). However, no significantly methylated promoters of some moter methylation of GPR56, MT1G, and RASSF1 in A549/ previously reported MDR genes such as MDR-1, LPR, MRP of DDP cells compared with A549 cells (p<0.0001, p=0.0099, 1314 Vol. 36, No. 8

Fig. 3. Analog Representation of the Promoter Methylation Level of Five Candidate Genes in A549/DDP Cells Compared with A549 Cells by BSP Analysis Each circle represents one CpG; the shaded circles indicate the presence of methyl-cytosine, and the empty circles indicate the absence of methylation. The numbers indicating the locations of the CpG sites in each gene. The methylation index (MI) is calculated by dividing all of the CpGs analysed by the total number of methylated CpGs detected. The incidence of promoter methylation of the three genes (GPR56, MT1G, and RASSF1) increased significantly in A549/DDP cells compared with A549 cells (p<0.0001, p=0.0099, and p=0.0165, respectively) (A–C), while the promoter methylation of the other two genes (CCNL2 and BAD) in A549/DDP cells was not different from that in A549 cells (p=0.0594 and p=0.5546, respectively) (D, E). and p=0.0165, respectively) (Figs. 3A–C), while no difference Discussion of the promoter methylation level of CCNL2 and BAD was found between A549/DDP cells and A549 cells (p=0.0594 MDR is one of the major clinical obstacles to the suc- and p=0.5546, respectively) (Figs. 3D, E). cessful treatment of lung adenocarcinoma. It appears to be a Expression of Five Candidate Genes Aberrant promoter polygenic phenomenon in which epigenetic-mediated changes methylation is usually linked to an altered chromosomal state might be the driving force leading to this phenotype.29) To in- and, thus, to transcriptional gene silencing.28) Therefore, vestigate whether certain distinct DNA methylation patterns is Q-PCR was carried out to investigate whether the expression associated with the MDR phenotype of lung adenocarcinoma, of the five candidate genes was regulated by the promoter MeDIP-ChIP was utilised to compare the promoter methyla- methylation. Q-PCR analysis demonstrated that except BAD tion profiles of the human lung adenocarcinoma MDR A549/ (p=0.426), the expression of the other four genes were all DDP cells with its parental A549 cells. Totally, the promoters significantly downregulated in A549/DDP cells compared with of 3617 genes were found to be differentially methylated, of A549 cells (all p<0.001) (Fig. 4). which 1581 were hypermethylated and 2036 were hypomethylated in A549/DDP cells compared with A549 cells. To verify the MeDIP-ChIP results and investigate the association the expression of genes with its promoter methylation status, five August 2013 1315 potential methylation markers of lung adencarcinoma MDR, three genes with hypermethylated promoter (GPR56, MT1G, and RASSF1) and two genes with hypomethylated promoter (CCNL2 and BAD) were selected due to their special role in tumorigenesis, tumour growth, or stress reaction, using BSP and Q-PCR, respectively. The results indicated that the promoter methylation of GPR56, MT1G, and RASSF1 by BSP was consistent with that of MeDIP-ChIP, accompanied with transcriptional downregulation. However, the promoter methylation level of CCNL2 and BAD decreased but did not reach statistical significance in A549/DDP cells compared with A549 cells. Then, anticipated transcriptional upregulation of the two genes was not observed. Instead, the expression of CCNL2 Fig. 4. Expression of the Five Candidate Genes in A549/DDP Cells Compared with A549 Cells Using Q-PCR was lower in A549/DDP cells compared with A549 cells, and Q-PCR analysis demonstrated that except BAD, the expression of the other four which of BAD was unchanged. genes were all significantly downregulated in A549/DDP cells compared with RASSF1 and MT1G, two of the hypermethylated genes, A549 cells (all p<0.001). The light blue and navy blue indicate the hypermethylated genes (GPR56, MT1G, and RASSF1) and the hypomethylated genes (CCNL2, were previously found to be involved in lung cancer prog- and BAD) identified in A549/DDP by MeDIP-ChIP, respectively. The Q-PCR ex- ress and prognostic, especially for non-small-cell lung cancer periments were performed in triplicate for each sample. (NSCLC), and regulated by promoter methylation.30,31) RAS association domain family gene 1 (RASSF1) is a recently genes were found to be differentially methylated and three discovered RAS family-related gene that modulates multiple candidate genes (GPR56, MT1G, and RASSF1) with differen- apoptotic and cell-cycle checkpoint pathways and promotes tially methylated promoter might be the potential methylation microtubule stability. RASSF1A, one isoform of RASSF1, has markers associated with acquired MDR of lung adenocarci- been identified as a tumour suppressor gene whose inactiva- noma, whether other genes or signalling pathways were in- tion has been implicated in the development of many cancers, volved in the acquired MDR of A549/DDP cells need further especially lung cancer. Metallothionein 1G (MT1G) belongs investigation. to a class of metal-binding proteins (MTs) and participates in In summary, to our knowledge, the present study reported several cellular processes, such as metal ion stability, detoxi- for the first time the genome-wide analysis of promoter meth- fication, oxidation, and damage resistance. G protein-coupled ylation in the human lung adenocarcinoma MDR A549/DDP receptor 56 isoform 3 (GPR56) is an orphan G protein-cou- cells. Additionally, GPR56, MT1G, and RASSF1, three genes pled receptor that has been shown to be implicated in brain with differentially methylated promoter, might be the potential development and play various roles in endogenous cancer methylation markers associated with acquired MDR of lung progression,32) and suppress tumour growth and metastasis adenocarcinoma. in human melanoma cell line xenograft models.33) But their roles in MDR of lung cancer is still unclear.34,35) Hence, this Acknowledgments The research was funded by Grants is the first study to report that the promoter methylation of from the Medical Science Foundation of Chengdu Military these three genes was significantly higher in MDR cells of Area of China (No. MB09010), and grants from the Chong lung adenocarcinoma compared with its progenitor cells and qing Natural Science Foundation (No. CSTC2012JJA1595) the expression of these three genes was downregulated by the awarded to Ruiling Guo; Grants from the National Natural promoter hypermethylation. Therefore, we deduced that the Science Foundation of China (No. 81170044), and Grants from three genes might be involved in the development of acquired the Natural Science Foundation of Third Military Medical MDR of lung adenocarcinoma. The mechanisms need be fur- University (No. 2010XLC29) awarded to Fuyun Ji. The fund- ther investigated. ing agencies had no role in the study design, data collection Interestingly, in the present study, Cyclin L2 (CCNL2), of and analysis, decision to publish, or preparation of the manu- which no promoter methylation was found between MDR script. cells with its progenitor cells by BSP, was found to be downregulated. The distance between the mCpGs and the TSS References might be one of the most important reasons to explain this phenominon36): the distance between the mCpGs and the TSS 1) Zhi XY. Advances in surgical treatment of non-small cell lung can- of CCNL2 is relatively longer (−1000 to −2200 bp), whereas cer. Oncology Progress, 7, 379–386 (2009a). that of the three hypermethylated genes (RASSF1, MT1G, and 2) Zheng S, Qian P, Li F, Qian G, Wang C, Wu G, Li Q, Chen Y, Li J, GPR56)) is relatively shorter (−200 to +500 bp). The phenom- Li H, He B, Ji F. Association of mitochondrial DNA variations with lung cancer risk in a Han Chinese population from southwestern enon also provides evidence that the expression of gene is not 37–40) China. PLoS ONE, 7, e31322 (2012). correlated with its promoter methylation. 3) Devesa SS, Bray F, Vizcaino AP, Parkin DM. International lung There are several limitations in the present study. First, cancer trends by histologic type: male : female differences diminish- several genes (e.g., MDR-1) that had previously been reported ing and adenocarcinoma rates rising. Int. J. Cancer, 117, 294–299 to be methylated in MDR cells were not identified by the (2005). MeDIP-ChIP. One of the possible reasons is that the promoter 4) Solyanik GI. Multifactorial nature of tumor drug resistance. Exp. regions of these genes might not be covered by the HG18 Oncol., 32, 181–185 (2010). methylation array. Additionally, heterogeneity might generate 5) Zeng-Rong N, Paterson J, Alpert L, Tsao MS, Viallet J, Alaoui- certain deviations.41,42) Second, though the promoters of 3617 Jamali MA. Elevated DNA repair capacity is associated with in- 1316 Vol. 36, No. 8

trinsic resistance of lung cancer to chemotherapy. Cancer Res., 55, B, Scacheri PC, Rozowsky J, Karpikov A, Euskirchen G, Weiss- 4760–4764 (1995). man S, Gerstein M, Snyder M, Yang A, Moqtaderi Z, Hirsch H, 6) Pommier Y, Sordet O, Antony S, Hayward RL, Kohn KW. Apopto- Shulha HP, Fu Y, Weng Z, Struhl K, Myers RM, Lieb JD, Liu XS. sis defects and chemotherapy resistance: molecular interaction maps Systematic evaluation of variability in ChIP-chip experiments using and networks. Oncogene, 23, 2934–2949 (2004). predefined DNA targets. Genome Res., 18, 393–403 (2008). 7) Townsend DM, Tew KD. The role of glutathione-S-transferase in 25) Scacheri PC, Crawford GE, Davis S. Statistics for ChIP-chip and anti-cancer drug resistance. Oncogene, 22, 7369–7375 (2003). DNase hypersensitivity experiments on NimbleGen arrays. Methods 8) Mashima T, Tsuruo T. Defects of the apoptotic pathway as Enzymol., 411, 270–282 (2006). therapeutic target against cancer. Drug Resist. Updat., 8, 339–343 26) o’Geen H, Nicolet CM, Blahnik K, Green R, Farnham PJ. Compari- (2005). son of sample preparation methods for ChIP-chip assays. Biotech- 9) oza AM. Clinical development of P glycoprotein modulators in on- niques, 41, 577–580 (2006). cology. Novartis Found. Symp., 243, 103–115, discussion, 115–118, 27) Livak KJ, Schmittgen TD. Analysis of relative gene expression 180–185 (2002). data using real-time quantitative PCR and the 2(-Delta Delta C(T)) 10) Choi CH. ABC transporters as multidrug resistance mechanisms Method. Methods, 25, 402–408 (2001). and the development of chemosensitizers for their reversal. Cancer 28) Li B, Carey M, Workman JL. The role of chromatin during tran- Cell Int., 5, 30 (2005). scription. Cell, 128, 707–719 (2007). 11) Baylin SB, Ohm JE. Epigenetic gene silencing in cancer—A mech- 29) Glasspool RM, Teodoridis JM, Brown R. Epigenetics as a mecha- anism for early oncogenic pathway addiction? Nat. Rev. Cancer, 6, nism driving polygenic clinical drug resistance. Br. J. Cancer, 94, 107–116 (2006). 1087–1092 (2006). 12) Nyce J. Drug-induced DNA hypermethylation and drug resistance 30) Wang J, Wang B, Chen X, Bi J. The prognostic value of RASSF1A in human tumors. Cancer Res., 49, 5829–5836 (1989). promoter hypermethylation in non-small cell lung carcinoma: a 13) Baker EK, El-Osta A. The rise of DNA methylation and the im- systematic review and meta-analysis. Carcinogenesis, 32, 411–416 portance of chromatin on multidrug resistance in cancer. Exp. Cell (2011). Res., 290, 177–194 (2003). 31) Chung JH, Lee HJ, Kim BH, Cho NY, Kang GH. DNA methylation 14) Roberti A, La Sala D, Cinti C. Multiple genetic and epigenetic profile during multistage progression of pulmonary adenocarcino- interacting mechanisms contribute to clonally selection of drug- mas. Virchows Arch., 459, 201–211 (2011). resistant tumors: current views and new therapeutic prospective. J. 32) Xu L, Begum S, Barry M, Crowley D, Yang L, Bronson RT, Hynes Cell. Physiol., 207, 571–581 (2006). RO. GPR56 plays varying roles in endogenous cancer progression. 15) Teodoridis JM, Strathdee G, Brown R. Epigenetic silencing medi- Clin. Exp. Metastasis, 27, 241–249 (2010). ated by CpG island methylation: potential as a therapeutic target 33) Ke N, Sundaram R, Liu G, Chionis J, Fan W, Rogers C, Awad T, and as a biomarker. Drug Resist. Updat., 7, 267–278 (2004). Grifman M, Yu D, Wong-Staal F, Li QX. Orphan G protein-coupled 16) Brown R, Glasspool R. Epigenetic modulation of resistance to che- receptor GPR56 plays a role in cell transformation and tumorigen- motherapy? Ann. Oncol., 18, 1429–1430 (2007). esis involving the cell adhesion pathway. Mol. Cancer Ther., 6, 17) Chekhun VF, Lukyanova NY, Kovalchuk O, Tryndyak VP, Pogrib- 1840–1850 (2007). ny IP. Epigenetic profiling of multidrug-resistant human MCF-7 34) Zhao QZ, Dou KF. Methylation of Ras association domain family breast adenocarcinoma cells reveals novel hyper- and hypomethyl- protein 1, isoform A correlated with proliferation and drug resis- ated targets. Mol. Cancer Ther., 6, 1089–1098 (2007). tance in hepatocellular carcinoma cell line SMMC-7721. J. Gastro- 18) Qiu YY, Mirkin BL, Dwivedi RS. Inhibition of DNA methyltrans- enterol. Hepatol., 22, 683–689 (2007). ferase reverses cisplatin induced drug resistance in murine neuro- 35) Huang Y, de la Chapelle A, Pellegata NS. Hypermethylation, but not blastoma cells. Cancer Detect. Prev., 29, 456–463 (2005). LOH, is associated with the low expression of MT1G and CRABP1 19) Plumb JA, Strathdee G, Sludden J, Kaye SB, Brown R. Reversal of in papillary thyroid carcinoma. Int. J. Cancer, 104, 735–744 (2003). drug resistance in human tumor xenografts by 2′-deoxy-5-azacyti- 36) Koga Y, Pelizzola M, Cheng E, Krauthammer M, Sznol M, Ariyan dine-induced demethylation of the hMLH1 gene promoter. Cancer S, Narayan D, Molinaro AM, Halaban R, Weissman SM. Genome- Res., 60, 6039–6044 (2000). wide screen of promoter methylation identifies novel markers in 20) Liu R, Hong Z. Relationship between methylation status of multi- melanoma. Genome Res., 19, 1462–1470 (2009). drug resistance protein (MRP) and multi-drug resistance in lung 37) Boyes J, Bird A. Repression of genes by DNA methylation depends cancer cell lines. Chin. J. Cancer Res., 19, 277–282 (2007). on CpG density and promoter strength: evidence for involvement of 21) Guo R, Wu G, Ji F, Xu S. Methylation of DNA mismatch repair a methyl-CpG binding protein. EMBO J., 11, 327–333 (1992). gene MLH1 and MSH2 in acquired multidrug-resistance of human 38) Tycko B. Epigenetic gene silencing in cancer. J. Clin. Invest., 105, small cell lung cancer cells H446. Acta Academiae Medicinae Mili- 401–407 (2000). taris Tertiae, 29, 2247–2249 (2007). 39) Suzuki MM, Bird A. DNA methylation landscapes: provocative in- 22) Guo R, Wu G, Ji F, Huang G, Chen W. Preliminary study of mecha- sights from epigenomics. Nat. Rev. Genet., 9, 465–476 (2008). nisms of docetacel on human lung adenocarcinoma multidrug- 40) Cheung HH, Lee TL, Davis AJ, Taft DH, Rennert OM, Chan WY. resistant cells A549/CDDP and its parental cells. Acta Academiae Genome-wide DNA methylation profiling reveals novel epige- Medicinae Militaris Tertiae, 27, 610–613 (2005). netically regulated genes and non-coding RNAs in human testicular 23) Weber M, Davies JJ, Wittig D, Oakeley EJ, Haase M, Lam WL, cancer. Br. J. Cancer, 102, 419–427 (2010). Schübeler D. Chromosome-wide and promoter-specific analyses 41) Eckhardt F, Lewin J, Cortese R, Rakyan VK, Attwood J, Burger identify sites of differential DNA methylation in normal and trans- M, Burton J, Cox TV, Davies R, Down TA, Haefliger C, Horton R, formed human cells. Nat. Genet., 37, 853–862 (2005). Howe K, Jackson DK, Kunde J, Koenig C, Liddle J, Niblett D, Otto 24) Johnson DS, Li W, Gordon DB, Bhattacharjee A, Curry B, Ghosh T, Pettett R, Seemann S, Thompson C, West T, Rogers J, Olek A, J, Brizuela L, Carroll JS, Brown M, Flicek P, Koch CM, Dunham Berlin K, Beck S. DNA methylation profiling of human chromo- I, Bieda M, Xu X, Farnham PJ, Kapranov P, Nix DA, Gingeras TR, somes 6, 20 and 22. Nat. Genet., 38, 1378–1385 (2006). Zhang X, Holster H, Jiang N, Green RD, Song JS, McCuine SA, 42) Feinberg AP, Ohlsson R, Henikoff S. The epigenetic progenitor ori- Anton E, Nguyen L, Trinklein ND, Ye Z, Ching K, Hawkins D, Ren gin of human cancer. Nat. Rev. Genet., 7, 21–33 (2006).