DOCSLIB.ORG

Detection of Respiratory Viruses and Subtype Identification of Inffuenza a Viruses by Greenechipresp Oligonucleotide Microarray

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Detection of Respiratory Viruses and Subtype Identification of Inffuenza a Viruses by Greenechipresp Oligonucleotide Microarray JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 2007, p. 2359–2364 Vol. 45, No. 8 0095-1137/07/$08.00ϩ0 doi:10.1128/JCM.00737-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved. Detection of Respiratory Viruses and Subtype Identification of Influenza A Viruses by GreeneChipResp Oligonucleotide Microarrayᰔ† Phenix-Lan Quan,1‡ Gustavo Palacios,1‡ Omar J. Jabado,1 Sean Conlan,1 David L. Hirschberg,2 Francisco Pozo,3 Philippa J. M. Jack,4 Daniel Cisterna,5 Neil Renwick,1 Jeffrey Hui,1 Andrew Drysdale,1 Rachel Amos-Ritchie,4 Elsa Baumeister,5 Vilma Savy,5 Kelly M. Lager,6 Ju¨rgen A. Richt,6 David B. Boyle,4 Adolfo Garcı´a-Sastre,7 Inmaculada Casas,3 Pilar Perez-Bren˜a,3 Thomas Briese,1 and W. Ian Lipkin1* Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, New York, New York1; Stanford School of Medicine, Palo Alto, California2; Centro Nacional de Microbiologia, Instituto de Salud Carlos III, Madrid, Spain3; CSIRO Livestock Industries, Australian Animal Health Laboratory, Victoria, Australia4; Instituto Nacional de Enfermedades Infecciosas, ANLIS Dr. Carlos G. Malbra´n, Buenos Aires, Argentina5; National Animal Disease Center, USDA, Ames, Iowa6; and Department of Microbiology and Emerging Pathogens Institute, 7 Mount Sinai School of Medicine, New York, New York Downloaded from Received 4 April 2007/Returned for modification 15 May 2007/Accepted 21 May 2007 Acute respiratory infections are significant causes of morbidity, mortality, and economic burden worldwide. An accurate, early differential diagnosis may alter individual clinical management as well as facilitate the recognition of outbreaks that have implications for public health. Here we report on the establishment and validation of a comprehensive and sensitive microarray system for detection of respiratory viruses and jcm.asm.org subtyping of influenza viruses in clinical materials. Implementation of a set of influenza virus enrichment primers facilitated subtyping of influenza A viruses through the differential recognition of hemagglutinins 1 through 16 and neuraminidases 1 through 9. Twenty-one different respiratory virus species were accurately characterized, including a recently identified novel genetic clade of rhinovirus. at COLUMBIA UNIVERSITY on June 4, 2008 Acute respiratory infections (ARIs) are leading causes of and public health practitioners must have the ability to dis- childhood morbidity and mortality worldwide, resulting in an criminate between the worried well and individuals infected estimated 1.9 million deaths in 2000 (8, 23, 34). ARIs account with pandemic influenza virus strains or other pathogens in for 1 to 3% of deaths among children less than 5 years of age order to appropriately allocate limited resources such as drugs in industrialized countries and 10 to 25% of deaths among and isolation facilities. children less than 5 years of age in developing countries (4). We and others have reported on multiplex PCR assays whereby The economic burden of ARIs is profound. In the United the microflora in clinical materials can be detected at the genus States the annual economic impact of non-influenza virus- and the species levels (6, 7, 9, 12, 16, 28, 29). Although these related viral respiratory tract infections is estimated to be $40 assays can facilitate the rapid, sensitive differential diagnosis of billion (13); influenza virus alone is responsible for approxi- ARIs and have recently enabled the recognition of a novel genetic mately $12 billion (26). clade of rhinovirus (18), such assays are limited to 20 to 30 can- Highly multiplexed, sensitive diagnostic methods are needed didate pathogens and may be confounded in the event that virus to address the challenges of ARIs. The early recognition of a evolution results in mutations at primer binding sites. DNA mi- causative agent may enable specific interventions that reduce croarrays offer unprecedented opportunities for multiplexing; morbidity and mortality; the personal and social burdens as- however, they are not widely implemented in clinical microbiol- sociated with losses in productivity; and the potential resis- ogy laboratories because of problems with sensitivity, throughput, tance, toxicities, and expense associated with inappropriate validation, and expense (11, 15, 19, 20, 25, 30, 32, 33). Here we therapy. Insights into the epidemiology of ARIs may also be report on the design and validation of a comprehensive microar- useful in directing vaccine and drug development and policy on ray system, the GreeneChipResp system, that allows the sensitive a larger scale. With the recent appreciation of the risk of detection of a wide variety of respiratory viruses and subtype pandemic influenza, there is an urgent need for the establish- identification of all influenza A virus hemagglutinins (HA) and ment of tools for diagnosis and surveillance (26). Clinicians neuraminidases (NA): H1 through H16 and N1 through N9, respectively. * Corresponding author. Mailing address: Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, 722 West 168th Street, Room 1801, New MATERIALS AND METHODS York, NY 10032. Phone: (212) 342-9033. Fax: (212) 342-9044. E-mail: Viruses. The sources of the viral reference strains used in this study are [email protected]. indicated in the footnotes to Tables S1 and S3 of the supplemental material. † Supplemental material for this article may be found at http://jcm With the exception of postmortem lung tissue samples (samples 47 and 160) from .asm.org/. two patients who died of severe acute respiratory syndrome (SARS) at Mount ‡ Both authors contributed equally to this work. Sinai Hospital, Toronto, Ontario, Canada, all clinical samples were nasopharyn- ᰔ Published ahead of print on 6 June 2007. geal aspirates collected by the Instituto de Salud Carlos III, Madrid, Spain. All 2359 2360 QUAN ET AL. J. CLIN. MICROBIOL. nasopharyngeal aspirates were previously assayed for the presence of viral patho- the same hybridization conditions. The slides were washed as described above, gens by multiplex reverse transcription-nested PCR assays (9, 10, 21). air dried, and scanned (Agilent DNA Microarray scanner, Agilent Technolo- Sample preparation. RNA from virus isolates (culture supernatant) and clin- gies). ical samples was isolated by use of the TriReagent (Molecular Research Center, GreeneLAMP analyses. The GreeneLAMP algorithm (version 1.0) was cre- Cincinnati, OH). DNA was removed from RNA preparations by treatment with ated to assess the results of the GreeneChip hybridizations (25). Briefly, the DNase I (DNA-free; Ambion, Austin, TX). Reverse transcription reactions were BLASTN program (1) was used to connect the probe sequences on the Greene- performed with the TaqMan Reverse Transcription Reagents kit (Applied Bio- ChipResp array to entries in a viral sequence database. Each sequence has a systems, Foster City, CA). corresponding NCBI taxonomy identifier ID (TaxID), which is in turn mapped to Two protocols were used to amplify templates for the hybridizations with the a node in a phylogenetic tree constructed on the basis of the ICTV taxonomy. GreeneChipResp array. In one protocol, first-strand synthesis was initiated with Probe intensities were corrected for the background intensity, log2 trans- a random octamer linked to a specific artificial primer sequence, 5Ј GTT TCC formed, and converted to Z scores (and the corresponding P values). Positive CAG TAG GTC TCN NNN NNN N 3Ј (sequence-independent amplification events were selected as those with a fluorescent signal that was greater than 2 [SIA] primer) (5). After RNase H digestion, the cDNA was amplified by using a standard deviations above the mean fluorescent signal. Candidate TaxIDs were 1:9 mixture of the SIA primer and a primer targeting the specific primer se- ranked by combining the P values for individual probes (3) for the positive quence (5Ј CGC CGT TTC CCA GTA GGT CTC 3Ј; the CGCC sequence at the probes within that TaxID. For FLUAV subtyping, probe sequences on the 5Ј end of the primer is included to enhance the annealing of the primer to the GreeneChipResp array were grouped by subtype rather than TaxID. The template and allow amplification at a higher temperature to increase the effi- FLUAV subtyping probes were then reanalyzed for the FLUAV-positive sam- ciency of the PCR). Initial PCR amplification cycles were performed at a low ples by using the GreeneLAMP algorithm. The rank and positive probe distri- annealing temperature (25°C); subsequent cycles used a stringent annealing bution along each gene was then used to determine the subtype. temperature (55°C) to favor priming through the specific sequence. The products Quantitative real-time PCR. For sensitivity assessments, real-time PCR as- of this first PCR were then amplified in a second PCR with the specific primer says were conducted to determine the viral load in each sample. Reactions Downloaded from sequence linked to a capture sequence for 3DNA dendrimers that contain more were performed in a 25-␮l volume by using either a SYBR green or a TaqMan than 300 fluorescent reporter molecules (Genisphere Inc., Hatfield, PA). assay (Applied Biosystems). The following cycling conditions were used: 50°C When this approach failed with nasopharyngeal aspirates from individuals for 2 min and 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and 60°C infected with influenza A virus (FLUAV), influenza B virus (FLUBV), or influ- for 1 min. Real-time PCR assays were performed with previously published enza C virus (FLUCV), we established a modified protocol wherein first-strand primers (22, 24, 27, 31, 35), with the exception of the assay for human synthesis was initiated with the SIA primer doped with a primer mixture con- parainfluenza virus type 2, for which we used the primer set Taq-908F (5Ј taining the same specific sequence linked to FLUAV, FLUBV, and FLUCV GGACTTGGAACAAGATGGCCT 3Ј [forward]), Taq-984R (5Ј AGCATG jcm.asm.org sequences representing the conserved termini of influenza virus genome seg- AGAGCYTTTAATTTCTGGA 3Ј [reverse]), and Taq-930T (5Ј FAM-CAT ments (influenza enrichment [IE] primers; 5 pmol per primer).
Load more

Recommended publications
  • Antiviral Bioactive Compounds of Mushrooms and Their Antiviral Mechanisms: a Review
    viruses Review Antiviral Bioactive Compounds of Mushrooms and Their Antiviral Mechanisms: A Review Dong Joo Seo 1 and Changsun Choi 2,* 1 Department of Food Science and Nutrition, College of Health and Welfare and Education, Gwangju University 277 Hyodeok-ro, Nam-gu, Gwangju 61743, Korea; [email protected] 2 Department of Food and Nutrition, School of Food Science and Technology, College of Biotechnology and Natural Resources, Chung-Ang University, 4726 Seodongdaero, Daeduck-myun, Anseong-si, Gyeonggi-do 17546, Korea * Correspondence: [email protected]; Tel.: +82-31-670-4589; Fax: +82-31-676-8741 Abstract: Mushrooms are used in their natural form as a food supplement and food additive. In addition, several bioactive compounds beneficial for human health have been derived from mushrooms. Among them, polysaccharides, carbohydrate-binding protein, peptides, proteins, enzymes, polyphenols, triterpenes, triterpenoids, and several other compounds exert antiviral activity against DNA and RNA viruses. Their antiviral targets were mostly virus entry, viral genome replication, viral proteins, and cellular proteins and influenced immune modulation, which was evaluated through pre-, simultaneous-, co-, and post-treatment in vitro and in vivo studies. In particular, they treated and relieved the viral diseases caused by herpes simplex virus, influenza virus, and human immunodeficiency virus (HIV). Some mushroom compounds that act against HIV, influenza A virus, and hepatitis C virus showed antiviral effects comparable to those of antiviral drugs. Therefore, bioactive compounds from mushrooms could be candidates for treating viral infections. Citation: Seo, D.J.; Choi, C. Antiviral Bioactive Compounds of Mushrooms Keywords: mushroom; bioactive compound; virus; infection; antiviral mechanism and Their Antiviral Mechanisms: A Review.
    [Show full text]
  • Module1: General Concepts
    NPTEL – Biotechnology – General Virology Module1: General Concepts Lecture 1: Virus history The history of virology goes back to the late 19th century, when German anatomist Dr Jacob Henle (discoverer of Henle’s loop) hypothesized the existence of infectious agent that were too small to be observed under light microscope. This idea fails to be accepted by the present scientific community in the absence of any direct evidence. At the same time three landmark discoveries came together that formed the founding stone of what we call today as medical science. The first discovery came from Louis Pasture (1822-1895) who gave the spontaneous generation theory from his famous swan-neck flask experiment. The second discovery came from Robert Koch (1843-1910), a student of Jacob Henle, who showed for first time that the anthrax and tuberculosis is caused by a bacillus, and finally Joseph Lister (1827-1912) gave the concept of sterility during the surgery and isolation of new organism. The history of viruses and the field of virology are broadly divided into three phases, namely discovery, early and modern. The discovery phase (1886-1913) In 1879, Adolf Mayer, a German scientist first observed the dark and light spot on infected leaves of tobacco plant and named it tobacco mosaic disease. Although he failed to describe the disease, he showed the infectious nature of the disease after inoculating the juice extract of diseased plant to a healthy one. The next step was taken by a Russian scientist Dimitri Ivanovsky in 1890, who demonstrated that sap of the leaves infected with tobacco mosaic disease retains its infectious property even after its filtration through a Chamberland filter.
    [Show full text]
  • Transport of Viral Specimens F
    CLINICAL MICROBIOLOGY REVIEWS, Apr. 1990, p. 120-131 Vol. 3, No. 2 0893-8512/90/020120-12$02.00/0 Copyright C) 1990, American Society for Microbiology Transport of Viral Specimens F. BRENT JOHNSON Department of Microbiology, Brigham Young University, Provo, Utah 84602 INTRODUCTION .......................................................................... 120 TRANSPORT SYSTEMS.......................................................................... 120 Swabs ........................................................................... 121 Swab-Tube Combinations ........................................................................... 121 Liquid Media .......................................................................... 122 Cell culture medium .......................................................................... 122 BSS and charcoal .......................................................................... 122 Broth-based media ........................................................................... 124 Bentonite-containing media .......................................................................... 124 Buffered sorbitol and sucrose-based solutions ........................................................................ 124 Transporters .......................................................................... 125 Viruses Adsorbed onto Filters .......................................................................... 125 Virus Stability in Transport Media: a Comparison ...................................................................
    [Show full text]
  • Risk Groups: Viruses (C) 1988, American Biological Safety Association
    Rev.: 1.0 Risk Groups: Viruses (c) 1988, American Biological Safety Association BL RG RG RG RG RG LCDC-96 Belgium-97 ID Name Viral group Comments BMBL-93 CDC NIH rDNA-97 EU-96 Australia-95 HP AP (Canada) Annex VIII Flaviviridae/ Flavivirus (Grp 2 Absettarov, TBE 4 4 4 implied 3 3 4 + B Arbovirus) Acute haemorrhagic taxonomy 2, Enterovirus 3 conjunctivitis virus Picornaviridae 2 + different 70 (AHC) Adenovirus 4 Adenoviridae 2 2 (incl animal) 2 2 + (human,all types) 5 Aino X-Arboviruses 6 Akabane X-Arboviruses 7 Alastrim Poxviridae Restricted 4 4, Foot-and- 8 Aphthovirus Picornaviridae 2 mouth disease + viruses 9 Araguari X-Arboviruses (feces of children 10 Astroviridae Astroviridae 2 2 + + and lambs) Avian leukosis virus 11 Viral vector/Animal retrovirus 1 3 (wild strain) + (ALV) 3, (Rous 12 Avian sarcoma virus Viral vector/Animal retrovirus 1 sarcoma virus, + RSV wild strain) 13 Baculovirus Viral vector/Animal virus 1 + Togaviridae/ Alphavirus (Grp 14 Barmah Forest 2 A Arbovirus) 15 Batama X-Arboviruses 16 Batken X-Arboviruses Togaviridae/ Alphavirus (Grp 17 Bebaru virus 2 2 2 2 + A Arbovirus) 18 Bhanja X-Arboviruses 19 Bimbo X-Arboviruses Blood-borne hepatitis 20 viruses not yet Unclassified viruses 2 implied 2 implied 3 (**)D 3 + identified 21 Bluetongue X-Arboviruses 22 Bobaya X-Arboviruses 23 Bobia X-Arboviruses Bovine 24 immunodeficiency Viral vector/Animal retrovirus 3 (wild strain) + virus (BIV) 3, Bovine Bovine leukemia 25 Viral vector/Animal retrovirus 1 lymphosarcoma + virus (BLV) virus wild strain Bovine papilloma Papovavirus/
    [Show full text]
  • Reverse Genetics of Rotavirus COMMENTARY Ulrich Desselbergera,1
    COMMENTARY Reverse genetics of rotavirus COMMENTARY Ulrich Desselbergera,1 The genetics of viruses are determined by mutations clarify structure/function relationships of viral genes of their nucleic acid. Mutations can occur spontane- and their protein products and also elucidate complex ously or be produced by physical or chemical means: phenotypes, such as host restriction, pathogenicity, for example, the application of different temperatures and immunogenicity. or mutagens (such as hydroxylamine, nitrous acid, or Kanai et al. (1) have now developed a reverse ge- alkylating agents) that alter the nucleic acid. The clas- netics system for rotaviruses (RVs), which are a major sic way to study virus mutants is to identify a change in cause of acute gastroenteritis in infants and young chil- phenotype compared with the wild-type and to corre- dren and in many mammalian and avian species. World- late this with the mutant genotype (“forward genet- wide RV-associated disease still leads to the death of ics”). Mutants can be studied by complementation, over 200,000 children of <5 y of age per annum (2) recombination, or reassortment analyses. These ap- and thus represents a major public health problem. proaches, although very useful, are cumbersome and The work by Kanai et al. (1) is the most recent ad- prone to problems by often finding several mutations dition to a long list of plasmid-only–based reverse ge- in a genome that are difficult to correlate with a change netics systems of RNA viruses, a selection of which is in phenotype. With the availability of the nucleotide presented in Table 1 (3–13).
    [Show full text]
  • Viral Strategies of Immune Function Impairment (Viral Evolution/Mathemadcal Models) SEBASTIAN BONHOEFFER and MARTIN A
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 8062-8066, August 1994 Evolution Intra-host versus inter-host selection: Viral strategies of immune function impairment (viral evolution/mathemadcal models) SEBASTIAN BONHOEFFER AND MARTIN A. NOWAK Department of Zoology, University of Oxford, South Parks Road, OX1 3PS, Oxford, United Kingdom Communicated by Baruch S. Blumberg, April 14, 1994 ABSTRACT We investigate the evolution of viral strate- virus-infected cells. Vaccinia virus inhibits the classical path- gies to counteract immunological attack. These strategies can way ofcomplement activation (3). Both cowpox and vaccinia be divided into two classes: those that impair the immune virus developed proteins that interfere with interleukin 1 response inside or at the surface of a virus-infected cell and (4-6), a cytokine involved in a variety of inflammatory and those that impair the immune response outside an infected cell. immunological responses. Shope fibroma virus produces a The former strategies confer a "selfish" individual selective soluble TNF receptor, which acts as a decoy, binding TNF advantage for intra-host competition among viruses. The latter before it reaches the infected target cell (7). Similarly, strategies confer an "unselfish" selective advantage to the virus myxoma virus secrets IFN-y receptors (8). population as a group. A mutant, defective in the gene coding All these viral defense strategies seem advantageous for for the extracellular immune function-impairment strategy, the defense against the immune responses, but there is an may be protected from immune attack because the wild-type important difference between the adenovirus and the poxvi- virus in the same host successfully impairs the host's immune rus strategies listed above.
    [Show full text]
  • Prion-Like Domains in Eukaryotic Viruses George Tetz & Victor Tetz
    www.nature.com/scientificreports OPEN Prion-like Domains in Eukaryotic Viruses George Tetz & Victor Tetz Prions are proteins that can self-propagate, leading to the misfolding of proteins. In addition to the Received: 20 March 2018 previously demonstrated pathogenic roles of prions during the development of diferent mammalian Accepted: 30 May 2018 diseases, including neurodegenerative diseases, they have recently been shown to represent an Published: xx xx xxxx important functional component in many prokaryotic and eukaryotic organisms and bacteriophages, confrming the previously unexplored important regulatory and functional roles. However, an in- depth analysis of these domains in eukaryotic viruses has not been performed. Here, we examined the presence of prion-like proteins in eukaryotic viruses that play a primary role in diferent ecosystems and that are associated with emerging diseases in humans. We identifed relevant functional associations in diferent viral processes and regularities in their presence at diferent taxonomic levels. Using the prion-like amino-acid composition computational algorithm, we detected 2679 unique putative prion- like domains within 2,742,160 publicly available viral protein sequences. Our fndings indicate that viral prion-like proteins can be found in diferent viruses of insects, plants, mammals, and humans. The analysis performed here demonstrated common patterns in the distribution of prion-like domains across viral orders and families, and revealed probable functional associations with diferent steps of viral replication and interaction with host cells. These data allow the identifcation of the viral prion-like proteins as potential novel regulators of viral infections. Recently, prions and their infectious forms have attracted a lot of research attention1,2.
    [Show full text]
  • USMLE Step 1: Predict Viral Replication in Enucleated Cells
    USMLE Step 1: Predict viral replication in enucleated cells DEC 8, 2016 Staff News Writer If you’re preparing for the United States Medical Licensing Examination® (USMLE®) Step 1 exam, you might want to know which questions are most often missed by test takers. Check out this example from Kaplan Medical, and view an expert video explanation of the answer. Also check out all posts in this series. This month’s stumper An investigator is studying virus life cycles. He creates a continuous culture of kidney fibroblasts that are suitable hosts for a large variety of viral agents. In one experiment, the nuclei of these cells are removed by cytosurgery, and various viral agents are added to the cultures. Following culture of the viruses with the enucleated cells, the yield of cytopathic units of virus is quantified. Which of the following viruses would be capable of replication in these enucleated cells? A. Adenovirus B. Cytomegalovirus C. Influenza virus D. JC virus E. Poliovirus URL: https://www.ama-assn.org/residents-students/usmle/usmle-step-1-predict-viral-replication-enucleated-cells Copyright 1995 - 2021 American Medical Association. All rights reserved. The correct answer is E. Kaplan Medical explains why Most RNA viruses—for example, poliovirus—replicate in the cytoplasm and therefore can replicate in enucleated cells. Poliovirus belongs to the family Picornaviridae. These viruses are nonenveloped and have an icosahedral nucleocapsid that contains positive-sense RNA. Why the other answers are wrong Read these explanations to understand the important rationale for why each answer is incorrect. Choice A: Adenoviruses are non-enveloped and have an icosahedral nucleocapsid that contains a double-stranded linear DNA genome.
    [Show full text]
  • Evolution and Ecology of Influenza a Viruses ROBERT G
    MICROBIOLOGICAL REVIEWS, Mar. 1992, p. 152-179 Vol. 56, No. 1 0146-0749/92/010152-28$02.00/0 Copyright © 1992, American Society for Microbiology Evolution and Ecology of Influenza A Viruses ROBERT G. WEBSTER,* WILLIAM J. BEAN, OWEN T. GORMAN, THOMAS M. CHAMBERS,t AND YOSHIHIRO KAWAOKA Department of Virology and Molecular Biology, St. Jude Children's Research Hospital, 332 North Lauderdale, P.O. Box 318, Memphis, Tennessee 38101 INTRODUCTION ............ 153 STRUCTURE AND FUNCTION OF THE INFLUENZA VIRUS VIRION .153 Components of the Virion.153 PB2 polymerase.154 PB1 polymerase.154 PA polymerase ........... 154 Hemagglutinin.154 Nucleoprotein .155 Neuraminidase.155 Ml protein ............................................... 155 M2 protein .155 Nonstructural NS1 and NS2 proteins.155 Influenza Virus Replication Cycle.156 RESERVOIRS OF INFLUENZA A VIRUSES IN NATURE.156 Influenza Viruses in Birds: Wild Ducks, Shorebirds, Gulls, Poultry, and Passerine Birds.156 Influenza Viruses in Pigs.158 Influenza Viruses in Horses ....................P 159 Influenza Viruses in Other Species: Seals, Mink, and Whales.159 Molecular Determinants of Host Range Restriction.160 Mechanism for Perpetuating Influenza Viruses in Avian Species.161 Continuous circulation in aquatic bird species.161 Circulation between different avian species.161 Persistence in water or ice.161 Persistence in individual animals .161 Continuous circulation in subtropical and tropical regions .161 EVOLUTIONARY PATHWAYS.161 Evolutionary Patterns among Influenza A Viruses.161 Selection Pressures
    [Show full text]
  • Infection in Mice: a Model of the Pathogenesis of Severe Orthomyxovirus Infection
    Am. J. Trop. Med. Hyg., 76(4), 2007, pp. 785–790 Copyright © 2007 by The American Society of Tropical Medicine and Hygiene DHORI VIRUS (ORTHOMYXOVIRIDAE: THOGOTOVIRUS) INFECTION IN MICE: A MODEL OF THE PATHOGENESIS OF SEVERE ORTHOMYXOVIRUS INFECTION ROSA I. MATEO, SHU-YUAN XIAO, HAO LEI, AMELIA P. A. TRAVASSOS DA ROSA, AND ROBERT B. TESH* Departments of Pathology and of Internal Medicine and Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, Texas Abstract. After intranasal, subcutaneous, or intraperitoneal infection with Dhori virus (DHOV), adult mice devel- oped a fulminant and uniformly fatal illness with many of the clinical and pathologic findings seen in mice infected with H5N1 highly pathogenic avian influenza A virus. Histopathologic findings in lungs of DHOV-infected mice consisted of hemorrhage, inflammation, and thickening of the interstitium and the alveolar septa and alveolar edema. Extra- pulmonary findings included hepatocellular necrosis and steatosis, widespread severe fibrinoid necrosis in lymphoid organs, marked lymphocyte loss and karyorrhexis, and neuronal degeneration in brain. Similar systemic histopathologic findings have been reported in the few fatal human H5N1 cases examined at autopsy. Because of the relationship of DHOV to the influenza viruses, its biosafety level 2 status, and its similar pathology in mice, the DHOV-mouse model may offer a low-cost, relatively safe, and realistic animal model for studies on the pathogenesis and management of H5N1 virus infection. INTRODUCTION (Indianapolis, IN). The animals were cared for in accordance with guidelines of the Committee on Care and Use of Labo- Since the appearance of human disease caused by avian ratory Animals (Institute of Laboratory Animal Resources, 1 influenza A H5N1 viruses in Hong Kong in 1997, there has National Resource Council) under an animal use protocol been renewed interest in the pathogenesis of highly patho- approved by the University of Texas Medical Branch.
    [Show full text]
  • A Short Note on Orthomyxoviridae Y
    Short Communication 1 A Short note on Orthomyxoviridae Y. Sai Sampath Kumar Andhra Loyola College, Vijayawada, India. Abstract disorder -A, − B and -C viruses, are enclosed polymer viruses that cause higher tract infections characterised Orthomyxoviridae (ὀρθός, orthós, Greek for by fever, chills, headache, generalized muscular aching, “straight”; μύξα, mýxa, Greek for “mucus”) could be a and loss of appetency (Webster et al. (1985)). The family family of negative-sense polymer viruses. It includes Orthomyxoviridae contains the genera Influenzavirus seven genera: Alphainfluenzavirus, Betainfluenzavirus, A, Influenzavirus B, Influenzavirus C, Thogotovirus, Deltainfluenzavirus, Gammainfluenzavirus, Isavirus, Quaranjavirus, and Isavirus. The name of the family Thogotovirus, and Quaranjavirus. The orthomyxoviruses comes from the Greek myxa, which means secretion, and (influenza viruses) represent the genus myxovirus, Keywordsorthos, which means correct or right. that consists of 3 sorts (species): A, B, and C. These viruses cause respiratory disorder, associate degree Orthomyxoviridae; Alphainfluenzavirus; Betainfluenzavirus ; acute disease with outstanding general symptoms. Deltainfluenzavirus The orthomyxoviridae family, containing respiratory Correspondence to: Citation: Sai Sampath Y. (2021). Cluster Analysis of Rabies Virus-Host (Homosapiens) Network to Determine Various Viral Y. Sai Sampath Kumar, Infections. EJBI. 17(6):01 Andhra Loyola College, DOI: 10.24105/ejbi.2020.17.6.01 Vijayawada, Received: June 01, 2021 India, Accepted: June 15, 2021 E-mail: [email protected] Published: June 22, 2021 1. Introduction Because the infectious agent order carries the blueprint for manufacturing new viruses, virologists think about it the foremost vital The myxovirus order contains eight segments of fibre negative-sense characteristic for classification. Respiratory disorder could be a fiber, polymer (ribonucleic acid), associate degreed an endogenous polymer helically formed, polymer virus of the myxovirus family.
    [Show full text]
  • Taxonomy and Comparative Virology of the Influenza Viruses
    2 Taxonomy and Comparative Virology of the Influenza Viruses INTRODUCTION Viral taxonomy has evolved slowly (and often contentiously) from a time when viruses were identified at the whim of the investigator by place names, names of persons (investigator or patient), sigla, Greco-Latin hybrid names, host of origin, or name of associated disease. Originally studied by pathologists and physicians, viruses were first named for the diseases they caused or the lesions they induced. Yellow fever virus turned its victims yellow with jaundice, and the virus now known as poliovirus destroyed the anterior horn cells or gray (polio) matter of the spinal cord. But the close kinship of polioviruses with coxsackievirus B1, the cause of the epidemic pleurodynia, is not apparent from names derived variously from site of pathogenic lesion and place of original virus isolation (Cox­ sackie, New York). In practice, many of the older names of viruses remain in common use, but the importance of a formal, more regularized approach to viral classification has been increasingly recognized by students and practitioners of virology as more basic information has become available about the nature of viruses. Accordingly, the International Committee on Taxonomy of Viruses has devised a generally ac­ cepted system for the classification and nomenclature of viruses that serves the needs of comparative virology in formulating regular guidelines for viral nomen­ clature. Although this nomenclature remains highly diversified and at times in­ consistent, retaining many older names, it affirms "an effort ... toward a latinized nomenclature" (Matthews, 1981) and places primary emphasis on virus structure and replication in viral classification.
    [Show full text]