JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 2007, p. 2359–2364 Vol. 45, No. 8 0095-1137/07/$08.00ϩ0 doi:10.1128/JCM.00737-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved. Detection of Respiratory Viruses and Subtype Identification of Influenza A Viruses by GreeneChipResp Oligonucleotide Microarrayᰔ† Phenix-Lan Quan,1‡ Gustavo Palacios,1‡ Omar J. Jabado,1 Sean Conlan,1 David L. Hirschberg,2 Francisco Pozo,3 Philippa J. M. Jack,4 Daniel Cisterna,5 Neil Renwick,1 Jeffrey Hui,1 Andrew Drysdale,1 Rachel Amos-Ritchie,4 Elsa Baumeister,5 Vilma Savy,5 Kelly M. Lager,6 Ju¨rgen A. Richt,6 David B. Boyle,4 Adolfo Garcı´a-Sastre,7 Inmaculada Casas,3 Pilar Perez-Bren˜a,3 Thomas Briese,1 and W. Ian Lipkin1* Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, New York, New York1; Stanford School of Medicine, Palo Alto, California2; Centro Nacional de Microbiologia, Instituto de Salud Carlos III, Madrid, Spain3; CSIRO Livestock Industries, Australian Animal Health Laboratory, Victoria, Australia4; Instituto Nacional de Enfermedades Infecciosas, ANLIS Dr. Carlos G. Malbra´n, Buenos Aires, Argentina5; National Animal Disease Center, USDA, Ames, Iowa6; and Department of Microbiology and Emerging Pathogens Institute, 7 Mount Sinai School of Medicine, New York, New York Downloaded from Received 4 April 2007/Returned for modification 15 May 2007/Accepted 21 May 2007 Acute respiratory infections are significant causes of morbidity, mortality, and economic burden worldwide. An accurate, early differential diagnosis may alter individual clinical management as well as facilitate the recognition of outbreaks that have implications for public health. Here we report on the establishment and validation of a comprehensive and sensitive microarray system for detection of respiratory viruses and jcm.asm.org subtyping of influenza viruses in clinical materials. Implementation of a set of influenza virus enrichment primers facilitated subtyping of influenza A viruses through the differential recognition of hemagglutinins 1 through 16 and neuraminidases 1 through 9. Twenty-one different respiratory virus species were accurately characterized, including a recently identified novel genetic clade of rhinovirus. at COLUMBIA UNIVERSITY on June 4, 2008 Acute respiratory infections (ARIs) are leading causes of and public health practitioners must have the ability to dis- childhood morbidity and mortality worldwide, resulting in an criminate between the worried well and individuals infected estimated 1.9 million deaths in 2000 (8, 23, 34). ARIs account with pandemic influenza virus strains or other pathogens in for 1 to 3% of deaths among children less than 5 years of age order to appropriately allocate limited resources such as drugs in industrialized countries and 10 to 25% of deaths among and isolation facilities. children less than 5 years of age in developing countries (4). We and others have reported on multiplex PCR assays whereby The economic burden of ARIs is profound. In the United the microflora in clinical materials can be detected at the genus States the annual economic impact of non-influenza virus- and the species levels (6, 7, 9, 12, 16, 28, 29). Although these related viral respiratory tract infections is estimated to be $40 assays can facilitate the rapid, sensitive differential diagnosis of billion (13); influenza virus alone is responsible for approxi- ARIs and have recently enabled the recognition of a novel genetic mately $12 billion (26). clade of rhinovirus (18), such assays are limited to 20 to 30 can- Highly multiplexed, sensitive diagnostic methods are needed didate pathogens and may be confounded in the event that virus to address the challenges of ARIs. The early recognition of a evolution results in mutations at primer binding sites. DNA mi- causative agent may enable specific interventions that reduce croarrays offer unprecedented opportunities for multiplexing; morbidity and mortality; the personal and social burdens as- however, they are not widely implemented in clinical microbiol- sociated with losses in productivity; and the potential resis- ogy laboratories because of problems with sensitivity, throughput, tance, toxicities, and expense associated with inappropriate validation, and expense (11, 15, 19, 20, 25, 30, 32, 33). Here we therapy. Insights into the epidemiology of ARIs may also be report on the design and validation of a comprehensive microar- useful in directing vaccine and drug development and policy on ray system, the GreeneChipResp system, that allows the sensitive a larger scale. With the recent appreciation of the risk of detection of a wide variety of respiratory viruses and subtype pandemic influenza, there is an urgent need for the establish- identification of all influenza A virus hemagglutinins (HA) and ment of tools for diagnosis and surveillance (26). Clinicians neuraminidases (NA): H1 through H16 and N1 through N9, respectively. * Corresponding author. Mailing address: Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, 722 West 168th Street, Room 1801, New MATERIALS AND METHODS York, NY 10032. Phone: (212) 342-9033. Fax: (212) 342-9044. E-mail: Viruses. The sources of the viral reference strains used in this study are [email protected]. indicated in the footnotes to Tables S1 and S3 of the supplemental material. † Supplemental material for this article may be found at http://jcm With the exception of postmortem lung tissue samples (samples 47 and 160) from .asm.org/. two patients who died of severe acute respiratory syndrome (SARS) at Mount ‡ Both authors contributed equally to this work. Sinai Hospital, Toronto, Ontario, Canada, all clinical samples were nasopharyn- ᰔ Published ahead of print on 6 June 2007. geal aspirates collected by the Instituto de Salud Carlos III, Madrid, Spain. All 2359 2360 QUAN ET AL. J. CLIN. MICROBIOL. nasopharyngeal aspirates were previously assayed for the presence of viral patho- the same hybridization conditions. The slides were washed as described above, gens by multiplex reverse transcription-nested PCR assays (9, 10, 21). air dried, and scanned (Agilent DNA Microarray scanner, Agilent Technolo- Sample preparation. RNA from virus isolates (culture supernatant) and clin- gies). ical samples was isolated by use of the TriReagent (Molecular Research Center, GreeneLAMP analyses. The GreeneLAMP algorithm (version 1.0) was cre- Cincinnati, OH). DNA was removed from RNA preparations by treatment with ated to assess the results of the GreeneChip hybridizations (25). Briefly, the DNase I (DNA-free; Ambion, Austin, TX). Reverse transcription reactions were BLASTN program (1) was used to connect the probe sequences on the Greene- performed with the TaqMan Reverse Transcription Reagents kit (Applied Bio- ChipResp array to entries in a viral sequence database. Each sequence has a systems, Foster City, CA). corresponding NCBI taxonomy identifier ID (TaxID), which is in turn mapped to Two protocols were used to amplify templates for the hybridizations with the a node in a phylogenetic tree constructed on the basis of the ICTV taxonomy. GreeneChipResp array. In one protocol, first-strand synthesis was initiated with Probe intensities were corrected for the background intensity, log2 trans- a random octamer linked to a specific artificial primer sequence, 5Ј GTT TCC formed, and converted to Z scores (and the corresponding P values). Positive CAG TAG GTC TCN NNN NNN N 3Ј (sequence-independent amplification events were selected as those with a fluorescent signal that was greater than 2 [SIA] primer) (5). After RNase H digestion, the cDNA was amplified by using a standard deviations above the mean fluorescent signal. Candidate TaxIDs were 1:9 mixture of the SIA primer and a primer targeting the specific primer se- ranked by combining the P values for individual probes (3) for the positive quence (5Ј CGC CGT TTC CCA GTA GGT CTC 3Ј; the CGCC sequence at the probes within that TaxID. For FLUAV subtyping, probe sequences on the 5Ј end of the primer is included to enhance the annealing of the primer to the GreeneChipResp array were grouped by subtype rather than TaxID. The template and allow amplification at a higher temperature to increase the effi- FLUAV subtyping probes were then reanalyzed for the FLUAV-positive sam- ciency of the PCR). Initial PCR amplification cycles were performed at a low ples by using the GreeneLAMP algorithm. The rank and positive probe distri- annealing temperature (25°C); subsequent cycles used a stringent annealing bution along each gene was then used to determine the subtype. temperature (55°C) to favor priming through the specific sequence. The products Quantitative real-time PCR. For sensitivity assessments, real-time PCR as- of this first PCR were then amplified in a second PCR with the specific primer says were conducted to determine the viral load in each sample. Reactions Downloaded from sequence linked to a capture sequence for 3DNA dendrimers that contain more were performed in a 25-␮l volume by using either a SYBR green or a TaqMan than 300 fluorescent reporter molecules (Genisphere Inc., Hatfield, PA). assay (Applied Biosystems). The following cycling conditions were used: 50°C When this approach failed with nasopharyngeal aspirates from individuals for 2 min and 95°C for 10 min, followed by 45 cycles at 95°C for 15 s and 60°C infected with influenza A virus (FLUAV), influenza B virus (FLUBV), or influ- for 1 min. Real-time PCR assays were performed with previously published enza C virus (FLUCV), we established a modified protocol wherein first-strand primers (22, 24, 27, 31, 35), with the exception of the assay for human synthesis was initiated with the SIA primer doped with a primer mixture con- parainfluenza virus type 2, for which we used the primer set Taq-908F (5Ј taining the same specific sequence linked to FLUAV, FLUBV, and FLUCV GGACTTGGAACAAGATGGCCT 3Ј [forward]), Taq-984R (5Ј AGCATG jcm.asm.org sequences representing the conserved termini of influenza virus genome seg- AGAGCYTTTAATTTCTGGA 3Ј [reverse]), and Taq-930T (5Ј FAM-CAT ments (influenza enrichment [IE] primers; 5 pmol per primer).