DOCSLIB.ORG

Molecular Prevalence and Species Co-Infection of Bovine Haemoparasites in Peninsular Malaysia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Prevalence and Species Co-Infection of Bovine Haemoparasites in Peninsular Malaysia VOLUME 8 NO. 2 JULY 2017 • pages 13-22 MALAYSIAN JOURNAL OF VETERINARY RESEARCH MOLECULAR PREVALENCE AND SPECIES CO-INFECTION OF BOVINE HAEMOPARASITES IN PENINSULAR MALAYSIA OLA-FADUNSIN S.D.1, MAIZATUL A.M.1, IBRAHIM A.R.1, AMLIZAWATHY A.1, CHANDRAWATHANI P.2, JESSE F.F.A1, SANI R.A.1 AND SHARMA R.S.K.1* 1 Faculty of Veterinary Medicine, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia. 2 Department of Veterinary Services, Ministry of Agriculture and Agro-Based IndustryWisma Tani, Block Podium, Lot 4G1, Precint 4, Federal Government Administration Centre, 62630 Putrajaya, Malaysia. * Corresponding author: [email protected] ABSTRACT. Bovine haemoparasites are first attempt in the country to document cosmopolitan in distribution and are the molecular prevalence and species co- known to cause substantial losses to the infection of bovine haemoparasites over a cattle industry. In spite of their economic wide spatial distribution. The data obtained importance, there remains a dearth of will facilitate treatment, control and information on their molecular epidemiology prevention measures to improve the local in many parts of the world including cattle industry. Malaysia. To ascertain the molecular Keywords: bovine haemoparasites, prevalence and species co-infection of Peninsular Malaysia, Anaplasma marginale, bovine haemoparasites in the country, Theileria orientalis, Candidatus Mycoplasma blood samples were collected from 1,045 haemobos, Babesia bovis, Babesia bigemina, heads of beef and dairy cattle on 43 farms Trypanosoma evansi from six geographical zones throughout Peninsular Malaysia. Samples subjected INTRODUCTION to PCR amplification of parasite species- specific genetic fragments revealed that The domestication and farming of livestock Anaplasma marginale was the most prevalent present many challenges including haemoparasite (72.6%), followed by Theileria prevention and control of diseases that orientalis (49.8%), Candidatus Mycoplasma could affect productivity. Haemoparasites haemobos (47.0%), Babesia bovis (32.5%), are among the pathogens of concern for Babesia bigemina (30.5%) and Trypanosoma successful livestock farming throughout evansi (17.9%). A high percentage (92.1%) the world (Jongejan and Uilenberg, 2004; of cattle was infected with either one or Sivakumar et al., 2012). In Malaysia, various more haemoparasites. Triple haemoparasite genera of haemopathogens namely species co-infection was the most prevalent Anaplasma, Babesia, Mycoplasma, Theileria (25.6%), followed closely by double species and Trypanosoma have been documented co-infection (25.1%). The most common to exert negative impacts on cattle (Lee (8.8%) and significantly corellated (rs = 0.250; and Whitten, 1982; Chin, 2007; Nur Mahiza p<0.01) combination was A. marginale + T. 2010; Rahman et al., 2012). Infection with orientalis. The present study constitutes the these haemoparasites are often sub-clinical, 13 MALAYSIAN JOURNAL OF VETERINARY RESEARCH VOLUME 8 NO. 2 JULY 2017 leading to a large pool of asymptomatic to attain self-sufficiency in beef and dairy carriers that act as a source of infection for products locally, it is vital that all aspects ticks and other blood sucking insect vectors of cattle farming and production should (Bell-Sakyi et al., 2004). The hot and humid be optimized. This includes the reduction tropical climate of Malaysia encourages and control of haemoparasitic diseases. the breeding and survival of various The present investigation was therefore arthropod vectors that are incriminated in undertaken to provide current information the transmission of these haemoparasites on the occurrence of cattle haemoparasites (Saharee and Fatimah, 1993). In the attempt in Peninsular Malaysia, utilising molecular to boost the cattle industry and to attain detection methods to determine the species self-sufficiency in beef and dairy products, diversity, prevalence and co-infection on various breeds of cattle from Europe, beef and dairy cattle farms throughout the Australia and South America have been country. imported into the country since the 1970s. This has potentially led to the importation MATERIALS AND METHODS and expansion of parasites since studies have shown that haemoparasites are more The study was conducted on 43 cattle farms prevalent in imported breeds of cattle over 33 locations throughout Peninsular compared to the local Kedah-Kelantan breed Malaysia (Table 1), comprising 23 beef farms, and their crosses (Fadzil and Ragavan, 1986; 16 dairy farms and four mixed beef-dairy Chin, 2007; Nur Mahiza, 2010; Rahman et al., farms. A total of 1045 cattle were sampled 2012; Haron et al., 2015). including 379 dairy and 666 beef cattle. In the past numerous studies have Sampling was carried out following a cross been carried out on the microscopy sectional study design and animals were and serological detection of bovine recruited from each farm by convenience haemoparasites in Malaysia (Rajamanickam, sampling. Approximately 5ml of blood 1970; Lee and Whiten, 1982; Salleh, 1984; was collected from each animal via jugular Fadzil and Ragavan, 1986; Kamio et al., or coccygeal venipuncture and placed in 1990; Lee et al., 1991; Chandrawathani et ethylenediaminetetraacetic acid (EDTA) al., 1993, 1994, 1998, 2014; Sani et al., 1995; coated blood collection tubes. Samples Sharifah, 2001; Chin, 2007; Nur Mahiza, 2010; were transported on ice to the Parasitology Rahman et al., 2010, 2012; Pong and Nik Laboratory, Faculty of Veterinary Medicine, Him, 2012; Nik Him et al., 2013; Haron et al., Universiti Putra Malaysia for storage at -80 °C 2015). However, apart from a single study and subsequent molecular detection. The on the molecular detection of Anaplasma farm coordinates were loaded into a geo- (Tay et al., 2014), there remains a paucity of database (ArcGIS 9.1TM, ESRI, Redlands, CA, information on the molecular prevalence, USA) for mapping and spatial analyses. species diversity and epidemiology of Deoxyribonucleic acid (DNA) was these pathogens in the country. With the extracted from frozen (-80 °C) whole blood increasing consumer demands and the need using the Qiagen DNeasy® Blood and Tissue 14 VOLUME 8 NO. 2 JULY 2017 MALAYSIAN JOURNAL OF VETERINARY RESEARCH Table 1. Distribution of cattle farms in Peninsular Malaysia sampled for the prevalence of bovine haemoparasites. Beef farms (b), dairy farms (d), mixed beef-dairy farms (bd). Zones and sampling locations No. farms No. cattle (%) North 6 105 (10.0) Bukit Mertajam, Pulau Pinang, Perlis, Kuala Ketil, Sik (3b, 3d) Northwest 8 220 (21.1) Kinta, Kampar, Ulu Bernam, Gopeng, Air Papan, Raub, Cameron Highlands (5b, 3d) Northeast 6 176 (16.8) Gua Musang, Kuala Krai, Pasir Puteh, Permaisuri, Hulu Terengganu (3b, 2d, 1bd) Southwest 9 186 (17.8) Serdang, Dengkil, Alor Gajah, Giadek, Jelebu, Temerloh (4b, 3d, 2bd) Southeast 5 186 (17.8) Jerantut, Rompin, Pekan, Dungun, Kemaman 3b, 1d, 1bd) South 9 172 (16.5) Muar, Labis, Mersing, Pontian, Kota Tinggi (5b, 4d) 43 Total 1045 (100.0) (23b, 16d, 4bd) kit according to the manufacturers’ protocol. Amplicons were electrophoresed on a 2% PCR amplification was carried out to amplify agarose gel (Vivantis, USA) at 90 V with nuclear and ribosomal gene fragments of TAE (Tris-acetic acid-EDTA) buffer, stained the various haemoparasites using species- with ethidium bromide, and viewed under specific primer sets and thermocyclic a UV transilluminator (GeneDocTM, Bio-Rad profiles (Table 2). PCR was carried out in Laboratories). Images were captured using a 25 μl reaction comprising 100-150 ng a digital camera and computer software genomic DNA, 1x reaction buffer (Green Go (GeneSnapTM, Bio-Rad Laboratories). In Tag Flexi Buffer, Promega Madison, USA), order to prevent cross-contamination, 1mM of each deoxynucleoside triphosphate work areas were designated solely for DNA (Promega), 5mM MgCl2 (Promega Madison, extraction, PCR reagent preparation, and USA), 1mM of each primer, and 0.5 units of PCR amplification. In addition, reagent Taq DNA polymerase (Promega Madison, preparation was done in a dedicated USA). Negative controls (template DNA biosafety cabinet which was UV illuminated substituted with sterile Type-1+ purified at the end of each session to avoid DNA water) and positive controls (positive crossover and contamination. Representative blood samples confirmed by microscopy amplicons from each parasite species and sequencing of the PCR amplicons) were gel-extracted and purified using were incorporated into each PCR run. the QIAquick Gel Extraction Kit (Qiagen, Amplification was done using the MyCyclerTM Germany) according to the manufacturers’ (Bio-Rad Laboratories, USA) thermal cycler. protocol. The amplified products were 15 MALAYSIAN JOURNAL OF VETERINARY RESEARCH VOLUME 8 NO. 2 JULY 2017 Table 2. Species-specific primers, thermocyclic profiles and expected amplicon size of the various gene fragments used for the detection and PCR amplification of bovine haemoparasites in Peninsular Malaysia. Thermocyclic profiles include initial denaturing (ID), denaturing (D), annealing (A), extension (E), and final extension (FE). Primer sequence (5ˈ-3ˈ) Thermocyclic Amplicon Parasite Gene Reference Forward (F) and Reverse (R) profile Size (bp) ID: 95°C /5mins D: 95°C /1min Anaplasma F- CATCTCCCATGAGTCACGAAGTGGC A: 65°C /2mins Shkap et al. MSP4 761 marginale R- GCTGAACAGGAATCTTGCTCCAAG E: 72°C /1min (2008) No of cycles: 40 FE: 72°C /10mins ID: 95°C /5mins D: 95°C /30secs Babesia F- TACTGTGACGAGGACGGATC A: 59°C /1min Sivakumar et al. AMA-1 211 bigemina
Load more

Recommended publications
  • Buku Daftar Senarai Nama Jurunikah Kawasan-Kawasan Jurunikah Daerah Johor Bahru Untuk Tempoh 3 Tahun (1 Januari 2016 – 31 Disember 2018)
    BUKU DAFTAR SENARAI NAMA JURUNIKAH KAWASAN-KAWASAN JURUNIKAH DAERAH JOHOR BAHRU UNTUK TEMPOH 3 TAHUN (1 JANUARI 2016 – 31 DISEMBER 2018) NAMA JURUNIKAH BI NO KAD PENGENALAN MUKIM KAWASAN L NO TELEFON 1 UST. HAJI MUSA BIN MUDA (710601-01-5539) 019-7545224 BANDAR -Pejabat Kadi Daerah Johor Bahru (ZON 1) 2 UST. FAKHRURAZI BIN YUSOF (791019-01-5805) 013-7270419 3 DATO’ HAJI MAHAT BIN BANDAR -Kg. Tarom -Tmn. Bkt. Saujana MD SAID (ZON 2) -Kg. Bahru -Tmn. Imigresen (360322-01-5539) -Kg. Nong Chik -Tmn. Bakti 07-2240567 -Kg. Mahmodiah -Pangsapuri Sri Murni 019-7254548 -Kg. Mohd Amin -Jln. Petri -Kg. Ngee Heng -Jln. Abd Rahman Andak -Tmn. Nong Chik -Jln. Serama -Tmn. Kolam Air -Menara Tabung Haji -Kolam Air -Dewan Jubli Intan -Jln. Straits View -Jln. Air Molek 4 UST. MOHD SHUKRI BIN BANDAR -Kg. Kurnia -Tmn. Melodies BACHOK (ZON 3) -Kg. Wadi Hana -Tmn. Kebun Teh (780825-01-5275) -Tmn. Perbadanan Islam -Tmn. Century 012-7601408 -Tmn. Suria 5 UST. AYUB BIN YUSOF BANDAR -Kg. Melayu Majidee -Flat Stulang (771228-01-6697) (ZON 4) -Kg. Stulang Baru 017-7286801 1 NAMA JURUNIKAH BI NO KAD PENGENALAN MUKIM KAWASAN L NO TELEFON 6 UST. MOHAMAD BANDAR - Kg. Dato’ Onn Jaafar -Kondo Datin Halimah IZUDDIN BIN HASSAN (ZON 5) - Kg. Aman -Flat Serantau Baru (760601-14-5339) - Kg. Sri Paya -Rumah Pangsa Larkin 013-3352230 - Kg. Kastam -Tmn. Larkin Perdana - Kg. Larkin Jaya -Tmn. Dato’ Onn - Kg. Ungku Mohsin 7 UST. HAJI ABU BAKAR BANDAR -Bandar Baru Uda -Polis Marin BIN WATAK (ZON 6) -Tmn. Skudai Kanan -Kg.
    [Show full text]
  • SENARAI PREMIS PENGINAPAN PELANCONG : JOHOR 1 Rumah
    SENARAI PREMIS PENGINAPAN PELANCONG : JOHOR BIL. NAMA PREMIS ALAMAT POSKOD DAERAH 1 Rumah Tumpangan Lotus 23, Jln Permas Jaya 10/3,Bandar Baru Permas Jaya,Masai 81750 Johor Bahru 2 Okid Cottage 41, Jln Permas 10/7,Bandar Baru Permas Jaya 81750 Johor Bahru 3 Eastern Hotel 200-A,Jln Besar 83700 Yong Peng 4 Mersing Inn 38, Jln Ismail 86800 Mersing 5 Mersing River View Hotel 95, Jln Jemaluang 86800 Mersing 6 Lake Garden Hotel 1,Jln Kemunting 2, Tmn Kemunting 83000 Batu Pahat 7 Rest House Batu Pahat 870,Jln Tasek 83000 Batu Pahat 8 Crystal Inn 36, Jln Zabedah 83000 Batu Pahat 9 Pulai Springs Resort 20KM, Jln Pontian Lama,Pulai 81110 Johor Bahru 10 Suria Hotel No.13-15,Jln Penjaja 83000 Batu Pahat 11 Indah Inn No.47,Jln Titiwangsa 2,Tmn Tampoi Indah 81200 Johor Bahru 12 Berjaya Waterfront Hotel No 88, Jln Ibrahim Sultan, Stulang Laut 80300 Johor Bahru 13 Hotel Sri Pelangi No. 79, Jalan Sisi 84000 Muar 14 A Vista Melati No. 16, Jalan Station 80000 Johor Bahru 15 Hotel Kingdom No.158, Jln Mariam 84000 Muar 16 GBW HOTEL No.9R,Jln Bukit Meldrum 80300 Johor Bahru 17 Crystal Crown Hotel 117, Jln Harimau Tarum,Taman Abad 80250 Johor Bahru 18 Pelican Hotel 181, Jln Rogayah 80300 Batu Pahat 19 Goodhope Hotel No.1,Jln Ronggeng 5,Tmn Skudai Baru 81300 Skudai 20 Hotel New York No.22,Jln Dato' Abdullah Tahir 80300 Johor Bahru 21 THE MARION HOTEL 90A-B & 92 A-B,Jln Serampang,Tmn Pelangi 80050 Johor Bahru 22 Hotel Classic 69, Jln Ali 84000 Muar 23 Marina Lodging PKB 50, Jln Pantai, Parit Jawa 84150 Muar 24 Lok Pin Hotel LC 117, Jln Muar,Tangkak 84900 Muar 25 Hongleng Village 8-7,8-6,8-5,8-2, Jln Abdul Rahman 84000 Muar 26 Anika Inn Kluang 298, Jln Haji Manan,Tmn Lian Seng 86000 Kluang 27 Hotel Anika Kluang 1,3 & 5,Jln Dato' Rauf 86000 Kluang BIL.
    [Show full text]
  • 1380097620-Laporan Tahunan 2003-Bhgn 3
    JABATAN ALAM SEKITAR DEPARTMENT OF ENVIRONMENT BAB / CHAPTER 5 JABATAN ALAM SEKITAR http://www.jas.sains.my 35 JABATAN ALAM SEKITAR DEPARTMENT OF ENVIRONMENT LAPORAN TAHUNAN 2003 36 ANNUAL REPORT 2003 JABATAN ALAM SEKITAR DEPARTMENT OF ENVIRONMENT PENGAWASAN KUALITI UDARA AIR QUALITY MONITORING Status Kualiti Udara Air Quality Status Pada tahun 2003, Jabatan Alam Sekitar (JAS) terus In 2003, the Department of Environment (DOE) mengawasi status kualiti udara di dalam negara monitored air quality under the national monitoring melalui rangkaian pengawasan kualiti udara network consisting of 51 automatic and 25 manual kebangsaan yang terdiri dari 51 stesen automatik dan stations (Map 5.1, Map 5.2). Sulphur Dioxide (SO2), 25 stesen manual (Peta 5.1, Peta 5.2). Sulfur Dioksida Carbon Monoxide (CO), Nitrogen Dioxide (NO2), (SO2), Karbon Monoksida (CO), Nitrogen Dioksida Ozone (O3) and Particulate Matter (PM10) were (NO2), Ozon (O3) and Partikulat Terampai (PM10) continuously monitored, while several heavy metals diawasi secara berterusan sementara logam berat including lead (Pb) were measured once in every six termasuk plumbum (Pb) diukur sekali pada setiap days (Table 5.1). enam hari. (Jadual 5.1). Secara keseluruhan, kualiti udara di seluruh negara The overall air quality for Malaysia throughout the pada tahun 2003 meningkat sedikit berbanding tahun 2003 improved slightly compared to 2002, such as sebelumnya terutama bagi parameter Partikulat for PM10, mainly due to more wet weather conditions Terampai (PM10) disebabkan oleh keadaan cuaca
    [Show full text]
  • Southern Region
    SOUTHERN REGION Negeri Sembilan Melaka UNESCO World Heritage City Johor History. Heritage. Recreation. Feel The Thrill! CONTENTS Welcome to the Southern Region 4 Negeri Sembilan 5 Map of Negeri Sembilan 6 Places of Interest 12 Shopping & Dining 13 Events 13 Essential Information 16 Melaka 17 Map of Melaka 18 Places of Interest 24 Shopping & Dining 25 Events 26 Essential Information 28 Johor 29 Map of Johor 30 Places of Interest 37 Shopping & Dining 38 Events & Recreation 39 Essential Information 44 Tips for Tourists 44 Malaysia at a Glance 46 Tourism Malaysia Offices WELCOME TO THE SOUTHERN REGION Discover the diverse facets of Asia as you explore the fascinating states of Negeri Sembilan, Melaka and Johor. The region, with its vibrant culture, historical relics, pristine islands and beaches as well as verdant rainforests, caters to all visitors. The UNESCO World Heritage City of Melaka has over 600 years of history, which is reflected in its ancient buildings, mouth-watering cuisine and unique cultural heritage, while Negeri Sembilan is home to the age-old Adat Perpatih custom and is synonymous with the Minangkabau culture. Johor is blessed with abundant natural treasures and is the ideal destination for nature lovers, eco-tourists, beach enthusiasts and water sports aficionados. The Southern Region is famous for attractions such as the iconic Porta de Santiago in Melaka City, the popular seaside resort of Port Dickson as well as the offshore islands and superb golf courses of Johor. Come and experience the magic of the Southern Region. The land of fascinating history and breathtaking wonders beckons. NEGERI SEMBILAN Negeri Sembilan is situated in the west of Peninsular Malaysia.
    [Show full text]
  • Pembangunan Wilayah Yang Seimbang
    LAPORAN TAHUNAN 2018 LAPORAN TAHUNAN PEJABAT KUALA LUMPUR PEJABAT NEGERI TERENGGANU Aras 3, Menara PjH Tingkat Bawah & Tingkat 1 Pembangunan Wilayah No.2, Jalan Tun Abdul Razak, 100B Jalan Sultan Zainal Abidin Presint 2, 62100 Putrajaya 20000 Kuala Terengganu, Terengganu yang Seimbang WILAYAH T : +603 8885 0000 T : +609 620 0021 EKONOMI F : +603 8885 0020 F : +609 620 0020 Lonjakan Seterusnya PANTAI TIMUR PEJABAT NEGERI PAHANG PEJABAT NEGERI KELANTAN B8002 Sri Kuantan Square Blok B, Bangunan Taman Industri Halal Jalan Teluk Sisek Pasir Mas, Lot PT9942, Lubok Jong 25050 Kuantan, Pahang Jalan Pasir Mas-Rantau Panjang 17000 Pasir Mas, Kelantan T : +609 565 0021 F : +609 565 0020 T : +609 791 9200 F : +609 791 9220 MAJLIS PEMBANGUNAN WILAYAH EKONOMI PANTAI TIMUR PANTAI EKONOMI MAJLIS WILAYAH PEMBANGUNAN LAPORAN TAHUNAN 2018 KANDUNGAN Mengenai ECER 1 Mengenai ECERDC 1 Perutusan Perdana Menteri 2 Laporan Ketua Pegawai Eksekutif 4 Struktur Organisasi 10 Anggota Majlis 11 Jawatankuasa Audit 12 Jawatankuasa Pelaksanaan dan Penyelarasan 13 Jawatankuasa Pengurusan 15 Rekod Pencapaian ECER (2007 - 2018) 16 Prestasi 2018 22 Pembuatan 24 Minyak, Gas dan Petrokimia 34 Pelancongan 40 Perniagaan Tani 52 Pembangunan Modal Insan dan Keusahawanan 62 Logistik dan Perkhidmatan 82 Warga Kerja ECERDC 90 Penyata Kewangan 98 Laporan Jawatankuasa Audit 2018 132 Lampiran 133 LAPORAN TAHUNAN 2018 | 1 MENGENAI ECER Wilayah Ekonomi Pantai Timur (ECER) terdiri daripada negeri Kelantan, Terengganu, VISI MENJADI WILAYAH MAJU Pahang dan daerah Mersing di Johor yang didiami oleh 4.3 juta penduduk. Merangkumi MENJELANG 2025 51 peratus keluasan seluruh Semenanjung • DISTINGTIF • DINAMIK • BERDAYA SAING Malaysia, ECER telah ditubuhkan untuk memastikan pengagihan kemakmuran secara seimbang.
    [Show full text]
  • Directors' Report and Audited Financial Statements
    DIRECTORS’ REPORT AND AUDITED FINANCIAL STATEMENTS 31 DECEMBER 2020 199301020767 (275505-K) Khazanah Nasional Berhad (Incorporated in Malaysia) Contents Page Directors' report 1 - 5 Statement by directors 6 Statutory declaration 6 Independent auditors' report 7 - 10 Corporate information and significant accounting policies 11 - 84 Statement of comprehensive income 85 Statement of financial position 86 Statement of changes in equity 87 Statement of cash flows 88 - 89 Notes to the Company financial statements 90 - 135 Consolidated statement of comprehensive income 136 - 137 Consolidated statement of financial position 138 - 139 Consolidated statement of changes in equity 140 - 141 Consolidated statement of cash flows 142 - 144 Notes to the Consolidated financial statements 145 - 363 199301020767 (275505-K) Khazanah Nasional Berhad (Incorporated in Malaysia) Directors' report The Directors hereby presenting their report together with the audited financial statements of the Group and of the Company for the financial year ended 31 December 2020. Principal activities The principal activity of the Company is that of investment holding. The principal activities of the subsidiaries, associates and joint ventures of the Company and of the Group are described in Note 77 and Note 78 to the financial statements, respectively. Results Group Company RM’000 RM’000 (Loss)/profit for the financial year, net of tax (2,856,924) 3,250,047 (Loss)/profit attributable to: Owners of the Company (2,675,399) 3,250,047 Non-controlling interests (181,525) - (2,856,924) 3,250,047 There were no material transfers to or from reserves or provisions during the financial year, other than as disclosed in the financial statements.
    [Show full text]
  • Criteria of Acceptance for Constant Rate of Strain Consolidation Test for Tropical Cohesive Soil
    Geotech Geol Eng DOI 10.1007/s10706-016-0016-8 ORIGINAL PAPER Criteria of Acceptance for Constant Rate of Strain Consolidation Test for Tropical Cohesive Soil Khairul Anuar Kassim . Ahmad Safuan A. Rashid . Ahmad Beng Hong Kueh . Chong Siaw Yah . Lam Chee Siang Received: 7 October 2015 / Accepted: 15 April 2016 Ó Springer International Publishing Switzerland 2016 Abstract In this study, the rapid consolidation This research has produced a set of criteria for equipment (RACE) was developed as an alternative determining the suitable rate for the rapid consolida- device to the conventional consolidation test using tion test based on the ratio of normalized strain rate, b, Oedometer, consuming merely a few hours for the and proposed a new coefficient in terms of a ratio of b whole precedure to determine the consolidation char- to clay fraction (CF), as a part of new criteria for acteristics of cohesive soil. RACE operates based on testing a fine soil. Four types of sample were tested the constant rate of strain (CRS) consolidation theory, with different rates of strain using the RACE and their which is a continuous loading method of testing, results were compared with those conducted using the requiring a good estimation of the loading rate such Oedometer on the same soil type, from which fairly that it is ideal for the achievement of steady state good agreements were evident in many specimens. It condition during testing. The steady state condition is was found from the study that the minimum value of achieved when the cv values from drained and normalized strain rate, b, for the CRS test is 0.005 and undrained face of CRS converged with the cv from for the ua /rv ratio is suggested as 0.01.
    [Show full text]
  • Penilaian Kaedah Laluan Terpendek : Rangkaian Jalan Raya Kajian Kes : Negeri Johor Dan Melaka
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Universiti Teknologi Malaysia Institutional Repository PENILAIAN KAEDAH LALUAN TERPENDEK : RANGKAIAN JALAN RAYA KAJIAN KES : NEGERI JOHOR DAN MELAKA ROHAIZAN BINTI RAMLAN (Sarjana Teknologi Maklumat (Pembuatan), UTM) Tesis ini telah dikemukankan sebagai memenuhi syarat penganugerahan Ijazah Sarjana Teknologi Maklumat (Pembuatan) Fakulti Sains Komputer dan Sistem Maklumat Universiti Teknologi Malaysia OKTOBER 2005 PSZ 19:16 (Pind.1/97) UNIVERSITI TEKNOLOGI MALAYSIA BORANG PENGESAHAN STATUS TESIS JUDUL : PENILAIAN KAEDAH LALUAN TERPENDEK RANGKAIAN JALAN RAYA . KAJIAN KES : NEGERI JOHOR DAN MELAKA SESI PENGAJIAN : 2005/2006 Saya ROHAIZAN BINTI RAMLAN ( HURUF BESAR ) mengaku membenarkan tesis (PSM/Sarjana/Doktor Falsafah)* disimpan di Perpustakaan Universiti Teknologi Malaysia dengan syarat-syarat kegunaan seperti berikut : 1. Tesis adalah hak milik Universiti Teknologi Malaysia. 2. Perpustakaan Universiti Teknologi Malaysia dibenarkan membuat salinan untuk tujuan pengajian sahaja. 3. Perpustakaan dibenarkan membuat salinan tesis ini sebagai bahan pertukaran di antara institusi pengajian tinggi. 4. ** Sila tandakan (9 ) (Mengandungi maklumat yang berdarjah keselamatan atau SULIT kepentingan Malaysia seperti yang termaktub di dalam AKTA RAHSIA RASMI 1972) TERHAD (Mengandungi maklumat TERHAD yang telah ditentukan oleh organisasi/badan di mana penyelidikan dijalankan) TIDAK TERHAD Disahkan oleh (TANDATANGAN PENULIS) (TANDATANGAN PENYELIA) Alamat Tetap: 53, Jln Ronggeng 26, Prof. Madya Dr. Ab Rahman Ahmad Tmn Nesa, 81300 Skudai Nama Penyelia Johor Bahru, Johor.______ Tarikh: 31 Oktober 2005 Tarikh: 31 Oktober 2005 CATATAN : * Potong yang tidak berkenaan. ** Jika tesis ini SULIT atau TERHAD, sila lampirkan surat daripada pihak berkuasa/ organisasi berkenaan dengan menyatakan sekali sebab dan tempoh tesis ini perlu dikelaskan sebagai SULIT atau TERHAD.
    [Show full text]
  • CBD Fifth National Report
    Government of Malaysia Ministry of Natural Resources and Environment Fifth National Report to the Convention on Biological Diversity The Fifth National Report to CBD was prepared with the support from the ‘National Biodiversity Planning to Support the Implementation of the CBD 2011-2020 Strategic Plan in Malaysia’ project implemented by the Ministry of Natural Resources and Environment supported by UNDP and financed by GEF. 2014 th 1 Malaysia’s 5 National Report to CBD 5TH REPORT TO CONVENTION ON BIOLOGICAL DIVERSITY This report is prepared by the Ministry of Natural Resources and Environment, Malaysia in accordance Article 26 of the Convention and decision X/10 of the Conference of the Parties of Convention on Biological Diversity (CBD). For further information, please contact: Biodiversity and Forestry Management Division Ministry of Natural Resources and Environment of Malaysia Level 12, Wisma Sumber Asli Federal Government Administrative Center Precinct 4, 62574 Putrajaya Malaysia www.nre.gov.my The MyBioD logo which was launched by the Ministry of Natural Resources and Environment in 2012. This logo serves as a vehicle to brand Malaysia’s rich biodiversity and to internalise the appreciation for this natural heritage with the view of generating awareness in line with the 1st Aichi Biodiversity Target. th 2 Malaysia’s 5 National Report to CBD Abbreviations ABS - Access and Benefit Sharing CBD - United Nations Convention on Biological Diversity CFS - Central Forest Spine DMPM - Department of Marine Park Malaysia DOA - Department of
    [Show full text]
  • Suburban Broadband (Subb)
    NON-CONFIDENTIAL SUMMARIES OF THE APPROVED UNIVERSAL SERVICE PLANS SURUHANJAYA KOMUNIKASI DAN MULTIMEDIA MALAYSIA (MALAYSIAN COMMUNICATIONS AND MULTIMEDIA COMMISSION) USP REGISTER 30 JUNE 2019 FIXED BROADBAND EXPANSION - SUBURBAN BROADBAND (SUBB) No. State Parliament UST Cabinet Name Address Tanjong Bersebelahan Jalan Jalan Ing Chong Sam, Yong 1 Johor Ayer Hitam Sembrong Ing Chong Sam Peng Tanjong 2 Johor Ayer Hitam Taman Berlian Taman Berlian, Yong Peng Sembrong Tanjong 3 Johor Ayer Hitam Taman Berlian Taman Berlian, Yong Peng Sembrong Chaah Balai Pemeriksa 4 Johor Ayer Hitam Yong Peng Bahru Jabatan Hutan Chaah 5 Johor Ayer Hitam Taman Desa Taman Desa, Yong Peng Bahru Tanjong 6 Johor Ayer Hitam Taman Selatan 1 Taman Selatan, Yong Peng Sembrong Tanjong 7 Johor Ayer Hitam Taman Selatan 2 Taman Selatan, Yong Peng Sembrong Tanjong 8 Johor Ayer Hitam Taman Selatan 3 Taman Selatan, Yong Peng Sembrong Tanjong 9 Johor Ayer Hitam Kg. Parit Awang Kg. Parit Awang, Yong Peng Sembrong Tanjong 10 Johor Ayer Hitam Taman Bahagia Taman Bahagia, Yong Peng Sembrong Tanjong Taman Sri Aman, Yong 11 Johor Ayer Hitam Taman Sri Aman 1 Sembrong Peng Tanjong Taman Sri Aman, Yong 12 Johor Ayer Hitam Taman Sri Aman 2 Sembrong Peng Tanjong Taman Semberong, Yong 13 Johor Ayer Hitam Taman Semberong Sembrong Peng Tanjong Taman Sembrong, Yong 14 Johor Ayer Hitam Taman Sembrong 1 Sembrong Peng Tanjong Taman Sembrong, Yong 15 Johor Ayer Hitam Taman Sembrong 2 Sembrong Peng Tanjong Taman Sembrong Taman Sembrong Baru, 16 Johor Ayer Hitam Sembrong Baru Yong Peng Tanjong Taman Sembrong Taman Sembrong Baru, 17 Johor Ayer Hitam Sembrong Baru 1 Yong Peng Tanjong Taman Sembrong Taman Sembrong Baru, 18 Johor Ayer Hitam Sembrong Baru 2 Yong Peng Tanjong 19 Johor Ayer Hitam Taman Mewah Taman Mewah, Yong Peng Sembrong Chaah 20 Johor Ayer Hitam Ladang Union Jalan Labis, Yong Peng Bahru Tanjong 21 Johor Ayer Hitam Taman Kota 1 Taman Kota, Yong Peng Sembrong No.
    [Show full text]
  • Ecer Master Plan 2.0 the Next Leap 2018-2025
    ECER MASTER PLAN 2.0 THE NEXT LEAP 2018-2025 KEY TARGETS RM70 BilLion 120,000 60,000 New Private Job New Investments Opportunities Entrepreneurs Continuing Transformation, Prosperity FOR Rakyat The rakyat has always been at the heart of the East Coast Economic Region (ECER)’s development agenda since its establishment over a decade ago. In continuing the socio-economic transformation of the Region, the ECER Master Plan 2.0 (2018-2025) has been outlined by taking into account the rakyat’s wellbeing to ensure ECER’s continuous growth and its readiness to face the anticipated challenges and future developments. The implementation of ECER Master Plan 2.0 will also bring new hope to the rakyat with the creation of jobs and entrepreneurship opportunities generated by private investments in the Region. A DECADE OF TRANSFORMATION IN THE LIVES OF THE RAKYAT (2008-2017) Since 2008, the East Coast Economic Region Development Council (ECERDC) has laid a strong foundation in developing the 2008-2017 Achievements socio-economic landscape of ECER, guided by the ECER Master For more information: Plan 1.0 (2008-2017),www.ecerdc.com.my by attracting private investments that have RM111.6 billion generated new job opportunities, and implementing various Committed Private Investments high-impact projects and human capital development programmes with the ultimate aim of enhancing the rakyat’s well-being. Among the strategic projects implemented under ECER Master 149,400 Plan 1.0 are the Kuantan Port expansion, the development of Job Opportunities thematic industrial parks, enhancements of water supply system, as well as human capital development programmes such as empower ECER, entrepreneur ECER and ECER Talent 31,700 Entrepreneurs/Business Enhancement Programme (ETEP), which have been successful in Opportunities transforming the lives of the target groups, especially the B40 households, youths and the Orang Asli.
    [Show full text]
  • JOHOR Map & Guide March 2019 NEW
    12345 6 12345 RAF Point Kampung Kampung Lukut Homestay P To s To To To Kempas Aman Kampung n To Ulu Tiram Taman District of Yayasan L Bandar Tenggara & Dato Onn a Bandar Tenggara & Pelajaran Johor r Suria Kota Tinggi Waterfalls k Jaafar i JOHOR 1°30'N KLUANG J Larkin Jaya n a Taman Kluang Kluang a Kota Tinggi Waterfall Resort k Taman Kota Rainforest Resort n Ta u P l Bandar Sri ala r Majidee a J J e Johor Bahru Felda Inas J a a Dato Onn J n l Tmn Larkin r a Institut Penyelidikan la Perani Johor a d n a l n Southern Johor n Perdana a Getah Malaysia Craft h K i a n J s D a Kg Felda o (IPGM) L Complex a Kampung l o a K w a t t KOHO Hotel m i Larkin Jaya a n u Map & Guide Bukit Besar a a n Plaza Larkin Jal r a Larkin n r SouthKey / m e n N T b L D Larkin Tmn u H d a o in o a i r g Indah t Stadium a Kota SouthKey t gi g n H a n Polyclinic Perbadanan Wisma h – K uan n o l – To Mersing, J w g l e a ' s Felda i da g K K Kam i l S Kota m C a eru Larkin Islam o S k a d n G u a Plaza J Sedili Inn Resort a a a n th Bukit Easter O a To Permas Jaya To Tinggi P h n s In Larkin Indah a Tmn Taman 1.
    [Show full text]