Supplementary Information

Supplementary information

Supplementary Discussion

Radiation therapy is one of the key modalities in the management of HNSCC. As of today about 75% of patients with HNSCC are treated with radiotherapy alone or in adjuvant setting after surgery (1). Nevertheless, only few biological parameters have been identified so far as potent prognostic biomarkers for radiotherapy outcome and as potential targets for personalized treatment approaches of radiotherapy combined with targeted drugs. Markers for radiosensitivity include HPV positivity, which has been associated with improved survival and loco-regional control (2-4). On the other hand, tumor volume, the number and intrinsic radioresistance of CSC as well as tumor hypoxia and repopulation were shown to be associated with tumor radioresistance (2, 5-

12) . The tumor growth is maintained by a population of CSC which have unlimited self- renewal potential and cause tumor recurrence if not eradicated by treatment. The number of CSC is a promising biomarker for local tumor control especially for the primary RCTx setting when the number of CSC correlates with primary tumor volumes

(8, 9).

The tumor suppressor p53 is a key regulator of energy metabolism (13).

Mutations in p53 are ubiquitous in HPV negative HNSCC (14). Cal33 HNSCC cells, which were used for the SLC3A2 gene knockout, harbour a p53R175H mutation, which has oncogenic functions and promotes tumor progression (15). A recent study showed that inducible expression of p53R175H in tumor cells increases mitochondrial oxygen consumption and cell proliferation as well as decreasing intracellular ROS levels (16).

Interestingly, previous studies demonstrated that the p53R175H mutation prevents cell

1 cycle arrest and apoptosis by attenuation of the expression of stress related gene ATF3

(17, 18). Inhibition of the CD98hc-mediated amino acid transport in maKO cells resulted in suppression of the basal mitochondrial respiration, lowering cell proliferation rate and upregulation of the wild-type p53-dependent signalling including upregulation of stress related gene ATF3. Of note, expression level of ATF3 gene was found to be downregulated in HNSCC radioresistant cell lines suggesting that activation of cellular stress can be a strategy for HNSCC radiosensitization.

Previous studies in HeLa and MCF7 cells have shown that CD98hc is required for amino acid exchange, activation of mTOR signalling pathway and cell growth (19).

Amino acid transport mediated by CD98hc supplies the substrates to the Krebs cycle to sustain mitochondrial metabolism (20). Indeed, we found that CD98hc maKO cells exhibit a low level of mTOR activation, decreased levels of Krebs cycle intermediates as a source of energy and biosynthesis and, as a result, a downregulated proliferation rate.

Supplementary methods

Tissue sections and haematoxylin & eosin staining

Before immunohistochemistry, all FFPE specimens were subjected to haematoxylin & eosin staining in order to confirm the presence of squamous cell carcinoma. For CD98hs staining, tumor tissues of the total cohort including 197 patients were available. The LAT1 staining was performed on tissue specimens of the patients of the monocentric Dresden cohort.

Immunohistochemical staining of CD98hc

Following deparaffinization and antigen retrieval (antigen retrieval buffer pH6

(DAKO, Glostrup, DK)) for 28 min at 630 W, endogenous peroxidase activity was blocked (Peroxidase block, DAKO) for 10 min. Sections were then incubated with normal blocking serum (rabbit anti-goat serum) for 10 min to prevent unspecific binding of the secondary antibody followed by incubation with the polyclonal goat anti-human

CD98 antibody (dilution 1:2500; Santa Cruz Biotechnology, Dallas, US; sc-7095). For negative controls, the corresponding IgG antibody was used. The staining was visualized by DAB immunostaining (Vectastain; Vector laboratories, Burlingame, US).

Semiquantitative analyses of blinded samples were performed by two independent observers (D.D. and A.L.) with an interobserver variability <5%. Staining was evaluated both for percentage of positive stained tumor cells (≥10%) and for intensity (0, + vs ++,

+++). For immunohistochemistry analysis, the respective isotype control was included to ensure specificity of the staining.

During preparation of this manuscript, goat polyclonal anti-CD98 antibody from

Santa Cruz Biotechnology (C-20, sc-7095) has been discontinued and replaced by mouse monoclonal antibody (E-5, sc-376815). We compared both antibodies by the immunochistochemical staining of HNSCC specimens and achieved comparable staining (Figure S 8 B).

Immunohistochemical staining of LAT1

Following deparaffinization and antigen retrieval (antigen retrieval buffer pH9

(DAKO, Glostrup, DK) for 28 min at 630 W, endogenous peroxidase activity was blocked (Peroxidase block, DAKO) for 10 min. This was followed by incubation with the monoclonal rabbit anti-human LAT1 antibody (dilution 1:5000; Abcam, Cambridge, UK;

EPR17573). For negative controls, the corresponding IgG antibody was used. The staining was visualized by DAB immunostaining (Dako REAL EnVision Detection

System, Peroxidase/DAB, rabbit/mouse). Semiquantitative analyses of blinded samples were performed by two independent observers (D.D. and A.L.) with an interobserver variability <5%. Staining was evaluated both, for percentage of positive stained tumor cells (≥10%) and for intensity (0,+ vs ++,+++). For immunohistochemistry analysis, the respective isotype control was included to ensure specificity of the staining (Figure S 8

C).

Clonogenic cell survival assay

Clonogenic cell survival assay was performed as described previously (11, 12).

Cells were counted via Casy® Cell Counter TCC and plated in triplicates at a density of

500-2000 cells/well depending on the cell line. Assays were performed either in the regular two-dimensional (2-D) culture conditions in 6-well plates or in 3-D conditions when cells were embedded in Matrigel (BD Biosciences, GE) and plated in triplicates in ultra-low attachment plates (Corning, BE). Eighteen hours after cell plating cells were irradiated with doses of 2, 4, 6 and 8 Gy of 200 kV X-rays (Yxlon Y.TU 320; 200 kV X- rays, dose rate 1.3Gy/min at 20 mA) filtered with 0.5 mm Cu. The absorbed dose was measured using a Duplex dosimeter (PTW). After 10-14 days of culturing, the colonies were fixed with 10% formaldehyde (VWR International, GE) and stained with 0.05% crystal violet (Sigma-Aldrich, GE). Colonies containing more than 50 cells were counted using a stereo microscope (Zeiss, GE). Plating efficacies (PE = counted colonies/seeded cells x 100) and surviving fractions (SF = counted colonies/(seeded cells xPE) x 100) were calculated.

Microarray analysis of the HNSCC cancer cell lines

Gene expression profiling of the Cal33 WT1, Cal33 WT2, Cal33 maKO1, Cal33 maKO2 cells was performed using SurePrint G3 Human Gene Expression 8x60K v3

Microarray Kit (Design ID 039494, Agilent Technologies) according to manufacturer's recommendations as described previously (11). Briefly, cells were irradiated with 4Gy of

X-rays or sham irradiated and collected 24 h after irradiation. Total RNA was isolated from cell pellets using the RNeasy kit (Qiagen, Valencia, CA, USA). Sample preparation for analysis was carried out according to the protocol detailed by Agilent Technologies

(Santa Clara, CA, USA). Arrays were processed using standard Agilent protocols.

Probe values from image files were obtained using Agilent Feature Extraction Software.

The dataset was analysed using SUMO software package: http://angiogenesis.dkfz.de/oncoexpress/software/sumo/. Data deposition: all data is

MIAME compliant. The raw data has been deposited in the Gene Expression Omnibus

(GEO) database, accession no GSE116162.

CRISPR/Cas9 mediated gene editing

Due to alternative splicing the SLC3A2 gene encodes multiple isoforms of

CD98hc whose translation is initiated from different exons. Therefore it was not possible to completely knockout SLC3A2 via single indel mutation upon CRISPR/Cas9 gene editing and we decided to delete the whole gene by targeting simultaneously two sequences, upstream and downstream of the gene. In order to delete the whole

SLC3A2 gene two sgRNAs were designed using Cas-Designer online tool http://www.rgenome.net/cas-designer/. First, sgRNA with targeting position upstream of

SLC3A2 had sequence GT TGT GGG TAG AGA GTT CCA and was cloned into

5 pCasHF-EGFP vector. Second sgRNA with targeting position downstream of SLC3A2 had sequence GG ACC CTA CAT AAA TAA TGA and was cloned into pCasHF- mCherry vector. Prior to that pCasHF-EGFP and pCasHF-mCherry were generated from pSpCas9(BB)-2A-GFP ( gift from Feng Zhang, Addgene plasmid # 48138) and pU6-(BbsI)_CBh-Cas9-T2A-mCherry (gift from Ralf Kuehn, Addgene plasmid # 64324) correspondingly via replacing original Cas9 by its high fidelity version Cas9-HF1 (gift from Aliona Bogdanova, Max Planck Institute of Molecular Cell Biology and Genetics).

Cal33 RR cells were co-transfected with both sgRNA constructs using DOTAP:DOPE

(1:1) cationic liposomes and EGFP/mCherry double positive population was sorted after

48 h into 96-well plates at one cell/well density. Obtained clones were PCR-screened for presence of SLC3A2 deletion and validated via sequencing of regions adjacent to targeted positions. Promising clones were further checked for absence of both Cas9 integration and off-target effects predicted using CCTop online tool http://crispr.cos.uni- heidelberg.de/ (3 off-targets with highest score were checked).

siRNA-mediated knockdown

For knockdown of SLC3A2, LAT1 and ATG5 expression, cells were transfected with RNAiMAX (Life Technologies GmbH, GE) according to the manufacturer's protocol.

The siRNA target sequences were obtained from the Life Technologies website and corresponding RNA duplexes were synthesized by Eurofins. The siRNA sequences are listed in supplementary Table 6.

Western Blot

Antibodies used for Western blot analysis are listed in supplementary Table 8.

During preparation of this manuscript, goat polyclonal anti-CD98 antibody from Santa

Cruz Biotechnology (C-20, sc-7095) has been discontinued and replaced by mouse monoclonal antibody (E-5, sc-376815). We compared both antibodies in Western blot analyses, which showed very similar band pattern and intensity (Figure S 8 B). We also found high Pearson correlation coefficients between the mean CD98hc protein levels in

HNSCC cell lines analysed by C-20 and E-5 antibodies as well as between the mean

CD98hc protein levels analysed by these antibodies and TCD50 values for HNSCC xenograft tumors (Figure S 8 BD).

PCR

The cDNA synthesis was carried outwith SuperScript II Revertase (Invitrogen,

GE). PCR was performed with GoTaq G2 Flexi DNA polymerase (Promega, GE).

Primers used for PCR analysis are listed in supplementary Table 6.

Immunofluorescence microscopy

Immunofluorescence analysis was performed as described previously(11, 12,

21). Briefly, cells were plated 24 after siRNA transfection in EZ slide chambers (Merck

Millipore, GE) at a density of 50×103 cells/well in corresponding medium containing 10% serum. For immunofluorescence analysis, cells were fixed for 30 min with 3.7% formaldehyde at room temperature and permeabilized with 0.125% Triton X-100 for 10 min, washed with PBS, and blocked by incubation with 10% BSA in PBS with 0.25%

Triton X-100 (PBS-T). The slides were then incubated for 12 h at 4oC with primary antibody for CD98hc (Santa Cruz Biotechnology, USA, #59145), LAT1 (Cell Signaling

Technology, USA, #5347), phospho-histone H2AX (S139) (Merk Millipore, GE) diluted in 3% BSA/ PBS-T as 1/200, 1/200 or 1/400, correspondingly and washed with PBS.

Cells were then incubated for 1 h with the secondary antibody conjugated with Alexa

Fluor 488 or 555 (Invitrogen, GE) diluted 1/500 in 3% BSA/PBS-T. After washing with

PBS, the cells were stained with DAPI (4′,6-diamidino-2-phenylindole) and analyzed by fluorescent microscopy. Images were taken with Leica Microscope (Leica – DM5000).

For quantification, up to 200 cells per condition in at least three randomly selected fields were counted. Intracellular co-localization of CD98hc and LAT1 proteins and number of

γH2AX foci were evaluated using ImageJ software. Colocalization analysis was performed using Fiji software plugin Coloc 2.

Caspase 3/7 activity assay

Cells were plated in 96 well plates at a density of 20×103 cells/well. Bafilomycin

A1 was added to the cells at the different concentrations 24h after plating. Caspase 3/7 activity was analysed 24h after start of treatment by the Caspase-Glo® 3/7 assay

(Promega, GE). In parallel, cell viability was measured by using Cell Titer Glo assay

(Promega, GE) according to the manufacturer’s recommendations. Caspase 3/7 activity was then normalized to the cell viability.

Analysis of ROS and GSH/GSSG levels

To measure the level of reactive oxygen species (ROS) cells were incubated with

0.1 μM 5-(and-6)-carboxy-2',7'-dichlorodihydrofluorescein diacetate acetyl ester,

CMH2DCFDA (Invitrogen, GE) for 15 min at 37°C. Samples were analyzed with flow cytometer Canto II (BD Biosciences, GE). Data were analyzed using FlowJo software

(version 7.6.2) and gates were set according to the individual controls. Measurement of reduced to oxidized glutathione ratio (GSH/GSSG) has been performed with luciferase- based GSH/GSSG-Glo™ kit (Promega, GE) according to manufacturer’s instructions.

Cytometry analysis of autophagy activation

Cells were plated in a 96 well black clear bottom plates (Corning, BE) at a density of 3×104 cells/well in media containing 10% serum. The level of autophagy was measured by using Cell Meter™ Autophagy Fluorescence Imaging Kit (Biomol, GE) using AutophagyGreen™ according to manufacturer’s instructions. Cells were analysed by Celigo cytometer.

Cell proliferation and cytotoxic activity

Cell proliferation and cytotoxicity was analyzed using the Cell Titer Glow luminescent cell viability assay (Sigma-Aldrich, GE). A total of 5×103 cells/well were seeded into 96-well plates and luminescence levels were analyzed after 1–3 days using a microplate reader (Tecan) according to manufacturer’s instructions.

Differential centrifugation method

The parental and radioresistant HNSCC cell lines of Cal33 and FaDu were seeded in two 25cm dishes each and grown until sub-confluent (80%). The cells were collected by scraping in 5 ml of ice-cold PBS, centrifuged at 1000 rpm/3min/4°C, the supernatant was aspirated, and the pellet was resuspended in 3ml Homogenization buffer (250mM sucrose, 10mM HEPES, 1mM EDTA (Sigma-Aldrich, GE), protease inhibitors cocktail (Roche, GE) in dH2O). Further, the cell suspension was centrifuged again at 1000 rpm/3min/4°C, the supernatant was again removed, and the pellet was resuspended in 750 μl Homogenization buffer and transferred to 1.5ml tube. With a prefilled 1ml syringe/G22 needle the suspension was homogenized with 5 passes, working slowly to avoid bubbles. Homogenized cell suspension was centrifuged at 7000 rpm/10min/4°C, the supernatant was transferred to a new tube and subjected again to centrifugation at 10000 rpm/10min/4°C. The obtained supernatant was transferred to an

9 ultracentrifuge tube and centrifuged at 47000 rpm/20min/4°C. The obtained pellets were resuspended in a fresh volume of 750μl of Homogenization buffer and ultracentrifuged again at 47000 rpm/20min/4°C. After collecting the pellets, they were resuspended in

750μl of 100mM Na2CO3 with pH 11, and rotated for 30 min/4°C on an end-over-end shaker. The solution was transferred to new ultracentrifuge tubes and spun at 80000 rpm/1h/4°C. The final pellet was dissolved in 40 μl 0.5% SDC in 50mM TEAB (pH 7.5-

8), heated at 95°C for 5 min and ultrasonicated for 5 min. From the final solution, small aliquots were used for protein quantification using BCA assay and qualitative analysis by western blot assay. 20-30 μl of the final protein solution was subjected to proteomic analysis.

Protein Identification by LC-MS/MS

In-gel tryptic digestion was performed post reduction with DTE and S- carbamidomethylation with iodoacetamide. Resulting peptides were analysed by label free LC-MS/MS over a 125 min gradient using a Waters nanoAcquity UPLC interfaced to a Bruker maXis HD mass spectrometer as detailed in (22, 23). Protein identification was performed by searching tandem mass spectra against the human subset of the

Uniprot database (20,259 sequences; 11,329,622 residues) using the Mascot search program. Matches were passed through Mascot percolator to achieve a false discovery rate of <1% and further filtered to accept only peptides with expect scores of 0.05 or better. Molar percentages were calculated from Mascot emPAI values by expressing individual values as a percentage of the sum of all emPAI values in the sample (22, 23).

Seahorse XF cell energy phenotype analysis

WT1 and maKO1 cells were seeded in triplicates in two separate Seahorse XFp miniplates (seeding surface of 0.106 cm2) at a confluence of 2 x 104 cells per well, following the manufacturer’s instructions. 24 hours later, one miniplate was irradiated with 4 Gy of X-rays, and the other miniplate was used as control without the application of irradiation. Both miniplates were incubated at 37°C in a CO2 incubator overnight.

Further, two Seahorse XFp sensor cartridges where hydrated at 37°C with Seahorse XF calibrant in a non-CO2 incubator overnight. 18 hours after the irradiation, the cells were washed in Seahorse XF Base Medium (supplemented with 1 mM pyruvate, 2 mM glutamine and 10 mM glucose; pH 7.4), finally filled with 180 ul medium per well and put in a 37°C non-CO2 incubator for 1 hour. Oligomycin and FCCP from the “Seahorse XFp cell energy phenotype Test Kit” were reconstituted with the supplemented Seahorse XF

Base Medium and then mixed to obtain 1 μM FCCP as final concentration. The energy phenotype test was then run by using a Seahorse XFp Analyzer. Data were then normalized to the initial number of cells seeded and baseline, stressed phenotype and metabolic potential were calculated by using the “Seahorse XF cell energy phenotype test report generator”.

Mass spectrometric measurements of central carbon metabolites

Cell cultures were washed four times with PBS and metabolites were extracted using ice-cold methanol. After centrifugation, the supernatants were dried using a speed vac concentrator (Thermo Scientific, GE). Before analysis, metabolites were resuspended in mobile phase and quantified by ultra-high pressure liquid chromatography-tandem mass spectrometry (LC-MS/MS) as described previously (24).

Values were normalized to cell number.

TCGA dataset analysis

For correlation analysis a dataset of 528 cases for HNSCC from The Human

Cancer Genome Atlas (TCGA) were downloaded from cBioportal

(http://www.cbioportal.org/study?id=hnsc_tcga#summary). The data were processed following the TCGA policy. Expression heat maps were generated using SUMO software package: http://angiogenesis.dkfz.de/oncoexpress/software/sumo/

Analysis of the correlation of CD98hc expression and 11q13 amplification

To check if overexpression of CD98hc can serve as a surrogate marker for the amplification of chromosomal locus 11q13, we evaluated an association between 11q13 copy number alteration (CNA) and SLC3A2 mRNA expression levels in TCGA dataset for 519 HNSCC patients. To analyse possible structural changes in 11q13 chromosomal locus in the cell lines used for the functional radiobiological assays, we performed an assessment of eleven genes in the 11q13 region (i.e. TPCN2, MYEOV, CCND1,

ORAOV1, FGF4, TMEM16A, FADD, PPF1A1, CTTN, SHANK2 and DHCR7) by Q-PCR as described previously (25). The relative quantity (RQ) of 11q13 chromosomal locus was calculated as an average of relative quantity for genomic DNA of these eleven genes normalized to a housekeeping gene NAGK located on chromosome 2.

Suppplementary References

1. Gregoire V, Langendijk JA, Nuyts S. Advances in Radiotherapy for Head and Neck Cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015;33(29):3277-84. 2. Balermpas P, Rodel F, Rodel C, Krause M, Linge A, Lohaus F, et al. CD8+ tumour-infiltrating lymphocytes in relation to HPV status and clinical outcome in patients with head and neck cancer after postoperative chemoradiotherapy: A multicentre study of the German cancer consortium radiation oncology group (DKTK-ROG). International journal of cancer. 2016;138(1):171-81. 3. Lohaus F, Linge A, Baumann M. HPV and beyond-looking out for biomarkers for distinguishing the good prognosis from the bad prognosis group in locally advanced and clinically high risk HNSCC. Annals of translational medicine. 2015;3(17):255.

4. Lohaus F, Linge A, Tinhofer I, Budach V, Gkika E, Stuschke M, et al. HPV16 DNA status is a strong prognosticator of loco-regional control after postoperative radiochemotherapy of locally advanced oropharyngeal carcinoma: results from a multicentre explorative study of the German Cancer Consortium Radiation Oncology Group (DKTK-ROG). Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology. 2014;113(3):317-23. 5. de Jong MC, Pramana J, van der Wal JE, Lacko M, Peutz-Kootstra CJ, de Jong JM, et al. CD44 expression predicts local recurrence after radiotherapy in larynx cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2010;16(21):5329-38. 6. Krause M, Dubrovska A, Linge A, Baumann M. Cancer stem cells: Radioresistance, prediction of radiotherapy outcome and specific targets for combined treatments. Adv Drug Deliv Rev. 2017;109:63- 73. 7. Linge A, Lock S, Gudziol V, Nowak A, Lohaus F, von Neubeck C, et al. Low Cancer Stem Cell Marker Expression and Low Hypoxia Identify Good Prognosis Subgroups in HPV(-) HNSCC after Postoperative Radiochemotherapy: A Multicenter Study of the DKTK-ROG. Clinical cancer research : an official journal of the American Association for Cancer Research. 2016;22(11):2639-49. 8. Baumann M, Krause M. CD44: a cancer stem cell-related biomarker with predictive potential for radiotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2010;16(21):5091-3. 9. Baumann M, Krause M, Overgaard J, Debus J, Bentzen SM, Daartz J, et al. Radiation oncology in the era of precision medicine. Nat Rev Cancer. 2016;16(4):234-49. 10. Yaromina A, Krause M, Thames H, Rosner A, Krause M, Hessel F, et al. Pre-treatment number of clonogenic cells and their radiosensitivity are major determinants of local tumour control after fractionated irradiation. Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology. 2007;83(3):304-10. 11. Peitzsch C, Cojoc M, Hein L, Kurth I, Mabert K, Trautmann F, et al. An Epigenetic Reprogramming Strategy to Resensitize Radioresistant Prostate Cancer Cells. Cancer research. 2016;76(9):2637-51. 12. Cojoc M, Peitzsch C, Kurth I, Trautmann F, Kunz-Schughart LA, Telegeev GD, et al. Aldehyde Dehydrogenase Is Regulated by beta-Catenin/TCF and Promotes Radioresistance in Prostate Cancer Progenitor Cells. Cancer research. 2015;75(7):1482-94. 13. Maddocks OD, Vousden KH. Metabolic regulation by p53. J Mol Med (Berl). 2011;89(3):237-45. 14. Lawrence MS, Stojanov P, Mermel CH, Robinson JT, Garraway LA, Golub TR, et al. Discovery and saturation analysis of cancer genes across 21 tumour types. Nature. 2014;505(7484):495-501. 15. Iyer SV, Parrales A, Begani P, Narkar A, Adhikari AS, Martinez LA, et al. Allele-specific silencing of mutant p53 attenuates dominant-negative and gain-of-function activities. Oncotarget. 2016;7(5):5401- 15. 16. Eriksson M, Ambroise G, Ouchida AT, Lima Queiroz A, Smith D, Gimenez-Cassina A, et al. Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism. Mol Cell Biol. 2017;37(24). 17. Buganim Y, Kalo E, Brosh R, Besserglick H, Nachmany I, Rais Y, et al. Mutant p53 protects cells from 12-O-tetradecanoylphorbol-13-acetate-induced death by attenuating activating transcription factor 3 induction. Cancer research. 2006;66(22):10750-9. 18. Napolitano L, Scalise M, Galluccio M, Pochini L, Albanese LM, Indiveri C. LAT1 is the transport competent unit of the LAT1/CD98 heterodimeric amino acid transporter. The international journal of biochemistry & cell biology. 2015;67:25-33. 19. Nicklin P, Bergman P, Zhang B, Triantafellow E, Wang H, Nyfeler B, et al. Bidirectional transport of amino acids regulates mTOR and autophagy. Cell. 2009;136(3):521-34. 20. Corbet C, Feron O. Cancer cell metabolism and mitochondria: Nutrient plasticity for TCA cycle fueling. Biochim Biophys Acta. 2017;1868(1):7-15.

21. Kurth I, Hein L, Mabert K, Peitzsch C, Koi L, Cojoc M, et al. Cancer stem cell related markers of radioresistance in head and neck squamous cell carcinoma. Oncotarget. 2015;6(33):34494-509. 22. Ishihama Y, Oda Y, Tabata T, Sato T, Nagasu T, Rappsilber J, et al. Exponentially modified protein abundance index (emPAI) for estimation of absolute protein amount in proteomics by the number of sequenced peptides per protein. Molecular & cellular proteomics : MCP. 2005;4(9):1265-72. 23. Dowle AA, Wilson J, Thomas JR. Comparing the Diagnostic Classification Accuracy of iTRAQ, Peak-Area, Spectral-Counting, and emPAI Methods for Relative Quantification in Expression Proteomics. Journal of proteome research. 2016;15(10):3550-62. 24. Richter S, Gieldon L, Pang Y, Peitzsch M, Huynh T, Leton R, et al. Metabolome-guided genomics to identify pathogenic variants in isocitrate dehydrogenase, fumarate hydratase, and succinate dehydrogenase genes in pheochromocytoma and paraganglioma. Genet Med. 2018. 25. Sugahara K, Michikawa Y, Ishikawa K, Shoji Y, Iwakawa M, Shibahara T, et al. Combination effects of distinct cores in 11q13 amplification region on cervical lymph node metastasis of oral squamous cell carcinoma. Int J Oncol. 2011;39(4):761-9. 26. Zacharakis N, Chinnasamy H, Black M, Xu H, Lu YC, Zheng Z, et al. Immune recognition of somatic mutations leading to complete durable regression in metastatic breast cancer. Nat Med. 2018;24(6):724-30.

Supplementary tables:

Table S 1. Patient characteristics of both cohorts.

Table S 2. Univariable Cox regression of loco-regional control using all patients

(left) and only patients with HPV16 DNA negative tumors (right). HR = hazard ratio; 95%

CI = 95 percent confidence interval.

Table S 3. List of the proteins identified by LC-MS/MS

Table S 4. List of the proteins upregulated in Cal33 and FaDu radioresistant

(RR) versus parental (P) (in alphabetical order).

Table S 5. Cross table (with p-value of chi-squared test) of CD98hc intensity and

LAT1 intensity.

Table S 6. Multivariable Cox regression of loco-regional control. Multivariable

Cox regression of loco-regional control. In each model one LAT1 parameter was combined with N stage (0,1 vs 2,3), p16 status and the natural logarithm (ln) of tumor

14 volume. Only the result for the LAT1 parameter is reported. HR = hazard ratio; 95% CI =

95 percent confidence interval.

Table S 7. Clinical trials for the CD98hc-targeted treatment.

Table S 8. Primers, siRNA oligos and antibodies used in the study

Supplementary figures:

Figure S 1. CD98hc is a regulator of HNSCC radiosensitivity. (A) Western blot analysis of CD98hc expression at the different days after irradiation of Cal33 and

FaDu cells with 4Gy of X-rays. (B) Plating efficacy of HNSCC cells transfected with siRNAs for SLC3A2 (si1 and si2) or with scrambled siRNA (Scr) used as control; error bars = SD. (C) The results of 2D radiobiological clonogenic assay for SAS cells transfected with siRNA for SLC3A2 or with scrambled siRNA (Scr) used as control; error bars = SD.

Figure S 2. Characterization of the HNSCC cells Cal33 RR with and without mono-allelic knockout of SLC3A2 gene. (A) Schematic of CRISPR/Cas9 gene editing technology to achieve a stable knockout of CD98hc expression in Cal33 RR cell line

(see Materials and Methods for detail). The results of karyotyping analysis of Cal33 RR

WT1, Cal33 RR WT2, Cal33 RR maKO1 and Cal33 RR maKO2 cells. (B) The chromosomes of 50 metaphase spread were counted in each cell line. The cells WT2 and maKO2 showed a hyperdiploid karyotype (the most frequent karyotype is 49 and 48 chromosomes, correspondingly). The cell lines WT1 and maKO1 are near-tetraploid

(maKO1 cells have 93 chromosomes as most frequent karyotype with a range of 87-

97). The cell line WT1 could be classified as hypertetraploid (most frequent karyotype is

96 chromosomes with a range of 77-99). (C) Plating efficiency of WT1, WT2, maKO1 and maKO2 cells; error bars = SD. (D) Validation of the global gene expression data by

RT² Profiler™ PCR Array Human DNA Repair array (Qiagen); n = 2.

Figure S 3. Gene expression and metabolic analysis of WT1 and maKO1

Cal33 RR cells. (A) Gene expression analysis of WT1 and maKO1, which were sham irradiated or irradiated with 4Gy of X-rays cells revealed substantial differences in amino acid metabolism. Heat map represents genes involved in amino acid metabolism that were significantly up- or downregulated (>1.5 fold change, p value < 0.05). (B)

Seahorse XF cell energy phenotype analysis showed a significant decrease in the baseline oxygen consumption rate in maKO1 cells as compared to WT1 cells; error bars

= SEM. (C) Overview of biochemical reactions driven by the CD98-dependent amino acid transport. The intracellular concentration of the highlighted metabolites was measured in WT1 and maKO1 cells and is shown in Figure 4 EGH.

Figure S 4. Activation of stress response in HNSCC cells correlates with their relative radioresistance. (A) PCR analysis of the expression levels of ATF3 stress responsive transcription factor in SLC3A2 maKO and WT Cal33 RR cells. (B)

Gene expression analysis for ATF3 and other p53-regulated genes in maKO1 and WT1 cells. (C) GSEA enrichment analysis for the genes differently regulated in WT1 cells as compared with maKO1 cells. The “HALLMARK_P53_PATHWAY” gene set includes genes involved in the negative regulation of cell cycle and induction of apoptosis. maKO1 cells have shown positive correlation with the indicated phenotype. (D)

Ingenuity Pathway analysis of the signaling pathways upregulated in maKO1 cells compared to WT1 cells 24h after 4Gy of X-rays. (E) Gene expression analysis of ATF3

16 in FaDu and Cal33 parental (P) cells as compared with their radioresistant (RR) counterparts; A.U. – arbitrary units; error bars = SD. * - p-value < 0.05; n = 3.

Figure S 5. Expression of CD98hc and LAT1 in cell lines. (A) Western blot analysis of CD98hc and LAT1 expression in HNSCC cells, n ≥ 2. (B) Correlation of

CD98hc (SLC3A2) and LAT1 (SLC7A5) expression in HNSCC cell lines by gene expression analysis.

Figure S 6. Analysis of WT1 and maKO1 cells with inhibition of CD98 dependent amino acid transport, mTOR/PI3K signaling or autophagy. (A)

Clonogenic analysis of SLC3A2 maKO and WT cell lines transfected with SLC3A2 siRNA or SLC7A5 siRNA after different doses of X-rays radiation; error bars = SD. (B)

Plating efficiency of WT1 and maKO1 cells transfected with siRNAs (si) for SLC3A2

(CD98hc), SLC7A5 (LAT1) (si1 and si2) or with scrambled siRNA (Scr) used as control; error bars = SEM. (C) BEZ235, a PI3K/mTOR inhibitor, is more potent for the inhibition of viability of SLC3A2 maKO1 cells as compared with their WT1 counterparts. IC50 values were determined after 24 hours (n = 3) and 72 hours (n = 3) of treatment with the drug; error bars = SD. * - p-value < 0.05. (D) Plating efficiency of WT1 and maKO1 cells treated with mTOR/PI3K inhibitor BEZ235 for 72 h in reduced serum medium (complete

DMEM medium with 3% FBS); error bars = SEM.

Figure S 7. Autophagy process correlates with cell radioresistance as well as with HNSCC patients’ overall survival and is deregulated in CD98 deficient cells. (A) Gene expression analysis of WT1 and maKO1 revealed substantial differences in expression of genes involved in autophagy regulation. Heat map represents genes involved in the process of autophagy that were significantly up- or

17 downregulated (> 1.5 fold change, p value < 0.05) in WT1 versus maKO1 cells. (B)

Gene expression analysis for ATG5 in FaDu and Cal33 parental (P) cells as compared with their radioresistant (RR) counterparts; error bars = SD. (C) Low expression of

ATG5 correlated with longer overall survival in patients with HNSCC. The analysis is based on the provisional TCGA data set http://www.cbioportal.org/study?id=hnsc_tcga#summary. Data were analysed using

SUMO software package. (D) Plating efficiency of WT1 and maKO1 cells transfected with siRNAs for ATG5 (siRNA#1 and siRNA#2) or with scrambled siRNA (Scr siRNA) used as control; error bars = SEM. (E) Plating efficiency of WT1 and maKO1 cells treated with autophagy inhibitor Bafilomycin A1 for 2 h in complete DMEM medium; error bars = SEM. (F) Autophagy inhibitors, Bafilomycin A1 (BafA1) and Chloroquine

(CQ) are more potent for the reduction of viability of SLC3A2 maKO1 cells as compared with their WT1 counterparts. IC50 values were determined after 24 hours (n=3) of drug treatment; error bars = SD. * - p-value < 0.05. (G) Treatment with Bafilomycin A1

(BafA1) leads to activation of apoptosis with more pronounced effect in maKO1 cells.

Caspase 3/7 activity was analysed after 24 hours of drug treatment; error bars = SEM.

Figure S 8. Analysis of the CD98hc expression using different antibodies and correlation of CD98hc expression and 11q13 amplification. (A) Correlation analysis of 11q13 copy number alteration (CNA) and SLC3A2 mRNA expression levels in TCGA dataset for 519 HNSCC patients. (B) Pearson coefficients of correlation between TCD50 values for HNSCC xenograft tumors, mean CD98hc protein levels in corresponding cell lines analysed by C-20 and E-5 antibodies from Santa Cruz

Biotechnology and 11q13 locus relative quantity (Chr11RQ). For the correlations

18 highlighted in yellow, p < 0.05. (C) Immunochistochemical staining using C-20 (goat) and E-5 (mouse) antibodies from Santa Cruz biotechnology in two HNSCC specimens.

(D) Comparative analysis of both antibodies using western blotting.

Table S 1. Patient characteristics of both cohorts.

Combined cohorts DKTK cohort Monocentric cohort Variable of 197 % of 134 % of 63 % Gender Male 167 84.8 114 85.1 53 84.1 Female 30 15.2 20 14.9 10 15.9 Tumor localisation Oropharynx 88 44.7 69 51.5 19 30.2 Oral cavity 46 23.4 22 16.4 24 38.1 Hypopharynx 58 29.4 43 32.1 15 23.8 Larynx 5 2.5 0 0.0 5 7.9

T stage 1 2 1.0 0 0.0 2 3.2 2 23 11.7 16 11.9 7 11.1 3 39 19.8 29 21.6 10 15.9 4 133 67.5 89 66.4 44 69.8

N stage 0 31 15.7 22 16.4 9 14.3 1 9 4.6 5 3.7 4 6.3 2 143 72.6 100 74.6 43 68.3 3 14 7.1 7 5.2 7 11.1

Smoking No 21 10.7 15 11.2 6 9.5 Yes 175 88.8 119 88.8 56 88.9 Missing 1 0.5 0 0.0 1 1.6

Chemotherapy No 10 5.1 0 0.0 10 15.9 Yes 187 94.9 134 100.0 53 84.1 p16 status Negative 161 81.7 108 80.6 53 84.1 Positive 27 13.7 19 14.2 8 12.7 Missing 9 4.6 7 5.2 2 3.2

HPV16 DNA status Negative 175 88.8 118 88.1 57 90.5 Positive 20 10.2 15 11.2 5 7.9 Missing 2 1.0 1 0.7 1 1.6

Variable Median (Range) Median (Range) Median (Range) Age 57.0 (39.2-82.1) 58.0 (39.2-81.9) 55.5 (42.2-82.1) Volume Tumor (ccm) 28.3 (1.4-227.4) 27.0 (4.4-175.8) 38.8 (1.4-227.4) Dose (Gy) 72.0 (68.0-77.6) 72.0 (68.4-74.0) 70.6 (68.0-77.6)

Table S 2. Univariable Cox regression of loco-regional control using all patients (left) and only patients with HPV16 DNA negative tumors (right). HR = hazard ratio; 95% CI = 95 percent confidence interval.

All patients HPV16 DNA negative Variable HR (95% CI) p-value HR (95% CI) p-value N stage 0,1 vs 2,3 1.70 (0.94-3.07) 0.080 1.75 (0.96-3.17) 0.066 Others vs oropharynx 1.04 (0.68-1.59) 0.86 1.17 (0.75-1.83) 0.49 Others vs hypopharynx 0.81 (0.50-1.31) 0.39 0.76 (0.47-1.24) 0.27 Ln tumor volume (cm3) 1.42 (1.08-1.87) 0.011 1.38 (1.05-1.81) 0.020 p16 status 0.60 (0.29-1.25) 0.17 - HPV16 DNA status 0.34 (0.12-0.93) 0.035 - CD98hc intensity > 1 3.02 (1.51-6.04) 0.002 2.95 (1.28-6.79) 0.011 CD98hc positivity ≥ 10% 3.49 (1.61-7.57) 0.002 2.99 (1.21-7.41) 0.018 LAT1 intensity > 1 7.55 (1.03-55.5) 0.047 * LAT1 positivity ≥ 10% 2.93 (0.89-9.65) 0.077 2.44 (0.58-10.3) 0.22

* no events, Cox model did not converge

Table S 3. List of the proteins identified by LC-MS/MS Rel Rel Rel Rel Mol Mol Mol Mol %, %, %, %, Cal33 Cal33 FaDu FaDu Protein P RR P RR 4F2 cell-surface antigen heavy chain OS=Homo sapiens GN=SLC3A2 PE=1 SV=3 - P08195 15.0 28.4 21.0 35.5 Ras GTPase-activating-like protein IQGAP1 OS=Homo sapiens GN=IQGAP1 PE=1 SV=1 - P46940 11.3 7.5 32.8 48.5 Myosin-9 OS=Homo sapiens GN=MYH9 PE=1 SV=4 - P35579 20.8 9.3 29.1 40.9 78 kDa glucose-regulated protein OS=Homo sapiens GN=HSPA5 PE=1 SV=2 - P11021 18.3 20.9 35.2 25.6 Endoplasmin OS=Homo sapiens GN=HSP90B1 PE=1 SV=1 - P14625 13.5 24.9 29.8 31.8 Transferrin receptor protein 1 OS=Homo sapiens GN=TFRC PE=1 SV=2 - P02786 7.0 23.8 34.7 34.5 Protein disulfide-isomerase OS=Homo sapiens GN=P4HB PE=1 SV=3 - P07237 12.2 12.8 47.3 27.8 Sodium/potassium-transporting ATPase subunit alpha-1 OS=Homo sapiens GN=ATP1A1 PE=1 SV=1 - P05023 23.3 31.4 18.2 27.0 Neuroblast differentiation-associated protein AHNAK OS=Homo sapiens GN=AHNAK PE=1 SV=2 - Q09666 35.0 13.2 21.3 30.5 Protein disulfide-isomerase A3 OS=Homo sapiens GN=PDIA3 PE=1 SV=4 - P30101 18.2 16.4 33.6 31.8 Annexin A2 OS=Homo sapiens GN=ANXA2 PE=1 SV=2 - P07355 31.7 6.2 32.9 29.2 Calnexin OS=Homo sapiens GN=CANX PE=1 SV=2 - P27824 13.0 35.6 23.9 27.5 Alpha-actinin-4 OS=Homo sapiens GN=ACTN4 PE=1 SV=2 - O43707 16.1 0.0 43.3 40.7 Serpin H1 OS=Homo sapiens GN=SERPINH1 PE=1 SV=2 - P50454 20.4 20.6 24.9 34.1 Catenin alpha-1 OS=Homo sapiens GN=CTNNA1 PE=1 SV=1 - P35221 21.9 26.1 24.2 27.8 Neutral alpha-glucosidase AB OS=Homo sapiens GN=GANAB PE=1 SV=3 - Q14697 18.6 24.0 25.5 31.9 Protein disulfide-isomerase A4 OS=Homo sapiens GN=PDIA4 PE=1 SV=2 - P13667 10.9 12.0 45.7 31.4 Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 - P12814 0.0 11.0 38.3 50.7 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 OS=Homo sapiens GN=RPN1 PE=1 SV=1 - P04843 10.1 42.6 27.9 19.5 HLA class I histocompatibility antigen, B-7 alpha chain OS=Homo sapiens GN=HLA-B PE=1 SV=3 - P01889 0.0 0.0 0.0 100.0 Plectin OS=Homo sapiens GN=PLEC PE=1 SV=3 - Q15149 44.6 11.1 13.4 30.8 Protein disulfide-isomerase A6 OS=Homo sapiens GN=PDIA6 PE=1 SV=1 - Q15084 14.7 25.2 32.4 27.7 Ras-related protein Rab-1B OS=Homo sapiens GN=RAB1B PE=1 SV=1 - Q9H0U4 13.9 19.9 30.8 35.3

Catenin beta-1 OS=Homo sapiens GN=CTNNB1 PE=1 SV=1 - P35222 12.8 16.7 18.4 52.1 Heat shock cognate 71 kDa protein OS=Homo sapiens GN=HSPA8 PE=1 SV=1 - P11142 24.4 25.2 33.5 16.9 Junction plakoglobin OS=Homo sapiens GN=JUP PE=1 SV=3 - P14923 35.5 11.8 26.1 26.6 Unconventional myosin-Ib OS=Homo sapiens GN=MYO1B PE=1 SV=3 - O43795 23.3 21.8 19.9 34.9 Calreticulin OS=Homo sapiens GN=CALR PE=1 SV=1 - P27797 31.6 13.1 29.2 26.1 Catenin delta-1 OS=Homo sapiens GN=CTNND1 PE=1 SV=1 - O60716 25.9 15.9 17.2 41.0 HLA class I histocompatibility antigen, A-1 alpha chain OS=Homo sapiens GN=HLA-A PE=1 SV=1 - P30443 0.0 0.0 51.5 48.5 Large neutral amino acids transporter small subunit 1 OS=Homo sapiens GN=SLC7A5 PE=1 SV=2 - Q01650 17.7 17.2 30.3 34.8 NADPH--cytochrome P450 reductase OS=Homo sapiens GN=POR PE=1 SV=2 - P16435 14.6 22.0 32.3 31.1 Ras-related protein Rab-7a OS=Homo sapiens GN=RAB7A PE=1 SV=1 - P51149 13.3 29.7 29.5 27.5 Epidermal growth factor receptor OS=Homo sapiens GN=EGFR PE=1 SV=2 - P00533 19.8 37.6 23.1 19.5 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 SV=6 - Q00839 16.0 37.0 19.0 28.0 Integrin alpha-3 OS=Homo sapiens GN=ITGA3 PE=1 SV=5 - P26006 5.9 28.5 27.9 37.7 Integrin beta-4 OS=Homo sapiens GN=ITGB4 PE=1 SV=5 - P16144 24.9 35.8 22.0 17.3 Neutral amino acid transporter B(0) OS=Homo sapiens GN=SLC1A5 PE=1 SV=2 - Q15758 18.0 25.2 26.5 30.4 Putative elongation factor 1-alpha-like 3 OS=Homo sapiens GN=EEF1A1P5 PE=5 SV=1 - Q5VTE0 24.8 25.8 30.9 18.4 60S ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=1 SV=2 - P62424 18.5 42.4 18.2 20.9 ATP-dependent RNA helicase DDX3X OS=Homo sapiens GN=DDX3X PE=1 SV=3 - O00571 22.8 17.0 19.9 40.3 Ephrin type-A receptor 2 OS=Homo sapiens GN=EPHA2 PE=1 SV=2 - P29317 0.0 0.0 46.6 53.4 Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK PE=1 SV=1 - P61978 16.4 27.7 22.4 33.6 Kinectin OS=Homo sapiens GN=KTN1 PE=1 SV=1 - Q86UP2 17.6 43.1 20.5 18.8 Myoferlin OS=Homo sapiens GN=MYOF PE=1 SV=1 - Q9NZM1 19.6 45.6 24.9 9.9 Peptidyl-prolyl cis-trans isomerase B OS=Homo sapiens GN=PPIB PE=1 SV=2 - P23284 11.7 14.0 34.6 39.7 Ras-related protein Rab-10 OS=Homo sapiens GN=RAB10 PE=1 SV=1 - P61026 18.1 21.8 39.9 20.2 Ras-related protein Rab-14 OS=Homo sapiens GN=RAB14 PE=1 SV=4 - P61106 18.5 16.6 30.2 34.7

Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 - Q01082 22.3 0.0 49.3 28.3 Tumor-associated calcium signal transducer 2 OS=Homo sapiens GN=TACSTD2 PE=1 SV=3 - P09758 21.9 21.1 26.5 30.4 Unconventional myosin-Ic OS=Homo sapiens GN=MYO1C PE=1 SV=4 - O00159 29.3 31.3 15.8 23.6 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 - Q02878 19.1 44.1 14.6 22.1 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 - P18124 31.2 27.5 22.1 19.2 Cadherin-1 OS=Homo sapiens GN=CDH1 PE=1 SV=3 - P12830 15.6 0.0 44.8 39.6 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 - Q00610 23.4 30.9 32.6 13.2 Desmoglein-2 OS=Homo sapiens GN=DSG2 PE=1 SV=2 - Q14126 16.3 37.5 24.6 21.7 DNA-dependent protein kinase catalytic subunit OS=Homo sapiens GN=PRKDC PE=1 SV=3 - P78527 26.1 54.4 11.5 7.9 Elongation factor 2 OS=Homo sapiens GN=EEF2 PE=1 SV=4 - P13639 23.1 32.9 20.4 23.5 Erythrocyte band 7 integral membrane protein OS=Homo sapiens GN=STOM PE=1 SV=3 - P27105 38.5 21.7 11.5 28.3 Extended synaptotagmin-1 OS=Homo sapiens GN=ESYT1 PE=1 SV=1 - Q9BSJ8 18.1 42.8 18.2 20.9 Ezrin OS=Homo sapiens GN=EZR PE=1 SV=4 - P15311 33.9 20.4 16.4 29.3 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 - P21333 30.1 0.0 42.2 27.7 Heat shock 70 kDa protein 1A/1B OS=Homo sapiens GN=HSPA1A PE=1 SV=5 - P08107 30.5 29.9 29.2 10.4 Heat shock protein HSP 90-beta OS=Homo sapiens GN=HSP90AB1 PE=1 SV=4 - P08238 28.9 0.0 40.3 30.8 Integrin beta-1 OS=Homo sapiens GN=ITGB1 PE=1 SV=2 - P05556 11.6 40.8 18.3 29.4 Neutral cholesterol ester hydrolase 1 OS=Homo sapiens GN=NCEH1 PE=1 SV=3 - Q6PIU2 14.4 12.5 10.1 63.0 Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PTBP1 PE=1 SV=1 - P26599 47.2 9.4 34.8 8.7 Pyruvate kinase PKM OS=Homo sapiens GN=PKM PE=1 SV=4 - P14618 19.1 9.0 33.5 38.4 Ras-related protein Rab-5C OS=Homo sapiens GN=RAB5C PE=1 SV=2 - P51148 8.5 33.5 27.0 31.0 Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 - P02768 4.8 29.3 23.7 42.2 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 - Q9BQE3 26.2 20.2 28.5 25.2 2'-5'-oligoadenylate synthase 3 OS=Homo sapiens GN=OAS3 PE=1 SV=3 - Q9Y6K5 11.1 38.2 15.4 35.3 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 - P23396 38.2 8.8 14.8 38.1 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 15.8 33.7 27.2 23.4

PE=1 SV=4 - P26373 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1 - P83731 23.9 20.0 26.1 30.0 60S ribosomal protein L4 OS=Homo sapiens GN=RPL4 PE=1 SV=5 - P36578 32.8 45.3 11.8 10.1 AP-2 complex subunit alpha-2 OS=Homo sapiens GN=AP2A2 PE=1 SV=2 - O94973 0.0 0.0 0.0 100.0 Basigin OS=Homo sapiens GN=BSG PE=1 SV=2 - P35613 15.1 14.7 41.2 29.1 Cathepsin D OS=Homo sapiens GN=CTSD PE=1 SV=1 - P07339 19.5 12.5 31.7 36.3 Elongation factor 1-gamma OS=Homo sapiens GN=EEF1G PE=1 SV=3 - P26641 27.9 29.4 15.4 27.2 Endoplasmic reticulum aminopeptidase 1 OS=Homo sapiens GN=ERAP1 PE=1 SV=3 - Q9NZ08 19.6 0.0 43.2 37.2 Integrin alpha-6 OS=Homo sapiens GN=ITGA6 PE=1 SV=5 - P23229 21.2 51.5 17.3 9.9 Junctional adhesion molecule A OS=Homo sapiens GN=F11R PE=1 SV=1 - Q9Y624 9.0 24.7 30.9 35.4 Lysosome-associated membrane glycoprotein 1 OS=Homo sapiens GN=LAMP1 PE=1 SV=3 - P11279 17.3 36.4 21.6 24.7 Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 PE=1 SV=2 - P11940 29.2 21.1 23.1 26.5 Polyubiquitin-B OS=Homo sapiens GN=UBB PE=1 SV=1 - P0CG47 17.9 22.0 28.0 32.1 Receptor-type tyrosine-protein phosphatase F OS=Homo sapiens GN=PTPRF PE=1 SV=2 - P10586 0.0 0.0 59.2 40.8 40S ribosomal protein S18 OS=Homo sapiens GN=RPS18 PE=1 SV=3 - P62269 48.4 18.9 15.2 17.5 40S ribosomal protein S7 OS=Homo sapiens GN=RPS7 PE=1 SV=1 - P62081 31.2 39.2 13.8 15.8 60S ribosomal protein L27a OS=Homo sapiens GN=RPL27A PE=1 SV=2 - P46776 21.6 16.2 29.0 33.2 AP-1 complex subunit beta-1 OS=Homo sapiens GN=AP1B1 PE=1 SV=2 - Q10567 23.6 21.6 34.8 20.0 ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 - Q08211 17.1 26.3 37.7 18.9 Basal cell adhesion molecule OS=Homo sapiens GN=BCAM PE=1 SV=2 - P50895 19.3 29.5 23.8 27.3 C-1-tetrahydrofolate synthase, cytoplasmic OS=Homo sapiens GN=MTHFD1 PE=1 SV=3 - P11586 26.6 13.6 22.0 37.8 Cadherin EGF LAG seven-pass G-type receptor 1 OS=Homo sapiens GN=CELSR1 PE=1 SV=1 - Q9NYQ6 14.1 19.2 31.1 35.6 CD44 antigen OS=Homo sapiens GN=CD44 PE=1 SV=3 - P16070 25.3 13.9 22.4 38.5 CD81 antigen OS=Homo sapiens GN=CD81 PE=1 SV=1 - P60033 11.8 32.3 26.0 29.9 Cofilin-1 OS=Homo sapiens GN=CFL1 PE=1 SV=3 - P23528 8.8 0.0 42.5 48.7 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit OS=Homo sapiens GN=DDOST PE=1 SV=4 - 17.5 26.8 30.8 24.8

P39656

Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2 OS=Homo sapiens GN=RPN2 PE=1 SV=3 - P04844 8.3 58.7 11.8 21.1 Filamin-B OS=Homo sapiens GN=FLNB PE=1 SV=2 - O75369 36.8 0.0 23.2 40.0 Fructose-bisphosphate aldolase A OS=Homo sapiens GN=ALDOA PE=1 SV=2 - P04075 27.0 33.0 26.6 13.4 Galectin-3-binding protein OS=Homo sapiens GN=LGALS3BP PE=1 SV=1 - Q08380 10.1 36.0 34.6 19.2 Glypican-1 OS=Homo sapiens GN=GPC1 PE=1 SV=2 - P35052 16.9 15.4 24.9 42.8 GTPase NRas OS=Homo sapiens GN=NRAS PE=1 SV=1 - P01111 5.0 13.8 37.8 43.4 Guanine nucleotide-binding protein G(k) subunit alpha OS=Homo sapiens GN=GNAI3 PE=1 SV=3 - P08754 20.4 0.0 45.1 34.5 Histone H4 OS=Homo sapiens GN=HIST1H4A PE=1 SV=2 - P62805 22.1 10.0 31.6 36.2 Long-chain-fatty-acid--CoA ligase 3 OS=Homo sapiens GN=ACSL3 PE=1 SV=3 - O95573 20.5 42.1 11.3 26.0 Peroxisomal multifunctional enzyme type 2 OS=Homo sapiens GN=HSD17B4 PE=1 SV=3 - P51659 33.4 27.5 22.2 16.9 Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens GN=DDX17 PE=1 SV=2 - Q92841 40.1 25.1 0.0 34.8 Ras GTPase-activating protein-binding protein 1 OS=Homo sapiens GN=G3BP1 PE=1 SV=1 - Q13283 40.6 16.2 13.1 30.1 Sodium/potassium-transporting ATPase subunit beta-3 OS=Homo sapiens GN=ATP1B3 PE=1 SV=1 - P54709 19.5 32.1 34.5 13.9 Staphylococcal nuclease domain-containing protein 1 OS=Homo sapiens GN=SND1 PE=1 SV=1 - Q7KZF4 20.3 12.9 31.1 35.7 T-complex protein 1 subunit alpha OS=Homo sapiens GN=TCP1 PE=1 SV=1 - P17987 11.9 16.2 41.9 30.0 T-complex protein 1 subunit zeta OS=Homo sapiens GN=CCT6A PE=1 SV=3 - P40227 37.2 0.0 17.8 45.0 Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 - P29401 26.2 15.1 27.4 31.4 Zinc finger CCCH-type antiviral protein 1 OS=Homo sapiens GN=ZC3HAV1 PE=1 SV=3 - Q7Z2W4 15.4 0.0 45.5 39.1 14-3-3 protein zeta/delta OS=Homo sapiens GN=YWHAZ PE=1 SV=1 - P63104 31.8 0.0 31.8 36.5 40S ribosomal protein S16 OS=Homo sapiens GN=RPS16 PE=1 SV=2 - P62249 28.7 32.0 25.8 13.4 40S ribosomal protein S25 OS=Homo sapiens GN=RPS25 PE=1 SV=1 - P62851 18.5 29.8 24.1 27.6 60S acidic ribosomal protein P0 OS=Homo sapiens GN=RPLP0 PE=1 SV=1 - P05388 15.3 26.5 33.7 24.5 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 - P30050 33.2 17.8 14.3 34.7 60S ribosomal protein L14 OS=Homo sapiens GN=RPL14 PE=1 SV=4 - P50914 25.0 19.4 15.6 40.0

60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 - Q07020 19.1 52.2 16.8 12.0 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1 - P84098 19.8 38.3 19.5 22.4 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 - P62917 32.4 37.3 8.9 21.4 AP-2 complex subunit beta OS=Homo sapiens GN=AP2B1 PE=1 SV=1 - P63010 24.0 0.0 35.4 40.6 Aspartyl/asparaginyl beta-hydroxylase OS=Homo sapiens GN=ASPH PE=1 SV=3 - Q12797 25.7 27.6 30.4 16.3 Caveolin-1 OS=Homo sapiens GN=CAV1 PE=1 SV=4 - Q03135 17.8 22.2 39.4 20.5 CD9 antigen OS=Homo sapiens GN=CD9 PE=1 SV=4 - P21926 24.7 19.8 15.9 39.6 Cell division control protein 42 homolog OS=Homo sapiens GN=CDC42 PE=1 SV=2 - P60953 27.6 15.5 42.6 14.4 Cytoskeleton-associated protein 4 OS=Homo sapiens GN=CKAP4 PE=1 SV=2 - Q07065 19.0 58.3 14.5 8.3 DnaJ homolog subfamily C member 13 OS=Homo sapiens GN=DNAJC13 PE=1 SV=5 - O75165 25.3 37.7 25.4 11.6 Endoplasmic reticulum resident protein 29 OS=Homo sapiens GN=ERP29 PE=1 SV=4 - P30040 43.8 0.0 26.2 30.0 ERO1-like protein alpha OS=Homo sapiens GN=ERO1L PE=1 SV=2 - Q96HE7 9.4 12.9 53.8 23.9 Fatty aldehyde dehydrogenase OS=Homo sapiens GN=ALDH3A2 PE=1 SV=1 - P51648 20.8 44.1 16.3 18.7 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - P04406 25.7 19.8 45.3 9.2 Hypoxia up-regulated protein 1 OS=Homo sapiens GN=HYOU1 PE=1 SV=1 - Q9Y4L1 41.0 25.7 15.5 17.8 Immunoglobulin superfamily member 8 OS=Homo sapiens GN=IGSF8 PE=1 SV=1 - Q969P0 0.0 0.0 30.4 69.6 Inactive tyrosine-protein kinase 7 OS=Homo sapiens GN=PTK7 PE=1 SV=2 - Q13308 22.5 23.1 18.7 35.7 Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo sapiens GN=IGF2BP3 PE=1 SV=2 - O00425 30.6 32.2 17.3 19.9 Integrin alpha-2 OS=Homo sapiens GN=ITGA2 PE=1 SV=1 - P17301 28.8 56.7 9.9 4.6 Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2 - Q12905 27.5 12.9 34.1 25.5 Katanin p60 ATPase-containing subunit A-like 2 OS=Homo sapiens GN=KATNAL2 PE=2 SV=3 - Q8IYT4 0.0 0.0 0.0 100.0 Keratin, type I cuticular Ha6 OS=Homo sapiens GN=KRT36 PE=1 SV=1 - O76013 0.0 0.0 0.0 100.0 Laminin subunit beta-3 OS=Homo sapiens GN=LAMB3 PE=1 SV=1 - Q13751 19.3 15.1 30.5 35.0 Lanosterol 14-alpha demethylase OS=Homo sapiens GN=CYP51A1 PE=1 SV=3 - Q16850 0.0 54.5 12.9 32.6 Leucyl-cystinyl aminopeptidase OS=Homo sapiens GN=LNPEP PE=1 SV=3 - Q9UIQ6 15.7 42.9 27.2 14.2

Lipolysis-stimulated lipoprotein receptor OS=Homo sapiens GN=LSR PE=1 SV=4 - Q86X29 0.0 0.0 27.9 72.1 Membrane-associated progesterone receptor component 1 OS=Homo sapiens GN=PGRMC1 PE=1 SV=3 - O00264 5.2 29.4 38.2 27.2 Non-POU domain-containing octamer-binding protein OS=Homo sapiens GN=NONO PE=1 SV=4 - Q15233 16.4 44.8 18.1 20.7 Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens GN=PPIA PE=1 SV=2 - P62937 43.5 0.0 26.3 30.2 Peroxiredoxin-1 OS=Homo sapiens GN=PRDX1 PE=1 SV=1 - Q06830 29.7 12.1 34.2 24.0 Peroxiredoxin-4 OS=Homo sapiens GN=PRDX4 PE=1 SV=1 - Q13162 10.2 13.3 50.5 25.9 Plakophilin-3 OS=Homo sapiens GN=PKP3 PE=1 SV=1 - Q9Y446 30.1 38.6 14.5 16.7 Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens GN=SERBP1 PE=1 SV=2 - Q8NC51 16.5 45.2 11.6 26.6 Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 PE=1 SV=1 - Q13310 26.2 15.1 27.4 31.4 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 SV=1 - P17844 23.4 24.1 30.2 22.3 Probable ATP-dependent RNA helicase DDX6 OS=Homo sapiens GN=DDX6 PE=1 SV=2 - P26196 26.3 27.0 21.8 25.0 Prostaglandin F2 receptor negative regulator OS=Homo sapiens GN=PTGFRN PE=1 SV=2 - Q9P2B2 34.3 20.1 27.0 18.6 Protein LYRIC OS=Homo sapiens GN=MTDH PE=1 SV=2 - Q86UE4 9.8 59.1 14.5 16.6 Proto-oncogene tyrosine-protein kinase Src OS=Homo sapiens GN=SRC PE=1 SV=3 - P12931 11.8 32.3 26.0 29.9 Ras-related C3 botulinum toxin substrate 2 OS=Homo sapiens GN=RAC2 PE=1 SV=1 - P15153 0.0 0.0 46.6 53.4 Ribosome-binding protein 1 OS=Homo sapiens GN=RRBP1 PE=1 SV=4 - Q9P2E9 47.8 37.0 4.6 10.5 Sarcoplasmic/endoplasmic reticulum calcium ATPase 1 OS=Homo sapiens GN=ATP2A1 PE=1 SV=1 - O14983 0.0 0.0 0.0 100.0 Secretory carrier-associated membrane protein 3 OS=Homo sapiens GN=SCAMP3 PE=1 SV=3 - O14828 5.9 34.4 27.8 31.9 Signal recognition particle 14 kDa protein OS=Homo sapiens GN=SRP14 PE=1 SV=2 - P37108 11.3 0.0 25.0 63.8 Sodium/potassium-transporting ATPase subunit beta-1 OS=Homo sapiens GN=ATP1B1 PE=1 SV=1 - P05026 16.6 22.8 18.4 42.2 Solute carrier family 2, facilitated glucose transporter member 1 OS=Homo sapiens GN=SLC2A1 PE=1 SV=2 - P11166 10.7 29.3 42.0 18.1 Surfeit locus protein 4 OS=Homo sapiens GN=SURF4 PE=1 SV=3 - O15260 21.8 0.0 22.9 55.3 Thioredoxin-related transmembrane protein 2 OS=Homo sapiens GN=TMX2 PE=1 SV=1 - Q9Y320 11.8 32.3 26.0 29.9 Translational activator GCN1 OS=Homo sapiens GN=GCN1L1 PE=1 SV=6 - Q92616 32.9 36.0 14.5 16.6 Translocon-associated protein subunit gamma OS=Homo sapiens GN=SSR3 PE=1 SV=1 - Q9UNL2 0.0 0.0 46.6 53.4

Transmembrane and coiled-coil domain-containing protein 1 OS=Homo sapiens GN=TMCO1 PE=1 SV=1 - Q9UM00 5.9 34.4 27.8 31.9 Transmembrane protein 33 OS=Homo sapiens GN=TMEM33 PE=1 SV=2 - P57088 11.8 32.3 26.0 29.9 Trophoblast glycoprotein OS=Homo sapiens GN=TPBG PE=1 SV=1 - Q13641 14.1 19.2 31.1 35.6 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 - P07437 45.0 0.0 0.0 55.0 Very-long-chain (3R)-3-hydroxyacyl-[acyl-carrier protein] dehydratase 3 OS=Homo sapiens GN=PTPLAD1 PE=1 SV=2 - Q9P035 22.3 28.4 23.0 26.3 Vesicle-associated membrane protein-associated protein A OS=Homo sapiens GN=VAPA PE=1 SV=3 - Q9P0L0 14.7 40.2 21.0 24.1 Vesicle-associated membrane protein-associated protein B/C OS=Homo sapiens GN=VAPB PE=1 SV=3 - O95292 20.2 29.2 33.5 17.1 Vesicle-trafficking protein SEC22b OS=Homo sapiens GN=SEC22B PE=1 SV=4 - O75396 13.1 10.8 55.2 20.8 2'-5'-oligoadenylate synthase-like protein OS=Homo sapiens GN=OASL PE=1 SV=2 - Q15646 18.6 0.0 59.9 21.5 3-keto-steroid reductase OS=Homo sapiens GN=HSD17B7 PE=1 SV=1 - P56937 0.0 0.0 46.6 53.4 40S ribosomal protein S14 OS=Homo sapiens GN=RPS14 PE=1 SV=3 - P62263 42.0 21.2 17.1 19.6 40S ribosomal protein S23 OS=Homo sapiens GN=RPS23 PE=1 SV=3 - P62266 11.8 32.3 26.0 29.9 40S ribosomal protein S4, X isoform OS=Homo sapiens GN=RPS4X PE=1 SV=2 - P62701 57.8 0.0 19.6 22.5 40S ribosomal protein SA OS=Homo sapiens GN=RPSA PE=1 SV=4 - P08865 36.9 35.5 12.9 14.8 5'-nucleotidase OS=Homo sapiens GN=NT5E PE=1 SV=1 - P21589 44.1 0.0 0.0 55.9 60S ribosomal protein L11 OS=Homo sapiens GN=RPL11 PE=1 SV=2 - P62913 17.8 22.2 39.4 20.5 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2 - P61313 41.3 46.1 0.0 12.6 60S ribosomal protein L23 OS=Homo sapiens GN=RPL23 PE=1 SV=1 - P62829 32.1 0.0 31.6 36.3 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3 - P46779 38.5 43.6 0.0 17.9 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2 - P47914 22.5 28.4 22.9 26.3 60S ribosomal protein L31 OS=Homo sapiens GN=RPL31 PE=1 SV=1 - P62899 22.9 28.2 22.8 26.1 60S ribosomal protein L5 OS=Homo sapiens GN=RPL5 PE=1 SV=3 - P46777 49.0 0.0 23.8 27.2 60S ribosomal protein L9 OS=Homo sapiens GN=RPL9 PE=1 SV=1 - P32969 20.5 56.1 0.0 23.4 7-dehydrocholesterol reductase OS=Homo sapiens GN=DHCR7 PE=1 SV=1 - Q9UBM7 45.8 0.0 25.3 29.0 Alpha-enolase OS=Homo sapiens GN=ENO1 PE=1 SV=2 - 49.0 26.4 11.5 13.2

P06733 AP-1 complex subunit gamma-1 OS=Homo sapiens GN=AP1G1 PE=1 SV=5 - O43747 22.3 30.5 35.1 12.1 ATP-dependent RNA helicase DDX1 OS=Homo sapiens GN=DDX1 PE=1 SV=2 - Q92499 17.4 0.0 38.5 44.1 Brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 1 OS=Homo sapiens GN=BAIAP2L1 PE=1 SV=2 - Q9UHR4 28.3 0.0 0.0 71.7 Calcineurin B homologous protein 1 OS=Homo sapiens GN=CHP1 PE=1 SV=3 - Q99653 28.9 36.9 0.0 34.2 Cell cycle and apoptosis regulator protein 2 OS=Homo sapiens GN=CCAR2 PE=1 SV=2 - Q8N163 50.3 25.8 0.0 23.9 Desmoplakin OS=Homo sapiens GN=DSP PE=1 SV=3 - P15924 36.3 33.1 0.0 30.6 Disks large homolog 1 OS=Homo sapiens GN=DLG1 PE=1 SV=2 - Q12959 78.0 0.0 0.0 22.0 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 OS=Homo sapiens GN=DAD1 PE=1 SV=3 - P61803 0.0 70.7 0.0 29.3 Elongation factor 1-delta OS=Homo sapiens GN=EEF1D PE=1 SV=5 - P29692 30.7 0.0 32.3 37.0 Endoplasmic reticulum metallopeptidase 1 OS=Homo sapiens GN=ERMP1 PE=1 SV=2 - Q7Z2K6 29.8 37.6 15.2 17.4 Epoxide hydrolase 1 OS=Homo sapiens GN=EPHX1 PE=1 SV=1 - P07099 26.0 61.1 6.0 6.9 ER membrane protein complex subunit 1 OS=Homo sapiens GN=EMC1 PE=1 SV=1 - Q8N766 9.4 25.6 41.3 23.7 Estradiol 17-beta-dehydrogenase 12 OS=Homo sapiens GN=HSD17B12 PE=1 SV=2 - Q53GQ0 20.4 35.4 28.6 15.5 Eukaryotic translation initiation factor 4 gamma 1 OS=Homo sapiens GN=EIF4G1 PE=1 SV=4 - Q04637 64.0 0.0 0.0 36.0 Extended synaptotagmin-2 OS=Homo sapiens GN=ESYT2 PE=1 SV=1 - A0FGR8 33.3 45.6 0.0 21.1 Flotillin-1 OS=Homo sapiens GN=FLOT1 PE=1 SV=3 - O75955 7.9 40.0 32.2 19.9 Heat shock protein beta-1 OS=Homo sapiens GN=HSPB1 PE=1 SV=2 - P04792 50.5 34.2 0.0 15.3 Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 SV=3 - P52597 44.1 0.0 0.0 55.9 Integrin alpha-V OS=Homo sapiens GN=ITGAV PE=1 SV=2 - P06756 6.0 43.7 35.2 15.2 Lamin-B receptor OS=Homo sapiens GN=LBR PE=1 SV=2 - Q14739 11.8 0.0 58.4 29.8 Mannosyl-oligosaccharide glucosidase OS=Homo sapiens GN=MOGS PE=1 SV=5 - Q13724 0.0 39.2 45.2 15.6 Nodal modulator 2 OS=Homo sapiens GN=NOMO2 PE=1 SV=1 - Q5JPE7 36.0 28.2 22.7 13.0 Phospholipid scramblase 1 OS=Homo sapiens GN=PLSCR1 PE=1 SV=1 - O15162 12.6 0.0 55.6 31.9 Plexin-A1 OS=Homo sapiens GN=PLXNA1 PE=1 SV=3 - 0.0 0.0 88.7 11.3

Q9UIW2 Plexin-B2 OS=Homo sapiens GN=PLXNB2 PE=1 SV=3 - O15031 41.2 41.0 8.3 9.5 Poly [ADP-ribose] polymerase 14 OS=Homo sapiens GN=PARP14 PE=1 SV=3 - Q460N5 26.9 27.6 37.1 8.5 Poly(rC)-binding protein 1 OS=Homo sapiens GN=PCBP1 PE=1 SV=2 - Q15365 64.6 0.0 0.0 35.4 Poly(rC)-binding protein 2 OS=Homo sapiens GN=PCBP2 PE=1 SV=1 - Q15366 38.1 32.1 0.0 29.7 Protein canopy homolog 2 OS=Homo sapiens GN=CNPY2 PE=1 SV=1 - Q9Y2B0 11.8 32.3 26.0 29.9 Protein S100-A14 OS=Homo sapiens GN=S100A14 PE=1 SV=1 - Q9HCY8 17.2 47.2 16.6 19.0 Protein S100-A16 OS=Homo sapiens GN=S100A16 PE=1 SV=1 - Q96FQ6 30.3 36.2 0.0 33.5 Ras GTPase-activating protein-binding protein 2 OS=Homo sapiens GN=G3BP2 PE=1 SV=2 - Q9UN86 11.8 32.3 26.0 29.9 Ras-related protein Rab-2A OS=Homo sapiens GN=RAB2A PE=1 SV=1 - P61019 47.6 0.0 34.2 18.2 Reticulon-4 OS=Homo sapiens GN=RTN4 PE=1 SV=2 - Q9NQC3 11.9 65.4 10.6 12.1 Retinol dehydrogenase 11 OS=Homo sapiens GN=RDH11 PE=1 SV=2 - Q8TC12 27.5 37.6 0.0 34.8 Rho-related GTP-binding protein RhoG OS=Homo sapiens GN=RHOG PE=1 SV=1 - P84095 24.3 41.2 16.1 18.4 Septin-9 OS=Homo sapiens GN=SEPT9 PE=1 SV=2 - Q9UHD8 60.8 14.3 11.6 13.3 Sortilin OS=Homo sapiens GN=SORT1 PE=1 SV=3 - Q99523 0.0 0.0 67.0 33.0 Synaptogyrin-2 OS=Homo sapiens GN=SYNGR2 PE=1 SV=1 - O43760 17.4 30.6 38.4 13.6 Syntaxin-7 OS=Homo sapiens GN=STX7 PE=1 SV=4 - O15400 17.8 22.2 39.4 20.5 Syntaxin-8 OS=Homo sapiens GN=STX8 PE=1 SV=2 - Q9UNK0 9.2 25.2 42.3 23.3 T-complex protein 1 subunit beta OS=Homo sapiens GN=CCT2 PE=1 SV=4 - P78371 31.7 0.0 31.8 36.5 Type-1 angiotensin II receptor-associated protein OS=Homo sapiens GN=AGTRAP PE=1 SV=1 - Q6RW13 11.8 32.3 26.0 29.9 Tyrosine-protein kinase Lyn OS=Homo sapiens GN=LYN PE=1 SV=3 - P07948 43.4 47.1 0.0 9.5 Tyrosine-protein phosphatase non-receptor type 1 OS=Homo sapiens GN=PTPN1 PE=1 SV=1 - P18031 22.5 28.4 22.9 26.3 UBX domain-containing protein 4 OS=Homo sapiens GN=UBXN4 PE=1 SV=2 - Q92575 24.0 42.5 15.6 17.9 Very-long-chain enoyl-CoA reductase OS=Homo sapiens GN=TECR PE=1 SV=1 - Q9NZ01 43.1 20.8 16.8 19.3 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - Q9Y3E0 11.8 32.3 26.0 29.9 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 - P62280 100.0 0.0 0.0 0.0

40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2 - P62277 32.9 37.1 30.0 0.0 40S ribosomal protein S17-like OS=Homo sapiens GN=RPS17L PE=1 SV=1 - P0CW22 50.5 0.0 49.5 0.0 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 - P15880 14.2 54.3 31.4 0.0 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=1 SV=1 - P62847 26.8 73.2 0.0 0.0 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 - P61247 100.0 0.0 0.0 0.0 40S ribosomal protein S5 OS=Homo sapiens GN=RPS5 PE=1 SV=4 - P46782 22.1 29.2 48.8 0.0 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2 - P62241 32.7 29.1 38.2 0.0 6-phosphogluconate dehydrogenase, decarboxylating OS=Homo sapiens GN=PGD PE=1 SV=3 - P52209 60.4 39.6 0.0 0.0 Absent in melanoma 1 protein OS=Homo sapiens GN=AIM1 PE=1 SV=3 - Q9Y4K1 35.4 64.6 0.0 0.0 Actin, alpha cardiac muscle 1 OS=Homo sapiens GN=ACTC1 PE=1 SV=1 - P68032 100.0 0.0 0.0 0.0 Actin-related protein 3 OS=Homo sapiens GN=ACTR3 PE=1 SV=3 - P61158 100.0 0.0 0.0 0.0 Afadin OS=Homo sapiens GN=MLLT4 PE=1 SV=3 - P55196 100.0 0.0 0.0 0.0 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - Q6NUM9 100.0 0.0 0.0 0.0 Annexin A1 OS=Homo sapiens GN=ANXA1 PE=1 SV=2 - P04083 100.0 0.0 0.0 0.0 Anterior gradient protein 2 homolog OS=Homo sapiens GN=AGR2 PE=1 SV=1 - O95994 100.0 0.0 0.0 0.0 AP-1 complex subunit mu-2 OS=Homo sapiens GN=AP1M2 PE=1 SV=4 - Q9Y6Q5 37.1 16.5 46.5 0.0 Argininosuccinate synthase OS=Homo sapiens GN=ASS1 PE=1 SV=2 - P00966 100.0 0.0 0.0 0.0 ATP-dependent RNA helicase DDX3Y OS=Homo sapiens GN=DDX3Y PE=1 SV=2 - O15523 67.7 32.3 0.0 0.0 Band 4.1-like protein 1 OS=Homo sapiens GN=EPB41L1 PE=1 SV=2 - Q9H4G0 100.0 0.0 0.0 0.0 CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3 - P27708 24.4 66.7 9.0 0.0 Calmodulin-like protein 3 OS=Homo sapiens GN=CALML3 PE=1 SV=2 - P27482 100.0 0.0 0.0 0.0 Carboxypeptidase D OS=Homo sapiens GN=CPD PE=1 SV=2 - O75976 27.7 56.9 15.3 0.0 Casein kinase I isoform alpha OS=Homo sapiens GN=CSNK1A1 PE=1 SV=2 - P48729 100.0 0.0 0.0 0.0 Catenin alpha-2 OS=Homo sapiens GN=CTNNA2 PE=1 SV=5 - P26232 0.0 0.0 100.0 0.0 CD109 antigen OS=Homo sapiens GN=CD109 PE=1 SV=2 - Q6YHK3 76.0 0.0 24.0 0.0

Chitobiosyldiphosphodolichol beta-mannosyltransferase OS=Homo sapiens GN=ALG1 PE=1 SV=2 - Q9BT22 0.0 0.0 100.0 0.0 Clathrin interactor 1 OS=Homo sapiens GN=CLINT1 PE=1 SV=1 - Q14677 100.0 0.0 0.0 0.0 Cleft lip and palate transmembrane protein 1 OS=Homo sapiens GN=CLPTM1 PE=1 SV=1 - O96005 100.0 0.0 0.0 0.0 Constitutive coactivator of PPAR-gamma-like protein 1 OS=Homo sapiens GN=FAM120A PE=1 SV=2 - Q9NZB2 77.6 22.4 0.0 0.0 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - O43169 26.8 73.2 0.0 0.0 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 - Q14204 64.6 35.4 0.0 0.0 Double-stranded RNA-binding protein Staufen homolog 1 OS=Homo sapiens GN=STAU1 PE=1 SV=2 - O95793 100.0 0.0 0.0 0.0 E3 ubiquitin/ISG15 ligase TRIM25 OS=Homo sapiens GN=TRIM25 PE=1 SV=2 - Q14258 100.0 0.0 0.0 0.0 EH domain-containing protein 2 OS=Homo sapiens GN=EHD2 PE=1 SV=2 - Q9NZN4 100.0 0.0 0.0 0.0 Endoplasmic reticulum aminopeptidase 2 OS=Homo sapiens GN=ERAP2 PE=1 SV=2 - Q6P179 28.8 39.4 31.8 0.0 Enhancer of mRNA-decapping protein 4 OS=Homo sapiens GN=EDC4 PE=1 SV=1 - Q6P2E9 14.7 20.2 65.1 0.0 Epiplakin OS=Homo sapiens GN=EPPK1 PE=1 SV=2 - P58107 100.0 0.0 0.0 0.0 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - P60842 100.0 0.0 0.0 0.0 Eukaryotic translation initiation factor 3 subunit A OS=Homo sapiens GN=EIF3A PE=1 SV=1 - Q14152 32.2 44.1 23.7 0.0 Eukaryotic translation initiation factor 3 subunit F OS=Homo sapiens GN=EIF3F PE=1 SV=1 - O00303 100.0 0.0 0.0 0.0 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens GN=EIF4G2 PE=1 SV=1 - P78344 100.0 0.0 0.0 0.0 Excitatory amino acid transporter 1 OS=Homo sapiens GN=SLC1A3 PE=1 SV=1 - P43003 26.8 73.2 0.0 0.0 Fascin OS=Homo sapiens GN=FSCN1 PE=1 SV=3 - Q16658 100.0 0.0 0.0 0.0 Fatty acid synthase OS=Homo sapiens GN=FASN PE=1 SV=3 - P49327 44.9 0.0 55.1 0.0 Fructose-bisphosphate aldolase C OS=Homo sapiens GN=ALDOC PE=1 SV=2 - P09972 0.0 0.0 100.0 0.0 Gamma-interferon-inducible protein 16 OS=Homo sapiens GN=IFI16 PE=1 SV=3 - Q16666 100.0 0.0 0.0 0.0 Glycogen [starch] synthase, muscle OS=Homo sapiens GN=GYS1 PE=1 SV=2 - P13807 100.0 0.0 0.0 0.0 Glycogen debranching enzyme OS=Homo sapiens GN=AGL PE=1 SV=3 - P35573 100.0 0.0 0.0 0.0 Guanine nucleotide-binding protein G(s) subunit alpha isoforms XLas OS=Homo sapiens GN=GNAS PE=1 SV=2 - Q5JWF2 0.0 40.3 59.7 0.0 Guanine nucleotide-binding protein subunit beta-2-like 1 OS=Homo sapiens GN=GNB2L1 PE=1 SV=3 - P63244 57.3 42.7 0.0 0.0 Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens 30.7 25.2 44.1 0.0

GN=HNRNPH1 PE=1 SV=4 - P31943 HLA class I histocompatibility antigen, B-37 alpha chain OS=Homo sapiens GN=HLA-B PE=1 SV=1 - P18463 0.0 0.0 100.0 0.0 HLA class I histocompatibility antigen, B-8 alpha chain OS=Homo sapiens GN=HLA-B PE=1 SV=1 - P30460 35.2 64.8 0.0 0.0 HLA class I histocompatibility antigen, Cw-17 alpha chain OS=Homo sapiens GN=HLA-C PE=1 SV=1 - Q95604 0.0 0.0 100.0 0.0 Immunoglobulin superfamily member 3 OS=Homo sapiens GN=IGSF3 PE=2 SV=3 - O75054 33.8 66.2 0.0 0.0 Inositol monophosphatase 3 OS=Homo sapiens GN=IMPAD1 PE=1 SV=1 - Q9NX62 100.0 0.0 0.0 0.0 Insulin-like growth factor 2 mRNA-binding protein 2 OS=Homo sapiens GN=IGF2BP2 PE=1 SV=2 - Q9Y6M1 100.0 0.0 0.0 0.0 Interferon-induced GTP-binding protein Mx1 OS=Homo sapiens GN=MX1 PE=1 SV=4 - P20591 29.7 50.1 20.2 0.0 Interferon-induced GTP-binding protein Mx2 OS=Homo sapiens GN=MX2 PE=1 SV=1 - P20592 100.0 0.0 0.0 0.0 Interleukin enhancer-binding factor 3 OS=Homo sapiens GN=ILF3 PE=1 SV=3 - Q12906 33.5 49.4 17.1 0.0 Keratin, type I cytoskeletal 13 OS=Homo sapiens GN=KRT13 PE=1 SV=4 - P13646 73.3 26.7 0.0 0.0 Keratin, type I cytoskeletal 15 OS=Homo sapiens GN=KRT15 PE=1 SV=3 - P19012 56.4 43.6 0.0 0.0 Keratin, type II cytoskeletal 4 OS=Homo sapiens GN=KRT4 PE=1 SV=4 - P19013 100.0 0.0 0.0 0.0 Keratin, type II cytoskeletal 6A OS=Homo sapiens GN=KRT6A PE=1 SV=3 - P02538 61.7 38.3 0.0 0.0 La-related protein 4 OS=Homo sapiens GN=LARP4 PE=1 SV=3 - Q71RC2 100.0 0.0 0.0 0.0 L-lactate dehydrogenase A chain OS=Homo sapiens GN=LDHA PE=1 SV=2 - P00338 30.5 24.7 44.8 0.0 Major vault protein OS=Homo sapiens GN=MVP PE=1 SV=4 - Q14764 100.0 0.0 0.0 0.0 Moesin OS=Homo sapiens GN=MSN PE=1 SV=3 - P26038 79.6 0.0 20.4 0.0 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - P60660 100.0 0.0 0.0 0.0 Myosin-14 OS=Homo sapiens GN=MYH14 PE=1 SV=2 - Q7Z406 69.4 0.0 30.6 0.0 Myristoylated alanine-rich C-kinase substrate OS=Homo sapiens GN=MARCKS PE=1 SV=4 - P29966 100.0 0.0 0.0 0.0 Neutral amino acid transporter A OS=Homo sapiens GN=SLC1A4 PE=1 SV=1 - P43007 36.1 63.9 0.0 0.0 Nuclease-sensitive element-binding protein 1 OS=Homo sapiens GN=YBX1 PE=1 SV=3 - P67809 26.8 73.2 0.0 0.0 Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 - P19338 38.2 61.8 0.0 0.0 Periplakin OS=Homo sapiens GN=PPL PE=1 SV=4 - O60437 100.0 0.0 0.0 0.0 Plasma membrane calcium-transporting ATPase 4 OS=Homo sapiens GN=ATP2B4 PE=1 SV=2 - P23634 100.0 0.0 0.0 0.0 Poly [ADP-ribose] polymerase 1 OS=Homo sapiens 100.0 0.0 0.0 0.0

GN=PARP1 PE=1 SV=4 - P09874 Poly [ADP-ribose] polymerase 9 OS=Homo sapiens GN=PARP9 PE=1 SV=2 - Q8IXQ6 60.2 0.0 39.8 0.0 Poly(U)-binding-splicing factor PUF60 OS=Homo sapiens GN=PUF60 PE=1 SV=1 - Q9UHX1 61.6 38.4 0.0 0.0 Polymeric immunoglobulin receptor OS=Homo sapiens GN=PIGR PE=1 SV=4 - P01833 100.0 0.0 0.0 0.0 Probable ATP-dependent RNA helicase DDX60 OS=Homo sapiens GN=DDX60 PE=1 SV=3 - Q8IY21 100.0 0.0 0.0 0.0 Protein FAM83F OS=Homo sapiens GN=FAM83F PE=1 SV=1 - Q8NEG4 100.0 0.0 0.0 0.0 Protein FAM83H OS=Homo sapiens GN=FAM83H PE=1 SV=3 - Q6ZRV2 56.8 43.2 0.0 0.0 Protein scribble homolog OS=Homo sapiens GN=SCRIB PE=1 SV=4 - Q14160 23.7 46.4 29.9 0.0 Putative helicase MOV-10 OS=Homo sapiens GN=MOV10 PE=1 SV=2 - Q9HCE1 100.0 0.0 0.0 0.0 Radixin OS=Homo sapiens GN=RDX PE=1 SV=1 - P35241 100.0 0.0 0.0 0.0 Ras-related protein Rab-12 OS=Homo sapiens GN=RAB12 PE=1 SV=3 - Q6IQ22 44.4 55.6 0.0 0.0 Ras-related protein Rab-1A OS=Homo sapiens GN=RAB1A PE=1 SV=3 - P62820 26.0 0.0 74.0 0.0 Ras-related protein Rab-35 OS=Homo sapiens GN=RAB35 PE=1 SV=1 - Q15286 100.0 0.0 0.0 0.0 Ras-related protein Rab-6A OS=Homo sapiens GN=RAB6A PE=1 SV=3 - P20340 100.0 0.0 0.0 0.0 Ras-related protein R-Ras2 OS=Homo sapiens GN=RRAS2 PE=1 SV=1 - P62070 22.3 28.4 49.3 0.0 Receptor tyrosine-protein kinase erbB-2 OS=Homo sapiens GN=ERBB2 PE=1 SV=1 - P04626 26.8 73.2 0.0 0.0 Redox-regulatory protein FAM213A OS=Homo sapiens GN=FAM213A PE=1 SV=3 - Q9BRX8 0.0 36.4 63.6 0.0 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - Q01844 100.0 0.0 0.0 0.0 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 OS=Homo sapiens GN=ATP2A2 PE=1 SV=1 - P16615 31.8 49.4 18.8 0.0 Secretory carrier-associated membrane protein 1 OS=Homo sapiens GN=SCAMP1 PE=1 SV=2 - O15126 26.8 73.2 0.0 0.0 Septin-10 OS=Homo sapiens GN=SEPT10 PE=1 SV=2 - Q9P0V9 100.0 0.0 0.0 0.0 Septin-2 OS=Homo sapiens GN=SEPT2 PE=1 SV=1 - Q15019 55.4 24.7 19.9 0.0 Septin-7 OS=Homo sapiens GN=SEPT7 PE=1 SV=2 - Q16181 72.0 0.0 28.0 0.0 Signal recognition particle receptor subunit alpha OS=Homo sapiens GN=SRPR PE=1 SV=2 - P08240 19.0 81.0 0.0 0.0 Syndecan-1 OS=Homo sapiens GN=SDC1 PE=1 SV=3 - P18827 53.9 46.1 0.0 0.0 T-complex protein 1 subunit delta OS=Homo sapiens GN=CCT4 PE=1 SV=4 - P50991 26.3 15.6 58.1 0.0 T-complex protein 1 subunit theta OS=Homo sapiens 71.7 0.0 28.3 0.0

GN=CCT8 PE=1 SV=4 - P50990 THO complex subunit 4 OS=Homo sapiens GN=ALYREF PE=1 SV=3 - Q86V81 100.0 0.0 0.0 0.0 Transcription intermediary factor 1-beta OS=Homo sapiens GN=TRIM28 PE=1 SV=5 - Q13263 100.0 0.0 0.0 0.0 Translocon-associated protein subunit delta OS=Homo sapiens GN=SSR4 PE=1 SV=1 - P51571 30.0 38.8 31.3 0.0 Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 - P68371 100.0 0.0 0.0 0.0 Ubiquitin-associated protein 2-like OS=Homo sapiens GN=UBAP2L PE=1 SV=2 - Q14157 49.3 50.7 0.0 0.0 UDP-glucose:glycoprotein glucosyltransferase 1 OS=Homo sapiens GN=UGGT1 PE=1 SV=3 - Q9NYU2 37.8 34.5 27.8 0.0 Vesicle-associated membrane protein 3 OS=Homo sapiens GN=VAMP3 PE=1 SV=3 - Q15836 26.8 73.2 0.0 0.0 Wiskott-Aldrich syndrome protein family member 2 OS=Homo sapiens GN=WASF2 PE=1 SV=3 - Q9Y6W5 100.0 0.0 0.0 0.0

Table S 4. List of the proteins upregulated in Cal33 and FaDu radioresistant (RR) versus parental (P) (in alphabetical order)

Cal33 FaDu gene RR/P fold change RR/P fold change AGTRAP 2,74 1,15 ATP1A1 1,35 1,48 ATP1B1 1,35 2,29 BCAM 1,53 1,15 CD81 2,74 1,15 CELSR1 1,37 1,15 CTNNA1 1,19 1,15 CNPY2 2,74 1,15 CTNNB 1,31 2,83 F11R 2,74 1,15 GCN1L1 1,09 1,15 ITGA3 4,79 1,35 ITGB1 3,52 1,65 LAMP1 2,11 1,15 NRAS 2,74 1,15 RAB5C 3,95 1,15 RHOG 1,7 1,15 RTN4 5,47 1,15 S100A14 2,74 1,15 SLC1A5 1,4 1,15 SLC3A2 1,89 1,69 SRC 2,74 1,15 TMEM33 2,74 1,15 TMX2 2,74 1,15 TPBG 1,37 1,15 VAPA 2,74 1,15

Table S 5. Cross table (with p-value of chi-squared test) of CD98hc intensity and LAT1 intensity.

CD98hc intensity 0 1 2 3

0 5 0 0 0 LAT1 1 0 2 1 0 intensity 2 1 6 23 0 3 1 3 18 3 p<0.001

Table S 6. Multivariable Cox regression of loco-regional control. Multivariable Cox regression of loco-regional control. In each model one LAT1 parameter was combined with N stage (0,1 vs 2,3), p16 status and the natural logarithm (ln) of tumor volume. Only the result for the LAT1 parameter is reported. HR = hazard ratio; 95% CI = 95 percent confidence interval.

Variable HR (95% CI) p-value LAT1 Intensity >1 3.33 (0.36-30.8) 0.29

LAT1 positivity ≥ 10% 1.05 (0.25-4.49) 0.95

Table S 7. Clinical trials for the CD98hc-targeted treatment.

Phase Title Conditions Interventions Outcome Measures NCT Number

Adverse event Study of Drug: KHK2898 collection and KHK2898 in (glyco-engineered assessment; subjects with Solid Tumors 1 NCT01516645 antibody, mAb Evidence of efficacy; advanced solid CD98) Profile of tumors pharmacokinetics

Incidence of adverse events; Incidence of antidrug Study of Drug: IGN523 antibodies to IGN523 in Acute Myeloid (Monoclonal IGN523; subjects with 1 NCT02040506 Leukemia Antibody, mAb Blood concentrations relapsed or CD98) of IGN523; refractory AML Assessment of anti- leukemic activity of IGN523

- Metastatic Colorectal Cancer - Metastatic Response rate; Immune Gastric Cancer Frequency and Biological: Tumor recognition of - Metastatic severity of treatment- Infiltrating somatic Pancreatic related to adverse Lymphocytes (TIL) mutations using Cancer events; Assessment Drug: Aldesleukin tumor - Metastatic of adverse events (i. NCT01174121 Drug: 2 infiltrating Hepatocellular e. their frequency see Ref (26) Cyclophosphamide lymphocytes for Carcinoma and severity); Drug: Fludarabine patients with - Progressive Safety and efficacy Drug: metastatic Glioblastoma of pembrolizumab Pembrolizumab cancer - Metastatic following TIL Ovarian therapy. Cancer - Metastatic Breast Cancer

Table S 8. Primers, siRNA oligos and antibodies used in the study

Antibody used for Western blot analysis Catalog Antigen Company Name # CD98hc Santa Cruz Biotechnology C-20 sc-7095 CD98hc Santa Cruz Biotechnology 4F2 sc-59145 LAT1 Cell Signaling Technology n/a #5347 GAPDH Santa Cruz Biotechnology FL-335 sc-25778 α-tubulin Cell Signaling Technology DM1A #3873 AKT Cell Signaling Technology C67E7 #4691 p-AKT (Ser473) Cell Signaling Technology D9E #4060 p-S6 (Ser240/244) Cell Signaling Technology D68F8 #5364 S6 Santa Cruz Biotechnology C-8 sc-74459 eIF2α Cell Signaling Technology D7D3 #5324 p-eIF2α (Ser51) Cell Signaling Technology D9G8 #3398 p-4EBP1 (Thr37/46) Cell Signaling Technology 236B4 #2855 4EBP1 Cell Signaling Technology 53H11 #9644 p-p70S6K (Thr389) Cell Signaling Technology 108D2 #9234 p70S6K Cell Signaling Technology 49D7 #2708 LC3 A/B Cell Signaling Technology D3U4C #12741 LC3 B Cell Signaling Technology D11 #3868 ATG5 Cell Signaling Technology D5F5U #12994 PARP Cell Signaling Technology 46D11 #9532 PARP cleaved Cell Signaling Technology D64E10 #5625 siRNA oligos used for knock down of gene expression Gene siRNA name Sequence ss GCAGCUAUAUGAAUGUUGUdTdT as ACAACAUUCAUAUAGCUGCdTdT Scrambled siRNA Scr siRNA ss GGAUGAGAUAACUGAAAGGdGdA ATG5-433 (siRNA as CCUUUCAGUUAUCUCAUCCdTdG ATG5 #1) ss GGCAACCUGACCAGAAACAdCdT ATG5-1277 as UGUUUCUGGUCAGGUUGCCdTdC ATG5 (siRNA #2) ss GAGGAUGGAAUUACUUGAAdTdT as UUCAAGUAAUUCCAUCCUCdCdA LAT1 (siRNA #1) SLC7A5 ss GCCUCAAGGAUACAGGGAGdCdC as CUCCCUGUAUCCUUGAGGCdAdT SLC7A5 LAT1 (siRNA #2)

ss AACAGAGACAAGAAAGGCAdGdA as UGCCUUUCUUGUCUCUGUUdTdC SLC7A5 LAT1 (siRNA #3) SLC3A2-119633 (siRNA ) ss GCCUACUCGAAUCCAACAAdAdG as UUGUUGGAUUCGAGUAGGCdCdT SLC3A2 ss AGGUGGAGCUGAAUGAGUUdAdG SLC3A2-601 as AACUCAUUCAGCUCCACCUdCdC SLC7A5 (siRNA #2) ss GGAUGAUGUCGCUCAGACUdGdA SLC3A2-11381 as AGUCUGAGCGACAUCAUCCdTdT SLC7A5 (siRNA #3) Primers used for PCR Primers Product size Sequences Tm, oC

ACTB 199 bp F 5'- CAC CCT GAA GTA CCC CAT CG -3' 57.4 R 5'-GCT GGG GTG TTG AAG GTC TC -3' 58.1 ATG 5 189 bp F 5'- GCC ATC AAT CGG AAA CTC ATG -3' 54 R 5'- CAG GAT CAA TAG CAG AAG GAC -3' 52.7 CDKN1A 219 bp F 5'- GAT GAG TTG GGA GGA GGC AG -3' 53.3 R 5'- GAA GAT CAG CCG GCG TTT GG -3' 55 CDKN2B 171/294 bp F 5'- GGA CTA GTG GAG AAG GTG CGA C -3' 64 R 5'- GGTGAGAGTGGCAGGGTCTG -3' 63.5 SLC7A5 153bp F 5'- CCTTCATCGCAGTACATCGTGG -3' 62.1 R 5'- GCCTTCACGCTGTAGCAGTTCAC -3' 64.2 SLC3A2 172bp F 5'- GCT GTA AGT GCC AAC ATG ACT G-3' 60.3 R 5'- GGT CCC AGT GGC GGA TAT AGG-3 63.7 PRKDC 234 bp F 5'- CCTGGCCGGTCATCAACTG-3' 61 R 5'- AGT AAG GTG CGA TCT TCT GGC-3 59.8 FANCA 166 F 5'- TTTGCTTGAGGTAGAAGGTCCA-3' 58.4 R 5'-CCCGGCTGAGAGAATACCCA -3 61.4

Supplementary Figure 1

A Cal33 FaDu

CD98hc

GAPDH

0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 Days after irradiation with 4 Gy of X-rays

B Cal33 2D Cal33 3D UTSCC5 2D FaDu 2D

40 30 20 30

30 15 20 20

20 10

10 10 10 5

0 0 0

Plating efficiency, % % efficiency, Plating Plating efficiency, % % efficiency, Plating

0 % efficiency, Plating si1 si2 Scr % efficiency, Plating si1 si2 Scr si1 si2 Scr si1 si2 Scr

C *- p < 0.05 n = 3 SAS 2D 1 Scr siRNA SLC3A2 siRNA 1 SLC3A2 siRNA 2

40 p=0,.057 1 2 30 0,1 20 * Survival fraction SLC3A2SLC3A2 siRNA siRNScr siRNAA 10 CD98hc 0

Plating efficiency, % % efficiency, Plating si1 si2 Scr

GAPDH

0,01 0 2 4 6 Dose (Gy) Supplementary Figure 2 A pCasR mCherry; y r

sgRNA1; r

Cas9 pCasG e h C

EGFP; m sgRNA2; 5‘ 3‘ ∆ 5‘ 3‘ ∆ 5‘ 3‘ ∆ 5‘ 3‘ ∆ Cas9 WT2 WT2 maKO2 maKO1 EGFP DNA isolation, FACS sorting PCR - based Cell transfection of the double positive clone screening and cells DNA sequencing

B WT1 maKO1

number of number of chromosomes absolute count chromosomes absolute count 77 1 87 1 81 1 88 2 90 1 89 7 92 2 90 3 93 2 91 5 94 2 92 7 95 8 Most frequent 93 10 Most frequent 96 15 94 7 97 8 95 4 98 8 96 2 99 2 97 2 50 50

WT2 maKO2 number of number of chromosomes absolute count chromosomes absolute count 46 1 47 9 47 2 Most frequent 48 36 48 4 49 1 Most frequent 49 40 93 1 50 3 95 1 50 96 1 146 1 50 C D

60 n. s.

, 50

y c

n 40

c i

f 30

g 20

n i

t 10

l P 0 W T1 W T2 KO 1 KO 2 Supplementary Figure 3 B XF Cell Energy Phenotype Aerobic Energetic 350 A Amino Acid Metabolism )

s 300 n l l o i maKO1 WT1 e t c a

4Gy r

4Gy 0Gy i 0Gy k 250 p 0 s 1 e n 1 2 3 1 2 3 1 2 3 1 2 3 / n R

i 200 l m a / i l r o d 150 n

m * o p ( h c R

o 100 t i C M O 50 Quiescent Glycolytic 00 00 50 100 150 ECAR (mpH/min/10 k cells) Glycolysis * - p < 0.05 n=3 WT1 sham irradiated maKO1 sham irradiated WT1 18 hours after 4 Gy Irradiation maKO1 18 h after 4 Gy Irradiation

C Gln Glu CD98↓ knockout LAT1 CD98↓ xCT

knockout Val, Leu, Ile, ↓ Gln CSSC Trp, Tyr

Isocitrate↓ α-KG ↓ Glu ↓ Cystine

GSH↓ cis-Aconitate↓ TCA Fumarate↓

Citrate↓ ROS↓

Lipids Pyruvate↓ Glucose Supplementary Figure 4 B p53 responsive genes D maKO1, 4Gy vs. WT1, 4Gy No activity pattern available maKO1 WT1 Positive Z-score Z-score = 0 0Gy 4Gy 0Gy 4Gy -log(p-value) Negative Z-score A n 1 2 3 1 2 3 1 2 3 1 2 3 Ratio 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 CCL5 Estrogen Biosynthesis HSPB2 Axonal Guidance SIgnaling maKO1maKO1 0Gy WT1 4Gy 0Gy WT1 4Gy SPRR1A SPRR1A Role of Osteoblasys, Osteoclasts NUPR1 and Chondrocytes in Rheumatoid Arthritis ATF3 MMP2 Inflamasome pathway CDKN1A IL1B Retioate Biosynthesis I ACTB GSN Sperm Motility GSN EDN1 Hepatic Fibrosis / Hepatic Stellate Cell Activation n = 3 EDN1 CHAC1 γ−glutamyl Cycle CHAC1 Nicotine Degradation III C HSPB1 HSPB1 FXR/RXR Activation HSPB1 Atherosclerosis Signaling p = 0.006 EPAS1 FDR = 0.025 IL6 Granulocyte Adhesion and Diapedesis SRI ASNS Bupropion Degradation ATF3 ATF3 Agranulocyte Adhesion and Diapedesis ATF3 Corticotripin Releasing Hormone Signaling ATF3 MMP3 LXR/RXR Activation TP53I3 Acetone Degradation I (to Methylglyoxal) TP53I3 Role of Macrophages, Fibroblasts and Endothelial Cells in Rheumatoid Arthritis LPS/IL-I Mediated Inhibition of RXR Function 3 maKO (positive correlation) NF-κB signaling E 2.5 2 * Basal Cell Carcinoma Signaling 1.5 WT (negative correlation) Nicotine Degradation II 1 p53 signaling Z-score = 2.6 0.5 0 Treshold

expression, A.U. expression,

Relative ATF3 gene ATF3 Relative Supplementary Figure 5

A B

SLC7A5

SLC3A2

Cal33HSC4UTSCC45XF354UTSCC5UTSCC8SASFaDu CD98hc

LAT1

α-tubulin

<=-2 >=2 R = 0.8 p < 0.001

Correlation of SLC3A2 and SLC7A5 expression in HNSCC cell lines: FaDu (n=6), FaDu RR (n=9), Cal33 (n=3); Cal33 RR (n=6) Supplementary Figure 6

A WT 1 maKO1 Dose (Gy) Dose (Gy) 0 2 4 6 0 2 4 6 1 WT 1 n=3 maKO1 n=3 1 B n.s. n.s. 40 60 y, % y, %

n c c

o 50 30

t a a t 0.1 40

0.1 c c c

c i i 20

a f f a 30

r f f

E l E 20 l 10

a a 10 g g

i n n 0

v 0 i i

v t

r t

u a 0.01 0.01 a u 1 2 1 2 l l i i i i

S s s s s

S P n=3 n=3 P 1 1 1 1 T T si1+2si1+2 si1+2 T T si1+2 si1+2 si1+2 p-values: p-values: r siRNAA A 1 T r siRNAA A 1 T Scr si RNA vs LAT1 siRNA 1: p = 0.79 hc c hc Scr si RNA vs LAT1 siRNA 1: p = 0.02 c L L T 8 A L L si 8 A Scr si RNA vs LAT1 siRNA 2: p = 0.01 S A L S L Scr si RNA vs LAT1 siRNA 2: p < 0.001 L 9 T 9 Scr si RNA vs LAT1 siRNA 1+2: p = 0.92 D A D 0.001 Scr si RNA vs LAT1 siRNA 1+2: p < 0.01 0.001 C L C Scr si RNA vs CD98hc siRNA 1+2: p < 0.0001 Scr si RNA vs CD98hc siRNA 1+2: p < 0.0001 hc & hc & Scr si RNA vs CD98hc & LAT1 siRNA 1+2: p < 0.0001 8 8 Scr si RNA vs CD98hc & LAT1 siRNA 1+2: p < 0.01 9 9 LAT1 siRNA 1+2 D D Scr siRNA C C LAT1 s iRNA1 CD98hc siRNA 1+2 LAT1 s iRNA2 CD98hc LAT1 siRNA 1+2

n=3 C D 60 n.s. 50

maKO1 24h y, % * c

WT1 24h a 40 %

i ,

maKO1 72h f y f 30

t * i E

l WT1 72h

i b g 20

a IC50 = 1.77E-06

n i i

t v

IC50 = 3.11E-06 10

a l l

l IC50 = 1.42E-07 e P 0

C IC50 = 3.01E-07 WT1 WT1 WT1 maKO1 maKO1 maKO1 DMSO BEZ235 BEZ235 DMSO BEZ235 BEZ235 10nM 50nM 10nM 50nM log10 [BEZ235], M n=3 Supplementary Figure 7

Regulation of Autophagy A C Overall survival of TCGA HNSCC patients maKO1 WT1 0Gy 4Gy 0Gy 4Gy F 100 n 1 2 3 1 2 3 1 2 3 1 2 3 ATG5 > Median 90

ATG5 < Median %

y t

80 i

l n > 3

b a

70 Individuals 258 259 i maKO1, BafA1, IC50 = 7.66E-07

Observed 114.00 101.00 v * l WT1, BafA1, IC50 = 1.44E-06 Expected 95.26 119.70 l

60 e Censored 144 158 maKO1, CQ, IC50 = 1.87E-06 % Log-Rank=6.616 C 50 p=1.011E-002 * WT1, CQ, IC50 = 4.96E-06

40 log10 [inhibitor], M 30

years . u .

a * , 9 y n=3 t i 8 - p < 0.05 n=3 v G i * t 7 * - p < 0.05 c B 1.6 D E 60 * * - p < 0.05 a 6

* 50 * n=3 7 * 50 / 5

1.2 45 3

y, % * y, % 4 e

40 c c 40 s

a 3 0.8 a 35 * * a c c i

30 p i 30 2 f f s f

f 25 0.4 * a 1 E

E 20

20 C 15 0 g g 0 10 d

n WT1 maKO1 n of ATG5 gene 10 e i i z t

t 5 i l Relative expression a a 0 Control Baf A1, 6,25nM l l 0 a WT1, WT1, WT1, maKO1, maKO1, maKO1, P P WT1 WT1 WT1 maKO1 maKO1 maKO1 m Baf A1, 12,5 nM Baf A1, 25 nM Scr ATG5 ATG5 Scr ATG5 ATG5 r

DMSO DMSO o siRNA siRNA#1 siRNA#2 siRNA siRNA#1 siRNA#2

N Baf A1, 50nM BafA1, 100nM n = 3 * - p < 0.05 BafA 10nM BafA 25nM BafA 10nM BafA 25nM Supplementary Figure 8 A C Patient 1 Patient 2 C-20 E-5 C-20 E-5

IgG control IgG control IgG control IgG control

D E-5 Biological repeat 1 Biological repeat 2

B CD98

G APDH

C-20 Biological repeat 1 Biological repeat 2

CD98

G APDH