DOCSLIB.ORG

Download (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

9 8 9 1 Caenarcaniphilales 9 8 Vampirovibrionales 7 9 9 2 Gastranaerophilales 9 7 Melainabacteria 95 9 9 Obscuribacterales 100 Oxyphotobacteria Sericytochromatia 0.05 Fig. S1. Maximum likelihood tree based on near-full length 16S rRNA genes (>1,200 bp) from the phylum Cyanobacteria. The tree was constructed using program FastTree. A total of 1,096 nucleotide positions were used with the GTR+G substitution model and 100 bootstrap resamplings. Sequences from the termite and cockroach gut samples fell into two orders shown in red. Samples from mammalian gastrointestinal tract 7 1 HM630178 from intestinal tract of herbivorous marine fish Naso tonganus JQ084643 from mice gut tissue CU920275 from mesophilic anaerobic digester which treats municipal wastewater sludge 6 4 GU208308 from Dongping Lake sediment 8 8 JN656845 from hypolimnion (hypoxic bottom) water from permafrost thaw pond KWK12 OTU-11710-MgMjD2 termite Macrotermes gilvus gut JPZV01257543 from whole body of Blatella germanica EF520515 from acid-impacted lake KC432436 from wetland JQ624955 from poplar biomass OTU-05081-DCn2-PRRqX from termite Dicuspiditermes nemorosus and Parrhinotermes sp. gut OTU-08574-SCaX from termite Schedorhinotermes sp. 1 gut OTU-19232-Rm from termite Reticulitermes miyatakei gut OTU-06201-Ra-Ry from termite Reticulitermes amamianus and Reticulitermes yaeyamanus gut OTU-21316-HETt from termite Heterotemes tenuior gut 8 4 OTU-18865-TcM2 from termite Termes comis gut OTU-19838-Tpq from termite Termes propinquus gut OTU-17247-LONl from termite Longitermes longipes gut OTU-21447-PRHj from termite Prorhinotermes japonicus gut OTU-08760-CKsX-PRRqX from termite Ceratokalotermes sp. and Parrhinotermes sp. gut OTU-16999-Ra from termite Reticulitermes amamianus gut OTU-19228-Rm from termite Reticulitermes miyatakei gut OTU-20701-Sv from termite Stolotermes victoriensis gut OTU-14014-SCaX from termite Schedorhinotermes sp. 2 gut OTU-12817-SCs from termite Schedorhinotermes sarawakensis gut EF453917 from termite Nasutitermes sp. gut OTU-13070-SCaX from termite Schedorhinotermes sp. 1 gut OTU-03304-NtTw from termite Nasutitermes takasagoensis gut OTU-04278-NtTw from termite Nasutitermes takasagoensis gut OTU-12118-Gf2 from termite Glyptotermes fuscus gut EF453956 from termite Nasutitermes sp. gut OTU-10360-Nl-Nl2 from termite Nasutitermes longinasus gut OTU-07803-HOSp from termite Hospitalitermes sp. gut 8 8 OTU-13805-HOSb from termite Hospitalitermes sp. 2 gut OTU-03592-Tp from termite Termitogeton planus gut OTU-12199-NtTw from termite Nasutitermes takasagoensis gut OTU-08388-PRRm2 from termite Parrhinotermes microdentiformis gut OTU-09609-HETp from termite Heterotermes paradoxus gut OTU-12792-Zn3-RsTz2 from termite Zootermopsis nevadensis and Reticulitermes speratus gut HM318898 from skin of human Homo sapiens OTU-05909-Cc3 from termite Cryptotermes cavifrons gut OTU-20951-Ntr from termite Nasutitermes toriodiae gut OTU-13172-GBg-HMe from termite Globitermes globosus and Homallotermes eleanorae gut OTU-21496-PRCx from termite Procapritermes sp. gut 7 0 AB089123 from termite Reticulitermes speratus gut JQ072402 from brewery wastewater clarifier outfall wet well 9 6 JX095405 from descending colon ingesta of cow Bos taurus GQ449145 from feces of cow Bos taurus OTU-21389-ORi from termite Oriensubulitermes inanis gut marine sponge 7 7 AB821786 from cattle rumen EU474510 from feces of bighorn sheep Ovis canadensis AB615061 from cattle rumen FJ680800 from MARC beef cattle fecal sample KT952876 from fish Zebrasoma xanthurum gut GQ064443 from skin of human Homo sapiens HM630179 from intestinal tract of herbivorous marine fish Naso tonganus OTU-04808-HOSm from termite Hospitalitermes medioflavus gut OTU-20000-Md2 from termite Mastotermes darwiniensis gut 8 6 OTU-05970-SCs-TGp from termite Schedorhinotermes sarawakensis and Termitogeton planus gut OTU-17104-TGp from termite Termitogeton planus gut OTU-07373-SGt-Tpq from cockroach Salganea taiwanensis and termite Termes propinquus gut 7 2 Tpq-Mel-01 (”Ca. Gastranaerophilus termiticola”) OTU-07911-HOSp from termite Hospitalitermes sp. 1 gut Detectable with OTU-14642-Pn from termite Pericapritermes nitobei gut probe MelTpq-646 9 1 OTU-19367-Tpq from termite Termes propinquus gut 8 8 AB612379 from cattle rumen EU871391 from rumen of cow Bos taurus 8 6 GQ448719 from fecal sample of cow Bos taurus 7 5 FJ684721 from MARC beef cattle fecal sample JQ084869 from NOD2 knockout mice gut tissue 9 9 OTU-00856-HOSb-HOSm from termite Hospitalitermes sp. 2 and Hospitalitermes medioflavus gut OTU-12430-Mm from termite Macrotermes malaccensis gut OTU-14997-Ra from termite Reticulitermes amamianus gut HM630217 from intestinal tract of herbivorous marine fish Naso tonganus Samples from mammalian gastrointestinal tract OTU-06217-CKsX from termite Ceraokalotermes sp. gut OTU-10310-Gs from termite Glyptotermes satsumensis gut OTU-14961-PRRm2 from termite Parrhinotermes microdentiformis gut OTU-15827-Zn3 from termite Zootermposis nevadensis gut OTU-11542-Sv-PRRqX from termite Stolotermes victoriensis and Parrhinotermes sp. gut OTU-12005-PRCx from termite Procapritermes sp. gut OTU-16207-Tc2 from termite Termes comis gut 8 4 OTU-20260-TcM from termite Termes comis gut AF544207 from rumen sample 9 2 AB615027 from cattle rumen 9 9 AB615027 from cattle rumen EF686586 from rumen fluid of Yunnan yellow cattle Bos taurus OTU-20360-Cp from cockroach Cryptocercus punctulatus gut : Cockroaches AB824324 from rumen of swamp buffalo Bubalus bubalis : Mastotermitidae : Archotermopsidae OTU-02817-CKsX from termite Ceratokalotermes sp. gut : Stolotermitidae LC028872 from feces of Thai native cattle : Kalotermitidae 6 1 OTU-15874-Cp from cockroach Cryptocercus punctulatus gut : Rhinotermitidae : Termitidae Continued to OTU-11550-RsTz2 from termite Reticulitermes speratus gut Fig.S2-2 OTU-20080-Pa from cockroach Panesthia angustipennis gut Fig.S2-1 0.05 Continued 6 5 KC163104 from rumen of yak Bos grunniens from Fig.S2-1 9 6 GQ451200 from feces of Yunnan snub-nosed monkey Rhinopithecus bieti GU303703 from rumen contents of HEAN cow (Hereford x Angus) OTU-13788-DRr from termite Drepanotermes rubriceps gut OTU-02378-HOSp-HOSm from termite Hospitalitermes sp. 1 and Hospitalitermes medioflavus gut 6 9 7 3 7 6 OTU-09455-Ntr from termite Nasutitermes toriodiae gut OTU-16640-TcM from termite Termes comis gut OTU-18253-PHm from termite Prohamitermes mirabilis gut OTU-20218-SCmX from termite Schedorhinotermes medioobscurus gut 8 2 OTU-20228-SPEx from termite Speculitermes sp. gut OTU-23126-Tpq from termite Termes propinquus gut OTU-14675-Ra from termite Reticulitermes amamianus gut 7 4 OTU-23100-SCaX from termite Schedorhinotermes sp. 1 gut OTU-19474-HOSm from termite Hospitalitermes medioflavus gut GQ133151 from ASBR reactor treating swine waste KM250940 from biochemical reactor 20-30cm core 9 9 AB494943 from sheep rumen KR067986 from rumen of yak Bos grunniens 7 5 OTU-05986-Gf2 from termite Glyptotermes fuscus gut 7 8 OTU-11641-CKsX from termite Ceratokalotermes sp. gut OTU-17418-PRRqX from termite Parrhinotermes sp. gut OTU-04806-Gs-NinX from termite Glyptotermes satsumensis and Neotermes sp. gut 9 0 OTU-05309-SCaX from termite Schedorhinotermes sp. 1 gut OTU-14285-PHm from termite Prohamitermes mirabilis gut OTU-08630-HOSm from termite Hospitalitermes medioflavus gut OTU-16158-RsTz2 from termite Reticulitermes speratus gut KJ874130 from equine reproductive tract JN513216 from Guerrero Negro Hypersaline Mat 08 9 6 HQ153911 from white microbial film on pebble substrate in the aphotic zone of a shallow hydrothermal vent KF758589 from ocean water JN487386 from Guerrero Negro Hypersaline Mat 06 7 3 Guerrero Negro Hypersaline Mat AB806170 from ocean drilling core sample Japan Shimokita Penninsula offshore Guerrero Negro Hypersaline Mat JQ611100 from biofilm near yellow vent off Kueishan Island 7 2 FR828711 from Chattam municipal waste water treatment plant 9 5 FR853013 from active hydrothermal chimney in Dudley site of Juan de Fuca Ridge 9 8 JN435590 from Guerrero Negro Hypersaline Mat 01 JN448577 from Guerrero Negro Hypersaline Mat 02 9 8 Guerrero Negro Hypersaline Mat 9 8 Guerrero Negro Hypersaline Mat KC358057 from large-discharge carbonate springs in Mojave Desert KC358460 from roundwater from tectonically-formed cavern in Devils Hole water column JN514452 from Guerrero Negro Hypersaline Mat 08 JQ625024 from poplar biomass Guerrero Negro Hypersaline Mat Guerrero Negro Hypersaline Mat 8 6 JX221840 from subsurface aquifer sediment JX223309 from subsurface aquifer sediment JN626528 from methane seep under ice cover in Lake Qalluuraq Alaska 6 5 KM410581 from biofilm in subsurface sulfidic cave stream AB240501 from root-base of phragmites at Sosei River in Sapporo, Japan JN445974 from Guerrero Negro Hypersaline Mat 02 9 9 AB240326 from rhizosphere biofilm of lab-scale reed bed reactor AF289160 from water in Parker River, USA AJ853587 from landfill leachate 9 2 JX224053 from subsurface aquifer sediment : Cockroaches JQ624966 from poplar biomass : Mastotermitidae 9 8 KJ578047 from soil in Yong Ding river : Archotermopsidae HQ178778 from sediment in Central Park, USA : Stolotermitidae : Kalotermitidae Guerrero Negro Hypersaline Mat : Rhinotermitidae : Termitidae JQ861864 from diesel-contaminated ground water OTU-14988-PRCx from termite Procapritermes sp. gut OTU-11644-CKsX-SCs from termite Ceratokalotermes sp. and Schedorhinotermes sarawakensis gut 7 4 OTU-22558-MgMjD2 from termite Macrotermes gilvus gut 0.05 Fig. S2-2. Phylogenetic positions of 16S rRNA gene sequences
Recommended publications
  • Termites (Isoptera) in the Azores: an Overview of the Four Invasive Species Currently Present in the Archipelago

    Termites (Isoptera) in the Azores: an Overview of the Four Invasive Species Currently Present in the Archipelago

    Arquipelago - Life and Marine Sciences ISSN: 0873-4704 Termites (Isoptera) in the Azores: an overview of the four invasive species currently present in the archipelago MARIA TERESA FERREIRA ET AL. Ferreira, M.T., P.A.V. Borges, L. Nunes, T.G. Myles, O. Guerreiro & R.H. Schef- frahn 2013. Termites (Isoptera) in the Azores: an overview of the four invasive species currently present in the archipelago. Arquipelago. Life and Marine Sciences 30: 39-55. In this contribution we summarize the current status of the known termites of the Azores (North Atlantic; 37-40° N, 25-31° W). Since 2000, four species of termites have been iden- tified in the Azorean archipelago. These are spreading throughout the islands and becoming common structural and agricultural pests. Two termites of the Kalotermitidae family, Cryp- totermes brevis (Walker) and Kalotermes flavicollis (Fabricius) are found on six and three of the islands, respectively. The other two species, the subterranean termites Reticulitermes grassei Clemént and R. flavipes (Kollar) of the Rhinotermitidae family are found only in confined areas of the cities of Horta (Faial) and Praia da Vitória (Terceira) respectively. Due to its location and weather conditions the Azorean archipelago is vulnerable to coloni- zation by invasive species. The fact that there are four different species of termites in the Azores, all of them considered pests, is a matter of concern. Here we present a comparative description of these species, their known distribution in the archipelago, which control measures are being used against them, and what can be done in the future to eradicate and control these pests in the Azores.
  • Blattodea: Hodotermitidae) and Its Role As a Bioindicator of Heavy Metal Accumulation Risks in Saudi Arabia

    Blattodea: Hodotermitidae) and Its Role As a Bioindicator of Heavy Metal Accumulation Risks in Saudi Arabia

    Article Characterization of the 12S rRNA Gene Sequences of the Harvester Termite Anacanthotermes ochraceus (Blattodea: Hodotermitidae) and Its Role as A Bioindicator of Heavy Metal Accumulation Risks in Saudi Arabia Reem Alajmi 1,*, Rewaida Abdel-Gaber 1,2,* and Noura AlOtaibi 3 1 Zoology Department, College of Science, King Saud University, Riyadh 11451, Saudi Arabia 2 Zoology Department, Faculty of Science, Cairo University, Cairo 12613, Egypt 3 Department of Biology, Faculty of Science, Taif University, Taif 21974, Saudi Arabia; [email protected] * Correspondence: [email protected] (R.A.), [email protected] (R.A.-G.) Received: 28 December 2018; Accepted: 3 February 2019; Published: 8 February 2019 Abstract: Termites are social insects of economic importance that have a worldwide distribution. Identifying termite species has traditionally relied on morphometric characters. Recently, several mitochondrial genes have been used as genetic markers to determine the correlation between different species. Heavy metal accumulation causes serious health problems in humans and animals. Being involved in the food chain, insects are used as bioindicators of heavy metals. In the present study, 100 termite individuals of Anacanthotermes ochraceus were collected from two Saudi Arabian localities with different geoclimatic conditions (Riyadh and Taif). These individuals were subjected to morphological identification followed by molecular analysis using mitochondrial 12S rRNA gene sequence, thus confirming the morphological identification of A. ochraceus. Furthermore, a phylogenetic analysis was conducted to determine the genetic relationship between the acquired species and other termite species with sequences previously submitted in the GenBank database. Several heavy metals including Ca, Al, Mg, Zn, Fe, Cu, Mn, Ba, Cr, Co, Be, Ni, V, Pb, Cd, and Mo were measured in both collected termites and soil samples from both study sites.
  • Novel Lineages of Oxymonad Flagellates from the Termite Porotermes Adamsoni (Stolotermitidae): the Genera Oxynympha and Termitim

    Novel Lineages of Oxymonad Flagellates from the Termite Porotermes Adamsoni (Stolotermitidae): the Genera Oxynympha and Termitim

    Protist, Vol. 170, 125683, December 2019 http://www.elsevier.de/protis Published online date 21 October 2019 ORIGINAL PAPER Novel Lineages of Oxymonad Flagellates from the Termite Porotermes adamsoni (Stolotermitidae): the Genera Oxynympha and Termitimonas a,1 b a c b,1 Renate Radek , Katja Meuser , Samet Altinay , Nathan Lo , and Andreas Brune a Evolutionary Biology, Institute for Biology/Zoology, Freie Universität Berlin, 14195 Berlin, Germany b Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, 35043 Marburg, Germany c School of Life and Environmental Sciences, The University of Sydney, Sydney, NSW 2006, Australia Submitted January 21, 2019; Accepted October 9, 2019 Monitoring Editor: Alastair Simpson The symbiotic gut flagellates of lower termites form host-specific consortia composed of Parabasalia and Oxymonadida. The analysis of their coevolution with termites is hampered by a lack of informa- tion, particularly on the flagellates colonizing the basal host lineages. To date, there are no reports on the presence of oxymonads in termites of the family Stolotermitidae. We discovered three novel, deep-branching lineages of oxymonads in a member of this family, the damp-wood termite Porotermes adamsoni. One tiny species (6–10 ␮m), Termitimonas travisi, morphologically resembles members of the genus Monocercomonoides, but its SSU rRNA genes are highly dissimilar to recently published sequences of Polymastigidae from cockroaches and vertebrates. A second small species (9–13 ␮m), Oxynympha loricata, has a slight phylogenetic affinity to members of the Saccinobaculidae, which are found exclusively in wood-feeding cockroaches of the genus Cryptocercus, the closest relatives of termites, but shows a combination of morphological features that is unprecedented in any oxymonad family.
  • Structure, Function and Evolution of the Labral and Frontal Glands in Termites Valeria Danae Palma Onetto

    Structure, Function and Evolution of the Labral and Frontal Glands in Termites Valeria Danae Palma Onetto

    Structure, function and evolution of the labral and frontal glands in termites Valeria Danae Palma Onetto To cite this version: Valeria Danae Palma Onetto. Structure, function and evolution of the labral and frontal glands in termites. Populations and Evolution [q-bio.PE]. Université Sorbonne Paris Cité, 2019. English. NNT : 2019USPCD027. tel-03033808 HAL Id: tel-03033808 https://tel.archives-ouvertes.fr/tel-03033808 Submitted on 1 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ PARIS 13, SORBONNE PARIS CITÉ ECOLE DOCTORALE GALILEÉ THESE présentée pour l’obtention du grade de DOCTEUR DE L’UNIVERSITE PARIS 13 Spécialité: Ethologie Structure, function and evolution Defensiveof the labral exocrine and glandsfrontal glandsin termites in termites Présentée par Valeria Palma–Onetto Sous la direction de: David Sillam–Dussès et Jan Šobotník Soutenue publiquement le 28 janvier 2019 JURY Maria Cristina Lorenzi Professeur, Université Paris 13 Présidente du jury Renate Radek Professeur, Université Libre de Berlin Rapporteur Yves Roisin Professeur,
  • Order Blattodea*

    Order Blattodea*

    Zootaxa 3703 (1): 046–048 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Correspondence ZOOTAXA Copyright © 2013 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3703.1.10 http://zoobank.org/urn:lsid:zoobank.org:pub:72196B26-433A-4816-90B3-9EC15495E1B4 Order Blattodea* GEORGE BECCALONI1 & PAUL EGGLETON2 1Curator of orthopteroid insects, Life Sciences Department, Terrestrial Invertebrates Division, The Natural History Museum, London SW7 5BD, UK; email: [email protected] 2Merit Researcher, Life Sciences Department, Terrestrial Invertebrates Division, The Natural History Museum, London SW7 5BD, UK * In: Zhang, Z.-Q. (Ed.) Animal Biodiversity: An Outline of Higher-level Classification and Survey of Taxonomic Richness (Addenda 2013). Zootaxa, 3703, 1–82. Abstract The Blattodea comprise the termites (epifamily Termitoidae only) and the cockroaches (all other taxa). 7570 living species of Blattodea are currently recognised, of which 2929 are termites (Krishna et al. 2013) and 4641 are cockroaches (Beccaloni 2007) . Key words: Blattodea, cockroaches, termites, classification, diversity Introduction The Blattodea comprise the termites (epifamily Termitoidae only) and the cockroaches (all other taxa). Beccaloni and Eggleton (2011) recognized 7314 extant named species of Blattodea, including 2692 termites and 4622 cockroaches and. In this update, 7570 living species of Blattodea are currently recognised, of which 2929 are termites (Krishna et al. 2013) and 4641 are cockroaches (Beccaloni 2007) . Inward, Beccaloni & Eggleton (2007) and subsequent phylogenetic studies (Legendre et al. 2008; Ware et al. 2008; Cameron et al. 2012; Djernaes et al. 2012; Xiao et al. 2012) have confirmed that the termites and the cockroach family Cryptocercidae are sister groups and that this clade is nested within the Blattodea.
  • The Diversification of Termites: Inferences from a Complete Species-Level Phylogeny

    The Diversification of Termites: Inferences from a Complete Species-Level Phylogeny

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.07.414342; this version posted December 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 The diversification of termites: inferences from a complete species-level phylogeny Marcio R. Pie1,*, Tiago F. Carrijo & Fernanda S. Caron1 1Departamento de Zoologia, Universidade Federal do Paraná, C.P 19020, Curitiba PR 81531- 990, Brazil 2Centro de Ciências Naturais e Humanas, Universidade Federal do ABC, São Bernardo do Campo, Brazil *Author for correspondence: Departamento de Zoologia, Universidade Federal do Paraná. C.P. 19020. 81531-990 Curitiba, PR, Brazil. Phone: +55(41) 3361-1558. Email: [email protected] Declarations of interest: none. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.07.414342; this version posted December 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 2 Abstract Termites play a major role in a variety of ecological processes in tropical and subtropical biomes worldwide, such as decomposition, soil formation and aeration, and nutrient cycling. These important ecosystem services were achieved through their highly complex societies and remarkable adaptations, including the evolution of sterile worker castes, the acquisition of endosymbionts, and the capacity for extensive environmental engineering, yet the causes and consequences of their ecological success are still poorly understood.
  • Blattodea Karyotype Database

    Blattodea Karyotype Database

    EUROPEAN JOURNAL OF ENTOMOLOGYENTOMOLOGY ISSN (online): 1802-8829 Eur. J. Entomol. 118: 192–199, 2021 http://www.eje.cz doi: 10.14411/eje.2021.020 ORIGINAL ARTICLE Blattodea Karyotype Database MAREK JANKÁSEK 1 , ZUZANA KOTYKOVÁ VARADÍNOVÁ 1,2 and FRANTIŠEK ŠŤÁHLAVSKÝ 1 1 Department of Zoology, Faculty of Science, Charles University, Viničná 7, 128 44 Praha 2, Czech Republic; e-mails: [email protected], [email protected], [email protected] 2 Department of Zoology, National Museum, Václavské náměstí 68, 115 79 Praha 1, Czech Republic Key words. Blattodea, Isoptera, cockroach, termite, chromosome number, karyotype, meiosis, sex chromosome system, online database Abstract. We present an open (publicly available) and updatable database of the karyotypes of Blattodea which is available at http://web.natur.cuni.cz/zoologie/arthropods/blattodeadatabase/index.html. This database currently contains data on chromo- some numbers and sex chromosome systems for 355 (209 cockroaches and 146 termites) cytogenetically and/or geographically distinct populations of 229 species (138 cockroaches and 91 termites). When available, data on chromosome morphology and fundamental number are also included. As this summary of the data on Blattodea cytogenetics follows current taxonomy and phy- logeny it enabled us to discuss hypotheses on karyotype evolution. We also point out some cytogenetically interesting phenomena such as extensive karyotype differentiation at low taxonomic levels in some lineages and the change from the X0 sex chromosome system, which is present in cockroaches, to systems with multiple neo-sex chromosomes, present in termites. We encourage the use of modern cytogenetic methods in research on Blattodea cytogenetics to uncover more detailed mechanisms of karyotype evolution in this insect order.
  • Blattodea : Cryptocercidae): Species Delimitation Based on Chromosome Numbers, Morphology and Molecular Analysis

    Blattodea : Cryptocercidae): Species Delimitation Based on Chromosome Numbers, Morphology and Molecular Analysis

    Invertebrate Systematics 2017, 32, 69–91 © CSIRO 2018 doi:10.1071/IS17003_AC Supplementary material Exploring the diversity of Asian Cryptocercus (Blattodea : Cryptocercidae): species delimitation based on chromosome numbers, morphology and molecular analysis Qikun BaiA, Lili WangA, Zongqing WangA, Nathan LoB and Yanli CheA,C ACollege of Plant Protection, Southwest University, Beibei, Chongqing 400716, P.R. China. BSchool of Life and Environmental Sciences, The University of Sydney, Sydney, NSW 2006, Australia. CCorresponding author. Email: [email protected] Page 1 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC Table S1. The primers and references for COI and 28S rRNA Gene Primer Sequence (5–3) Reference COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994 HCO2198 TAAACTTCAGGGTGACCAAAAAATCA COI COI f ACAAATCATAAAGACATTGG COI r TTCTGGGTGACCGAAGAATCA 28S 28S f AAACACGGACCAAGGAGTCTAAC rRNA 28S r CTAGTTGCTTCGGCAGGTGAGTTGTTA Page 2 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC Table S2. Termite outgroups used in this study and GenBank accession number N/A, not available Species Family Reference Accession number COI 28S rRNA Mastotermes darwiniensis Mastotermitidae Legendre et al. 2008 EU253846 DQ441950 Hodotermopsis sjostedti Archotermopsidae Bourguignon et al. 2015 KP026259 DQ441931 Zootermopsis angusticollis Archotermopsidae Cameron et al. 2012 JX144932 AY859614 Microhodotermes viator Hodotermitidae Cameron et al. 2012 NC018122 DQ441959 Porotermes adamsoni Stolotermitidae Cameron et al. 2012 NC018121 N/A Cryptotermes secundus Kalotermitidae Bourguignon et al. 2015 KP026283 DQ441901 Glyptotermes satsumensis Kalotermitidae Bourguignon et al. 2015 KP026257 N/A Glyptotermes sp A Kalotermitidae Bourguignon et al. 2015 KP026263 N/A Glyptotermes sp B Kalotermitidae Bourguignon et al. 2015 KP026301 N/A Glyptotermes sp C Kalotermitidae Bourguignon et al. 2015 KP026300 N/A Neotermes insularis Kalotermitidae Cameron et al.
  • Nest-Sharing Among a Termite Host and Its Obligatory Inquiline

    Nest-Sharing Among a Termite Host and Its Obligatory Inquiline

    PAULO FELLIPE CRISTALDO NEST-SHARING AMONG A TERMITE HOST AND ITS OBLIGATORY INQUILINE Tese apresentada `aUniversidade Federal de Vi¸cosa, como parte das exigˆencias do Pro- grama de P´os-Gradua¸c˜aoem Entomologia, para obten¸c˜aodo t´ıtulo de Doctor Scientiae. VI ¸COSA MINAS GERAIS - BRASIL 2014 ii A minha fam´ılia, pelo apoio e dedica¸c˜aoao longo da minha vida. iii AGRADECIMENTOS A` Universidade Federal de Vi¸cosa e ao Programa de P´os-Gradua¸c˜aoem En- tomologia pela oportunidade, aprendizado e estrutura concedida para a realiza¸c˜ao deste trabalho. Ao Conselho Nacional de Desenvolvimento Cient´ıfico e Tecnol´ogico (CNPq) pela bolsa de doutorado (140085/2010-6), ao Programa de Doutorado Sandu´ıche no Ex- terior da Coordena¸c˜aode Aperfei¸coamento de Pessoal de N´ıvel Superior (PDSE - CAPES) pela bolsa de doutorado sandu´ıche (PDSE 9669/11-6) e a Funda¸c˜aode Am- paro `aPesquisa do Estado de Minas Gerais (FAPEMIG) pelo financiamento parcial desta pesquisa (CRA-APQ-01519-11 e BPV-00055-11). Ao meu orientador Og DeSouza por estes seis anos de ensinamentos, orienta¸c˜ao e dedica¸c˜ao;por ter ’aberto’ a porta da pesquisa me conduzindo sempre de maneira ´etica, pela cr´ıticas que me fizeram sempre buscar o meu melhor e pela confian¸ca que me fez acreditar que estava no caminho certo. Durantes estes anos aprendi muito com vocˆe! Muito Obrigado! Aos meus coorientadores Eraldo R. Lima e Simon L. Elliot pela disponibilidade e ajuda em todos os momentos. Aos membros da banca de qualifica¸c˜ao: Alexandre Vasconcellos, Fl´avia M.
  • Genetic Variation and Species Distribution of Subterranean Termites in the Southeastern U.S

    Genetic Variation and Species Distribution of Subterranean Termites in the Southeastern U.S

    University of Arkansas, Fayetteville ScholarWorks@UARK Theses and Dissertations 7-2015 Genetic Variation and Species Distribution of Subterranean Termites in the Southeastern U.S. Focusing on Family Structure and the Invasive Formosan Subterranean Termite Mark Allan Janowiecki University of Arkansas, Fayetteville Follow this and additional works at: http://scholarworks.uark.edu/etd Part of the Entomology Commons, and the Genetics Commons Recommended Citation Janowiecki, Mark Allan, "Genetic Variation and Species Distribution of Subterranean Termites in the Southeastern U.S. Focusing on Family Structure and the Invasive Formosan Subterranean Termite" (2015). Theses and Dissertations. 1221. http://scholarworks.uark.edu/etd/1221 This Thesis is brought to you for free and open access by ScholarWorks@UARK. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of ScholarWorks@UARK. For more information, please contact [email protected], [email protected]. Genetic Variation and Species Distribution of Subterranean Termites in the Southeastern U.S. Focusing on Family Structure and the Invasive Formosan Subterranean Termite A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Entomology by Mark Allan Janowiecki The Ohio State University Bachelor of Science in Entomology, 2012 July 2015 University of Arkansas This thesis is approved for recommendation to the Graduate Council _____________________________ Dr. Allen L. Szalanski Thesis Director _____________________________ _____________________________ Dr. Donn Johnson Dr. Joe DeMark Committee Member Committee Member ABSTRACT This work applies molecular genetic tools to distinguish the identity and understand the biology of termites, particularly Reticulitermes Holmgren and Coptotermes formosanus Shiraki (Isoptera: Rhinotermitidae) in the southeastern U.S.
  • Diversity of Termite Breeding Systems

    Diversity of Termite Breeding Systems

    insects Review Diversity of Termite Breeding Systems Edward L. Vargo Department of Entomology, Texas A&M University, College Station, TX 77843, USA; [email protected]; Tel.: +1-979-845-5855 Received: 14 December 2018; Accepted: 30 January 2019; Published: 12 February 2019 Abstract: Termites are social insects that live in colonies headed by reproductive castes. The breeding system is defined by the number of reproductive individuals in a colony and the castes to which they belong. There is tremendous variation in the breeding system of termites both within and among species. The current state of our understanding of termite breeding systems is reviewed. Most termite colonies are founded by a primary (alate-derived) king and queen who mate and produce the other colony members. In some species, colonies continue throughout their life span as simple families headed by the original king and queen. In others, the primary king and queen are replaced by numerous neotenic (nymph- or worker-derived) reproductives, or less commonly primary reproductives, that are descendants of the original founding pair leading to inbreeding in the colony. In still others, colonies can have multiple unrelated reproductives due to either founding the colonies as groups or through colony fusion. More recently, parthenogenetic reproduction has shown to be important in some termite species and may be widespread. A major challenge in termite biology is to understand the ecological and evolutionary factors driving the variation in termite breeding systems. Keywords: reproductives; king; queen; neotenics; parthenogenesis 1. Introduction Like all eusocial insects, termites have a reproductive division of labor in which specialized castes reproduce and other members of the colony work on their behalf.
  • 5 Sociality in Termites

    5 Sociality in Termites

    Comp. by: SUNDARAVARADARAJULU Stage: Proof Chapter No.: 5 Title Name: RubensteinAndAbbot Date:7/12/16 Time:12:49:21 Page Number: 124 5 Sociality in Termites Judith Korb and Barbara Thorne Overview Termites are biologically unique because, across all known living creatures, termites have the most diverse array of distinct body forms encoded by a single genome. These different morphologies characterize separate castes within termite societies, including up to three types of reproductives of each sex, and depending upon the species, several castes of workers and soldiers. No microbe, plant, or animal – including other eusocial taxa – rival the breadth of polyphenism found within termite species. The exceptional behavioral and physiological specializations facilitated by varying internal and external morphologies of these diversified castes, and the resulting flexibility and adaptability afforded an integrated colony, comprise one of the fundamental drivers of termites’ ecological success and evolutionary radiation. Another key component of termite abundance and prosperity in many ecosystems is their exclusive niche among eusocial insects (as well as most of other animals): termites feed and often nest in or around dead plant material. Although a cellulose-based diet has its challenges, termites have evolved “clever” innovations to thrive as detritivores. Exploiting the vast and relatively uncrowded plant decomposer niche has contributed to termites’ success, and has rendered their activities critical to nutrient cycles and other essential dynamics of tropical forests, savannahs, and other ecosystems. ISOCIALDIVERSITY 5.1 How Common is Sociality in Termites? Termites are “eusocial cockroaches,” a monophyletic clade of diploid insects (Infra- order Isoptera) within the order Blattaria (Inward et al., 2007a; Lo et al., 2007; Engel et al., 2009; Krishna et al., 2013).