sign in sign up
<<
Home , Archotermopsidae, Cryptocercus, Heterotermitinae, Hodotermitidae, Serritermitidae, Stolotermitidae

Invertebrate Systematics 2017, 32, 69–91 © CSIRO 2018 doi:10.1071/IS17003_AC

Supplementary material

Exploring the diversity of Asian ( : Cryptocercidae): delimitation based on chromosome numbers, morphology and molecular analysis

Qikun BaiA, Lili WangA, Zongqing WangA, Nathan LoB and Yanli CheA,C

ACollege of Plant Protection, Southwest University, Beibei,

Chongqing 400716, P.R. China.

BSchool of Life and Environmental Sciences, The University of Sydney,

Sydney, NSW 2006, Australia.

CCorresponding author. Email: [email protected]

Page 1 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC

Table S1. The primers and references for COI and 28S rRNA Gene Primer Sequence (5–3) Reference COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994 HCO2198 TAAACTTCAGGGTGACCAAAAAATCA COI COI f ACAAATCATAAAGACATTGG COI r TTCTGGGTGACCGAAGAATCA 28S 28S f AAACACGGACCAAGGAGTCTAAC rRNA 28S r CTAGTTGCTTCGGCAGGTGAGTTGTTA

Page 2 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC

Table S2. outgroups used in this study and GenBank accession number

N/A, not available

Species Reference Accession number COI 28S rRNA darwiniensis Mastotermitidae Legendre et al. 2008 EU253846 DQ441950 Hodotermopsis sjostedti Bourguignon et al. 2015 KP026259 DQ441931 angusticollis Archotermopsidae Cameron et al. 2012 JX144932 AY859614 viator Cameron et al. 2012 NC018122 DQ441959 Porotermes adamsoni Cameron et al. 2012 NC018121 N/A Cryptotermes secundus Bourguignon et al. 2015 KP026283 DQ441901 Glyptotermes satsumensis Kalotermitidae Bourguignon et al. 2015 KP026257 N/A Glyptotermes sp A Kalotermitidae Bourguignon et al. 2015 KP026263 N/A Glyptotermes sp B Kalotermitidae Bourguignon et al. 2015 KP026301 N/A Glyptotermes sp C Kalotermitidae Bourguignon et al. 2015 KP026300 N/A Neotermes insularis Kalotermitidae Cameron et al. 2012 NC018124 N/A Rugitermes sp. A Kalotermitidae Bourguignon et al. 2015 KP026284 N/A Glossotermes oculatus Bourguignon et al. 2015 KP026291 JN647689 Serritermes serrifer Serritermitidae Bourguignon et al. 2015 KP026264 N/A Coptotermes formosanus Coptotermitinae Tokuda et al. 2012 NC015800 N/A Coptotermes lacteus Coptotermitinae Cameron et al. 2012 NC018125 FJ806530 sp. Heterotermitinae Cameron et al. 2012 NC018127 N/A flavipes Heterotermitinae Cameron and Whiting 2007 EF206317 N/A Reticulitermes santonensis Heterotermitinae Cameron and Whiting 2007 NC009499 FJ806531 Prorhinotermes canalifrons Bourguignon et al. 2015 KP026256 N/A Dolichorhinotermes longilabius Rhinotermitidae Bourguignon et al. 2015 KP026258 N/A

Page 3 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC

Species Family Reference Accession number COI 28S rRNA Parrhinotermes browni Rhinotermitidae Bourguignon et al. 2015 KP026295 N/A Schedorhinotermes breinli Rhinotermitidae Cameron et al. 2012 NC018126 N/A Termitogeton planus Rhinotermitidae Bourguignon et al. 2015 KP026298 DQ442039 Ancistrotermes pakistanicus Bourguignon et al. 2015 KP026267 N/A Macrotermes barneyi Termitidae Wei et al. 2012 NC018599 N/A Odontotermes formosanus Termitidae Bourguignon et al. 2015 KP026254 JQ429094 Sphaerotermes sphaerothorax Termitidae Bourguignon et al. 2015 KP026279 JQ429097 Astalotermes sp. Termitidae Bourguignon et al. 2015 KP026272 DQ441874 Ateuchotermes sp. Termitidae Bourguignon et al. 2015 KP026274 N/A Anoplotermes-group sp E1 Termitidae Bourguignon et al. 2015 KP026287 N/A Duplidentitermes sp. Termitidae Bourguignon et al. 2015 KP026271 N/A Jugositermes tuberculatus Termitidae Bourguignon et al. 2015 KP026269 DQ441938 Cubitermes fungifaber Termitidae Bourguignon et al. 2015 KP026265 DQ441903 Drepanotermes sp. Termitidae Cameron et al. 2012 NC018129 N/A Microcerotermes biroi Termitidae Bourguignon et al. 2015 KP026297 N/A Neocapritermes araguaia Termitidae Bourguignon et al. 2015 KP026286 N/A Pericapritermes nigerianus Termitidae Bourguignon et al. 2015 KP026278 DQ442004 Constrictotermes cavifrons Termitidae Bourguignon et al. 2015 KP026290 JQ429100 Nasutitermes bikpelanus Termitidae Bourguignon et al. 2015 KP026296 N/A Postsubulitermes parviconstrictus Termitidae Bourguignon et al. 2015 KP026268 N/A Embiratermes neotenicus Termitidae Bourguignon et al. 2015 KP026262 N/A Labiotermes labralis Termitidae Bourguignon et al. 2015 KP026292 N/A Syntermes spinosus Termitidae Bourguignon et al. 2015 KP026293 N/A

Page 4 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC

Table S3. Pairwise genetic divergence (K2P) of Cryptocercus species using cytochromecoxidase subunit I (COI) gene sequences

All genetic distances (%) were corrected with the Kimura two-parameter (K2P) substitution model using MEGA 6; extreme values of intraspecific and interspecific distances are given (the numbers in bold are the intraspecific distances)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 C. laojunensis sp. nov. 0.20 2 C. pudacuoensis sp. nov. 10.15 0.00 3 C. habaensis 12.19 9.13 0.00 4 C. shangmengensis 10.94 9.49 11.01 0.10 5 C. zagunaoensis 11.76 10.65 10.18 8.56 0.00 6 C. tianbaensis sp. nov. 11.07 10.65 11.77 8.84 8.92 0.00 7 C. banshanmenensis sp. nov 11.60 9.12 10.40 8.88 6.51 8.64 0.00 8 C. wolongensis sp. nov. 12.52 9.78 10.90 8.16 8.07 9.46 7.95 0.00 9 C. neixiangensis 13.13 11.79 12.57 12.15 14.28 12.71 14.55 13.76 0.20 10 C. luanchuanensis sp. nov. 13.45 12.31 12.66 12.90 13.30 12.15 13.94 13.60 2.18 0.34 11 C. chengkouensis sp. nov. 14.90 15.30 13.56 13.88 14.78 14.70 15.09 15.72 7.49 8.76 0.00 12 C. arcuatus 11.49 9.54 3.67 11.98 10.59 12.18 11.55 12.43 13.56 14.03 13.80 0.10 13 C. pingwuensis 11.75 10.95 10.46 7.91 6.49 8.17 6.70 8.02 13.00 12.50 14.84 11.80 0.15 14 C. meridianus 11.21 10.34 10.72 10.56 10.68 10.32 10.14 11.09 12.75 12.84 13.57 10.41 11.53 0.00 15 C. wuxiensis 13.03 14.08 13.49 13.00 15.09 14.10 16.03 15.64 6.24 7.08 4.86 13.16 14.24 14.07 0.10 16 C. hirtus 14.00 13.44 12.13 12.80 14.26 13.05 14.76 13.67 6.35 7.59 3.50 12.55 13.55 12.70 3.61 0.26 17 C. convexus 11.07 8.56 10.00 7.96 5.05 7.38 3.37 7.07 13.84 13.61 13.22 10.95 5.64 9.63 13.93 12.53 0.00 18 C. shennongjiaensis 14.22 13.20 12.73 13.41 13.57 13.47 14.03 13.67 6.78 7.38 6.50 12.78 13.24 13.28 6.95 5.71 12.69 0.30 19 C. ningshanensis 13.82 12.32 12.13 12.62 13.70 13.24 14.48 13.28 6.22 7.50 4.55 12.74 13.28 13.64 4.20 3.33 12.25 6.20 0.08 20 C. relictus 12.71 12.23 11.46 11.25 11.12 11.11 11.81 13.61 14.12 13.82 13.92 11.61 11.82 10.66 13.79 13.62 10.75 13.18 14.39 0.16 21 C. metilei 9.56 11.07 10.56 7.14 7.92 7.74 8.66 9.14 13.32 13.28 14.36 11.72 7.16 10.32 14.12 14.04 7.57 13.90 14.05 11.50 0.00 22 C. primarius 9.30 8.56 9.50 6.52 7.40 6.38 7.47 8.29 11.76 12.34 13.22 9.55 7.70 9.63 13.38 12.16 6.57 12.76 12.72 11.17 6.40 0.00 23 C. weixiensis sp. nov. 5.84 8.50 9.76 8.94 10.63 8.34 10.09 10.62 11.66 11.54 13.70 10.35 9.03 9.72 12.23 11.53 9.04 13.03 10.98 11.39 9.53 8.02 0.20 24 C. changbaiensis sp. nov. 11.26 11.45 10.92 10.49 9.52 10.72 10.97 11.31 11.93 12.20 14.19 11.33 9.96 10.87 13.15 13.10 10.20 14.10 12.92 11.04 8.79 10.04 10.85 0.00 25 C. kyebangensis 10.33 10.53 11.26 12.30 10.00 12.56 11.88 13.53 14.12 14.02 15.47 11.31 10.85 12.16 14.61 14.43 10.56 14.53 14.38 13.04 10.72 10.36 11.01 7.93 N/A 26 Crptocercus sp1 15.77 13.91 14.85 14.31 14.25 16.53 14.29 15.04 18.70 19.07 19.44 15.09 14.20 14.84 18.03 18.87 12.96 16.76 18.67 17.37 13.73 14.67 14.69 16.73 16.54 N/A 27 Crptocercus sp2 14.91 14.15 14.96 16.41 15.72 16.07 15.28 16.14 18.61 18.51 20.45 14.95 14.66 15.52 17.90 18.79 14.72 17.17 19.15 16.74 13.94 13.15 13.98 17.14 17.14 9.69 N/A 28 C. darwini 15.28 14.76 15.34 15.28 16.17 15.54 14.76 16.23 19.71 19.54 20.36 15.20 15.17 15.10 18.72 18.76 14.08 17.05 19.07 16.84 14.46 13.53 14.38 16.97 16.67 9.41 3.63 0.61

Page 5 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC

Table S4. Pairwise genetic divergence (K2P) of Cryptocercus species using 28S rRNA gene sequences All genetic distances (%) were corrected with the Kimura two-parameter (K2P) substitution model using MEGA 6; extreme values of intraspecific and interspecific distances are given (the numbers in bold are the intraspecific distances)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 1 C. neixiangensis 0.18 2 C. luanchuanensis sp.nov. 1.00 0.18 3 C. ningshanensis 1.64 0.73 0.54 4 C. hirtus 1.49 0.57 0.76 0.60 5 C. chengkouensis sp.nov. 1.27 0.36 0.54 0.57 0.18 6 C. wuxiensis 1.55 0.63 0.64 0.79 0.27 0.00 7 C. shennongjiaensis 1.36 0.45 0.63 0.60 0.09 0.18 0.00 8 C. meridianus 3.17 2.79 3.08 3.36 3.16 3.34 3.53 0.00 9 C. habaensis 4.64 4.26 4.37 4.58 4.25 4.23 4.42 4.62 0.00 10 C. arcuatus 4.62 4.24 4.34 4.56 4.23 4.21 4.40 4.51 0.62 0.18 11 C. changbaiensis sp.nov. 3.37 2.99 3.28 3.38 3.00 2.80 3.00 3.59 3.18 3.33 0.00 12 C. kyebangensis 1.66 1.24 1.56 1.66 1.24 1.03 1.24 0.82 0.62 0.52 0.41 N/A 13 C. relictus 4.51 3.74 3.65 3.88 3.36 3.17 3.36 3.00 3.73 4.09 3.58 0.20 0.00 14 C. wolongensis sp.nov. 4.10 3.90 4.01 4.04 3.90 3.88 4.07 4.10 4.78 4.76 3.59 1.03 3.37 0.00 15 C. pingwuensis 3.22 2.85 2.86 2.82 2.66 2.57 2.75 2.78 3.65 4.00 3.37 0.82 3.53 2.75 0.00 16 C. convexus 4.18 3.79 3.99 4.08 3.98 4.06 4.25 4.09 4.95 4.93 3.96 1.03 3.94 2.73 3.67 0.00 17 C. banshanmenensis sp.nov. 4.09 3.71 3.81 3.84 3.61 3.50 3.69 3.35 4.78 4.77 3.96 1.03 3.17 1.63 3.30 0.54 0.00 18 C. zagunaoensis 3.61 3.23 3.33 3.30 3.13 3.03 3.22 4.01 3.93 3.80 3.57 1.24 4.01 2.37 2.36 2.55 2.37 0.35 19 C. matilei 3.06 2.68 3.06 2.78 2.86 2.76 2.95 2.97 3.50 3.66 3.58 1.03 3.55 2.77 2.02 2.11 2.20 2.38 0.00 20 C. primarius 3.89 3.32 3.57 3.41 3.28 3.09 3.28 2.82 3.17 3.22 3.98 1.14 3.31 1.67 2.13 1.95 1.95 1.76 1.58 0.61 21 C. tianbaensis sp.nov. 4.45 4.07 4.17 4.26 4.15 4.23 4.42 3.90 4.19 4.54 3.17 0.41 3.40 3.01 1.97 3.56 3.20 2.24 2.85 2.22 0.17 22 C. shangmengensis 4.10 3.91 4.01 3.97 3.80 3.69 3.88 3.73 3.09 3.43 3.19 0.82 3.16 2.92 2.17 2.93 2.56 1.98 2.02 1.86 2.42 0.00 23 C. laojunensis sp.nov. 5.64 5.45 5.36 5.77 5.43 5.60 5.80 3.11 6.25 6.55 5.13 0.62 3.72 5.20 5.55 5.76 5.02 5.67 4.30 4.73 6.90 5.36 0.00 24 C. weixiensis sp.nov. 4.31 4.12 4.23 4.51 4.11 4.10 4.29 2.57 4.97 5.15 3.99 0.62 2.80 4.08 4.28 4.26 3.52 4.56 2.98 3.30 4.51 3.69 2.69 0.00 25 C. pudacuoensis sp.nov. 3.78 3.59 3.88 4.10 3.96 4.14 4.33 3.15 3.33 3.77 3.43 1.24 3.19 4.35 3.58 4.31 3.58 3.86 2.83 3.53 4.20 3.37 3.12 2.93 0.00 26 C. darwini 8.02 7.41 7.41 7.75 7.30 7.39 7.39 6.78 7.32 7.02 6.09 4.42 6.59 6.20 6.36 7.00 6.58 6.68 6.80 6.16 6.35 6.00 6.16 5.95 6.57 0.00

Page 6 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC

References

Bourguignon, T., Lo, N., Cameron, S. L., Sobotnik, J., Hayashi, Y., Shigenobu, S., Watanabe, D., Roisin, Y.,

Miura, T., and Evans, T. A. (2015). The evolutionary history of as inferred from 66 mitochondrial

genomes. Molecular Biology and Evolution 32(2), 406–421. doi:10.1093/molbev/msu308

Cameron, S. L., and Whiting, M. F. (2007). Mitochondrial genomic comparisons of the subterranean termites

from the Reticulitermes (Insecta: Isoptera: Rhinotermitidae). Genome 50(2), 188–202. doi:10.1139/g06-

148

Cameron, S. L., Lo, N., Bourguignon, T., Svenson, G. J., and Evans, T. A. (2012). A mitochondrial genome

phylogeny of termites (Blattodea: Termitoidae): robust support for interfamilial relationships and molecular

synapomorphies define major clades. Molecular Phylogenetics and Evolution 65(1), 163–173.

doi:10.1016/j.ympev.2012.05.034

Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. (1994). DNA primers for amplification of

mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology

and Biotechnology 3(5), 294–299.

Legendre, F., Whiting, M. F., Bordereau, C., Cancello, E. M., Evans, T. A., and Grandcolas, P. (2008). The

phylogeny of termites (: Isoptera) based on mitochondrial and nuclear markers: Implications for

the evolution of the worker and pseudergate castes, and foraging behaviors. Molecular Phylogenetics and

Evolution 48(2), 615–627. doi:10.1016/j.ympev.2008.04.017

Tokuda, G., Isagawa, H., and Sugio, K. (2012). The complete mitogenome of the Formosan termite, Coptotermes

formosanus Shiraki. Insectes Sociaux 59(1), 17–24. doi:10.1007/s00040-011-0182-x

Wei, S. J., Ni, J. F., Yu, M. L., and Shi, B. C. (2012). The complete mitochondrial genome of Macrotermes

barneyi Light (Isoptera: Termitidae). Mitochondrial DNA 23(6), 426–428.

doi:10.3109/19401736.2012.710215

Page 7 of 7