DOCSLIB.ORG

Blattodea : Cryptocercidae): Species Delimitation Based on Chromosome Numbers, Morphology and Molecular Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Blattodea : Cryptocercidae): Species Delimitation Based on Chromosome Numbers, Morphology and Molecular Analysis Invertebrate Systematics 2017, 32, 69–91 © CSIRO 2018 doi:10.1071/IS17003_AC Supplementary material Exploring the diversity of Asian Cryptocercus (Blattodea : Cryptocercidae): species delimitation based on chromosome numbers, morphology and molecular analysis Qikun BaiA, Lili WangA, Zongqing WangA, Nathan LoB and Yanli CheA,C ACollege of Plant Protection, Southwest University, Beibei, Chongqing 400716, P.R. China. BSchool of Life and Environmental Sciences, The University of Sydney, Sydney, NSW 2006, Australia. CCorresponding author. Email: [email protected] Page 1 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC Table S1. The primers and references for COI and 28S rRNA Gene Primer Sequence (5–3) Reference COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994 HCO2198 TAAACTTCAGGGTGACCAAAAAATCA COI COI f ACAAATCATAAAGACATTGG COI r TTCTGGGTGACCGAAGAATCA 28S 28S f AAACACGGACCAAGGAGTCTAAC rRNA 28S r CTAGTTGCTTCGGCAGGTGAGTTGTTA Page 2 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC Table S2. Termite outgroups used in this study and GenBank accession number N/A, not available Species Family Reference Accession number COI 28S rRNA Mastotermes darwiniensis Mastotermitidae Legendre et al. 2008 EU253846 DQ441950 Hodotermopsis sjostedti Archotermopsidae Bourguignon et al. 2015 KP026259 DQ441931 Zootermopsis angusticollis Archotermopsidae Cameron et al. 2012 JX144932 AY859614 Microhodotermes viator Hodotermitidae Cameron et al. 2012 NC018122 DQ441959 Porotermes adamsoni Stolotermitidae Cameron et al. 2012 NC018121 N/A Cryptotermes secundus Kalotermitidae Bourguignon et al. 2015 KP026283 DQ441901 Glyptotermes satsumensis Kalotermitidae Bourguignon et al. 2015 KP026257 N/A Glyptotermes sp A Kalotermitidae Bourguignon et al. 2015 KP026263 N/A Glyptotermes sp B Kalotermitidae Bourguignon et al. 2015 KP026301 N/A Glyptotermes sp C Kalotermitidae Bourguignon et al. 2015 KP026300 N/A Neotermes insularis Kalotermitidae Cameron et al. 2012 NC018124 N/A Rugitermes sp. A Kalotermitidae Bourguignon et al. 2015 KP026284 N/A Glossotermes oculatus Serritermitidae Bourguignon et al. 2015 KP026291 JN647689 Serritermes serrifer Serritermitidae Bourguignon et al. 2015 KP026264 N/A Coptotermes formosanus Coptotermitinae Tokuda et al. 2012 NC015800 N/A Coptotermes lacteus Coptotermitinae Cameron et al. 2012 NC018125 FJ806530 Heterotermes sp. Heterotermitinae Cameron et al. 2012 NC018127 N/A Reticulitermes flavipes Heterotermitinae Cameron and Whiting 2007 EF206317 N/A Reticulitermes santonensis Heterotermitinae Cameron and Whiting 2007 NC009499 FJ806531 Prorhinotermes canalifrons Rhinotermitidae Bourguignon et al. 2015 KP026256 N/A Dolichorhinotermes longilabius Rhinotermitidae Bourguignon et al. 2015 KP026258 N/A Page 3 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC Species Family Reference Accession number COI 28S rRNA Parrhinotermes browni Rhinotermitidae Bourguignon et al. 2015 KP026295 N/A Schedorhinotermes breinli Rhinotermitidae Cameron et al. 2012 NC018126 N/A Termitogeton planus Rhinotermitidae Bourguignon et al. 2015 KP026298 DQ442039 Ancistrotermes pakistanicus Termitidae Bourguignon et al. 2015 KP026267 N/A Macrotermes barneyi Termitidae Wei et al. 2012 NC018599 N/A Odontotermes formosanus Termitidae Bourguignon et al. 2015 KP026254 JQ429094 Sphaerotermes sphaerothorax Termitidae Bourguignon et al. 2015 KP026279 JQ429097 Astalotermes sp. Termitidae Bourguignon et al. 2015 KP026272 DQ441874 Ateuchotermes sp. Termitidae Bourguignon et al. 2015 KP026274 N/A Anoplotermes-group sp E1 Termitidae Bourguignon et al. 2015 KP026287 N/A Duplidentitermes sp. Termitidae Bourguignon et al. 2015 KP026271 N/A Jugositermes tuberculatus Termitidae Bourguignon et al. 2015 KP026269 DQ441938 Cubitermes fungifaber Termitidae Bourguignon et al. 2015 KP026265 DQ441903 Drepanotermes sp. Termitidae Cameron et al. 2012 NC018129 N/A Microcerotermes biroi Termitidae Bourguignon et al. 2015 KP026297 N/A Neocapritermes araguaia Termitidae Bourguignon et al. 2015 KP026286 N/A Pericapritermes nigerianus Termitidae Bourguignon et al. 2015 KP026278 DQ442004 Constrictotermes cavifrons Termitidae Bourguignon et al. 2015 KP026290 JQ429100 Nasutitermes bikpelanus Termitidae Bourguignon et al. 2015 KP026296 N/A Postsubulitermes parviconstrictus Termitidae Bourguignon et al. 2015 KP026268 N/A Embiratermes neotenicus Termitidae Bourguignon et al. 2015 KP026262 N/A Labiotermes labralis Termitidae Bourguignon et al. 2015 KP026292 N/A Syntermes spinosus Termitidae Bourguignon et al. 2015 KP026293 N/A Page 4 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC Table S3. Pairwise genetic divergence (K2P) of Cryptocercus species using cytochromecoxidase subunit I (COI) gene sequences All genetic distances (%) were corrected with the Kimura two-parameter (K2P) substitution model using MEGA 6; extreme values of intraspecific and interspecific distances are given (the numbers in bold are the intraspecific distances) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 1 C. laojunensis sp. nov. 0.20 2 C. pudacuoensis sp. nov. 10.15 0.00 3 C. habaensis 12.19 9.13 0.00 4 C. shangmengensis 10.94 9.49 11.01 0.10 5 C. zagunaoensis 11.76 10.65 10.18 8.56 0.00 6 C. tianbaensis sp. nov. 11.07 10.65 11.77 8.84 8.92 0.00 7 C. banshanmenensis sp. nov 11.60 9.12 10.40 8.88 6.51 8.64 0.00 8 C. wolongensis sp. nov. 12.52 9.78 10.90 8.16 8.07 9.46 7.95 0.00 9 C. neixiangensis 13.13 11.79 12.57 12.15 14.28 12.71 14.55 13.76 0.20 10 C. luanchuanensis sp. nov. 13.45 12.31 12.66 12.90 13.30 12.15 13.94 13.60 2.18 0.34 11 C. chengkouensis sp. nov. 14.90 15.30 13.56 13.88 14.78 14.70 15.09 15.72 7.49 8.76 0.00 12 C. arcuatus 11.49 9.54 3.67 11.98 10.59 12.18 11.55 12.43 13.56 14.03 13.80 0.10 13 C. pingwuensis 11.75 10.95 10.46 7.91 6.49 8.17 6.70 8.02 13.00 12.50 14.84 11.80 0.15 14 C. meridianus 11.21 10.34 10.72 10.56 10.68 10.32 10.14 11.09 12.75 12.84 13.57 10.41 11.53 0.00 15 C. wuxiensis 13.03 14.08 13.49 13.00 15.09 14.10 16.03 15.64 6.24 7.08 4.86 13.16 14.24 14.07 0.10 16 C. hirtus 14.00 13.44 12.13 12.80 14.26 13.05 14.76 13.67 6.35 7.59 3.50 12.55 13.55 12.70 3.61 0.26 17 C. convexus 11.07 8.56 10.00 7.96 5.05 7.38 3.37 7.07 13.84 13.61 13.22 10.95 5.64 9.63 13.93 12.53 0.00 18 C. shennongjiaensis 14.22 13.20 12.73 13.41 13.57 13.47 14.03 13.67 6.78 7.38 6.50 12.78 13.24 13.28 6.95 5.71 12.69 0.30 19 C. ningshanensis 13.82 12.32 12.13 12.62 13.70 13.24 14.48 13.28 6.22 7.50 4.55 12.74 13.28 13.64 4.20 3.33 12.25 6.20 0.08 20 C. relictus 12.71 12.23 11.46 11.25 11.12 11.11 11.81 13.61 14.12 13.82 13.92 11.61 11.82 10.66 13.79 13.62 10.75 13.18 14.39 0.16 21 C. metilei 9.56 11.07 10.56 7.14 7.92 7.74 8.66 9.14 13.32 13.28 14.36 11.72 7.16 10.32 14.12 14.04 7.57 13.90 14.05 11.50 0.00 22 C. primarius 9.30 8.56 9.50 6.52 7.40 6.38 7.47 8.29 11.76 12.34 13.22 9.55 7.70 9.63 13.38 12.16 6.57 12.76 12.72 11.17 6.40 0.00 23 C. weixiensis sp. nov. 5.84 8.50 9.76 8.94 10.63 8.34 10.09 10.62 11.66 11.54 13.70 10.35 9.03 9.72 12.23 11.53 9.04 13.03 10.98 11.39 9.53 8.02 0.20 24 C. changbaiensis sp. nov. 11.26 11.45 10.92 10.49 9.52 10.72 10.97 11.31 11.93 12.20 14.19 11.33 9.96 10.87 13.15 13.10 10.20 14.10 12.92 11.04 8.79 10.04 10.85 0.00 25 C. kyebangensis 10.33 10.53 11.26 12.30 10.00 12.56 11.88 13.53 14.12 14.02 15.47 11.31 10.85 12.16 14.61 14.43 10.56 14.53 14.38 13.04 10.72 10.36 11.01 7.93 N/A 26 Crptocercus sp1 15.77 13.91 14.85 14.31 14.25 16.53 14.29 15.04 18.70 19.07 19.44 15.09 14.20 14.84 18.03 18.87 12.96 16.76 18.67 17.37 13.73 14.67 14.69 16.73 16.54 N/A 27 Crptocercus sp2 14.91 14.15 14.96 16.41 15.72 16.07 15.28 16.14 18.61 18.51 20.45 14.95 14.66 15.52 17.90 18.79 14.72 17.17 19.15 16.74 13.94 13.15 13.98 17.14 17.14 9.69 N/A 28 C. darwini 15.28 14.76 15.34 15.28 16.17 15.54 14.76 16.23 19.71 19.54 20.36 15.20 15.17 15.10 18.72 18.76 14.08 17.05 19.07 16.84 14.46 13.53 14.38 16.97 16.67 9.41 3.63 0.61 Page 5 of 7 Invertebrate Systematics © CSIRO 2018 doi:10.1071/IS17003_AC Table S4.
Load more

Recommended publications
  • Evolution and Ecology of Termite Nesting Behavior and Its Impact On
    1 Evolution and Ecology of Termite Nesting Behavior and Its Impact on Disease Susceptibility A dissertation presented by Marielle Aimée Postava-Davignon to The Department of Biology In partial fulfillment of the requirements for the degree of Doctor of Philosophy in the field of Biology Northeastern University Boston, Massachusetts April, 2010 2 Evolution and Ecology of Termite Nesting Behavior and Its Impact on Disease Susceptibility by Marielle Aimée Postava-Davignon ABSTRACT OF DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology in the Graduate School of Arts and Sciences of Northeastern University, April, 2010 3 Abstract Termites construct nests that are often structurally species-specific. They exhibit a high diversity of nest structures, but their nest evolution is largely unknown. Current hypotheses for the factors that influenced nest evolution include adaptations that improved nest thermoregulation, defense against predators, and competition for limited nest sites. Studies have shown a lower prevalence of pathogens and parasites in arboreal nesting animal species compared to ground nesters. Nest building behavior is plastic and can adapt to changing environments. As termites can detect and avoid pathogens, I hypothesized that the evolution of arboreal termite nests was an adaptation to avoid infection. To test this, bacteria and fungi from nest cores, trails, and surrounding soils of the arboreal nesting Nasutitermes acajutlae were cultured. Abiotic factors such as temperature, relative humidity, and light were measured to elucidate how they influenced the interactions between termites and microbes. Fungi associated with N. acajutlae were identified to determine the potential pathogenic pressures these termites encounter in their nest as compared to the external environment.
    [Show full text]
  • Cockroach Marion Copeland
    Cockroach Marion Copeland Animal series Cockroach Animal Series editor: Jonathan Burt Already published Crow Boria Sax Tortoise Peter Young Ant Charlotte Sleigh Forthcoming Wolf Falcon Garry Marvin Helen Macdonald Bear Parrot Robert E. Bieder Paul Carter Horse Whale Sarah Wintle Joseph Roman Spider Rat Leslie Dick Jonathan Burt Dog Hare Susan McHugh Simon Carnell Snake Bee Drake Stutesman Claire Preston Oyster Rebecca Stott Cockroach Marion Copeland reaktion books Published by reaktion books ltd 79 Farringdon Road London ec1m 3ju, uk www.reaktionbooks.co.uk First published 2003 Copyright © Marion Copeland All rights reserved No part of this publication may be reproduced, stored in a retrieval system or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise without the prior permission of the publishers. Printed and bound in Hong Kong British Library Cataloguing in Publication Data Copeland, Marion Cockroach. – (Animal) 1. Cockroaches 2. Animals and civilization I. Title 595.7’28 isbn 1 86189 192 x Contents Introduction 7 1 A Living Fossil 15 2 What’s in a Name? 44 3 Fellow Traveller 60 4 In the Mind of Man: Myth, Folklore and the Arts 79 5 Tales from the Underside 107 6 Robo-roach 130 7 The Golden Cockroach 148 Timeline 170 Appendix: ‘La Cucaracha’ 172 References 174 Bibliography 186 Associations 189 Websites 190 Acknowledgements 191 Photo Acknowledgements 193 Index 196 Two types of cockroach, from the first major work of American natural history, published in 1747. Introduction The cockroach could not have scuttled along, almost unchanged, for over three hundred million years – some two hundred and ninety-nine million before man evolved – unless it was doing something right.
    [Show full text]
  • Isoptera) in New Guinea 55 Doi: 10.3897/Zookeys.148.1826 Research Article Launched to Accelerate Biodiversity Research
    A peer-reviewed open-access journal ZooKeys 148: 55–103Revision (2011) of the termite family Rhinotermitidae (Isoptera) in New Guinea 55 doi: 10.3897/zookeys.148.1826 RESEARCH ARTICLE www.zookeys.org Launched to accelerate biodiversity research Revision of the termite family Rhinotermitidae (Isoptera) in New Guinea Thomas Bourguignon1,2,†, Yves Roisin1,‡ 1 Evolutionary Biology and Ecology, CP 160/12, Université Libre de Bruxelles (ULB), Avenue F.D. Roosevelt 50, B-1050 Brussels, Belgium 2 Present address: Graduate School of Environmental Science, Hokkaido Uni- versity, Sapporo 060–0810, Japan † urn:lsid:zoobank.org:author:E269AB62-AC42-4CE9-8E8B-198459078781 ‡ urn:lsid:zoobank.org:author:73DD15F4-6D52-43CD-8E1A-08AB8DDB15FC Corresponding author: Yves Roisin ([email protected]) Academic editor: M. Engel | Received 19 July 2011 | Accepted 28 September 2011 | Published 21 November 2011 urn:lsid:zoobank.org:pub:27B381D6-96F5-482D-B82C-2DFA98DA6814 Citation: Bourguignon T, Roisin Y (2011) Revision of the termite family Rhinotermitidae (Isoptera) in New Guinea. In: Engel MS (Ed) Contributions Celebrating Kumar Krishna. ZooKeys 148: 55–103. doi: 10.3897/zookeys.148.1826 Abstract Recently, we completed a revision of the Termitidae from New Guinea and neighboring islands, record- ing a total of 45 species. Here, we revise a second family, the Rhinotermitidae, to progress towards a full picture of the termite diversity in New Guinea. Altogether, 6 genera and 15 species are recorded, among which two species, Coptotermes gambrinus and Parrhinotermes barbatus, are new to science. The genus Heterotermes is reported from New Guinea for the first time, with two species restricted to the southern part of the island.
    [Show full text]
  • The Termite by Ogden Nash
    Biological studies on two European termite species: establishment risk in the UK Laetitia Virginie Laine B.Sc. M.Sc. D.I.C. A thesis submitted for the degree of Doctor of Philosophy of the University of London November 2002 Department of Biological Sciences, Imperial College, Silwood Park, Ascot, SL5 7PY, Berkshire Abstract The discovery of an accidental introduction of termites into Devon in 1994 generated great interest as termites were previously thought to be unable to establish in the UK due to unfavourable climatic conditions. Information about the species present in Devon, Reticulitermes grassei, was found to be lacking and the present study was undertaken to determine the importance of various abiotic and biotic factors in establishment of this species. The factors included in the study were the minimum termite number for establishment, the consumption of wood and its effect on survival and temperature and soil type. A review of the literature was also conducted, detailing the problems with the taxonomy of this termite genus, their present distribution pattern and the life cycle of Reticulitermes species. Two populations of both R. grassei and R. santonensis were studied. The effect of the minimum termite number was found to be significant in both laboratory and field conditions. However, survival decreased in the laboratory and increased in the field with increased number of termites. Consumption experiments were performed using blocks of Scots pine, beech and oak. In most cases termite populations were found to consume and survive best on oak. Consumption was also tested on live seedlings but these results were inconclusive. Survival was observed to increase with increased temperature.
    [Show full text]
  • Host Insect List 2005
    WSU Puyallup Plant Clinic 2005 Host-Insect/Mite/Spider Index January Insect Name Family Where Found Latin name County Date Crop balsam woolly adelgid Adelgididae Nordmann fir Abies nordmannian Pierce 1/31/2005 coneworm Tortricidae noble fir Abies procera Thurston 1/31/2005 comb footed spider, Curiosity/Non-pest Steatoda sp. Theridiidae unknown Island 1/21/2005 folding-door spider Antrodiaetidae house Pierce 1/12/2005 Nuisance brown dog tick Ixodidae dog Benton 1/7/2005 drainflies Psychodidae bathroom Cowlitz 1/28/2005 folding-door spider Antrodiaetidae daycare center Pacific 1/24/2005 fungus gnats Fungivoridae loquat Eriobotrya japonica King 1/24/2005 giant house spider Agelenidae unknown Pierce 1/21/2005 hobo spider Agelenidae unknown Pierce 1/21/2005 moisture ant queen Formicidae garden Clallam 1/27/2005 psocids Psocidae loquat Eriobotrya japonica King 1/24/2005 springtails Poduridae home Clark 1/10/2005 springtails Sminthuridae outside Pierce 1/26/2005 variegated cutworm Noctuidae unknown Pierce 1/21/2005 Ornamental aphids Aphididae sweet bay Laurus nobilis Pierce 1/27/2005 aphids Aphididae sweet bay Laurus nobilis Pierce 1/27/2005 balsam woolly adelgid nymphs Adelgididae Frasier fir Abies fraseri Pierce 1/25/2005 spruce aphid Aphididae spruce Picea sp. Pierce 1/10/2005 spruce spider mites Tetranchyidae spruce Picea sp. Pierce 1/10/2005 Structural subterranean termites Rhinotermitidae garden Clallam 1/27/2005 subterranean termites Rhinotermitidae ground near shed Pierce 1/8/2005 February Insect Name Family Where Found Latin name County
    [Show full text]
  • Isoptera Book Chapter
    Isoptera 535 See Also the Following Articles Biodiversity ■ Biogeographical Patterns ■ Cave Insects ■ Introduced Insects Further Reading Carlquist , S. ( 1974 ) . “ Island Biology . ” Columbia University Press , New York and London . Gillespie , R. G. , and Roderick , G. K. ( 2002 ) . Arthropods on islands: Colonization, speciation, and conservation . Annu. Rev. Entomol. 47 , 595 – 632 . Gillespie , R. G. , and Clague , D. A. (eds.) (2009 ) . “ Encyclopedia of Islands. ” University of California Press , Berkeley, CA . Howarth , F. G. , and Mull , W. P. ( 1992 ) . “ Hawaiian Insects and Their Kin . ” University of Hawaii Press , Honolulu, HI . MacArthur , R. H. , and Wilson , E. O. ( 1967 ) . “ The Theory of Island Biogeography . ” Princeton University Press , Princeton, NJ . Wagner , W. L. , and Funk , V. (eds.) ( 1995 ) . “ Hawaiian Biogeography Evolution on a Hot Spot Archipelago. ” Smithsonian Institution Press , Washington, DC . Whittaker , R. J. , and Fern á ndez-Palacios , J. M. ( 2007 ) . “ Island Biogeography: Ecology, Evolution, and Conservation , ” 2nd ed. Oxford University Press , Oxford, U.K . I Isoptera (Termites) Vernard R. Lewis FIGURE 1 Castes for Isoptera. A lower termite group, University of California, Berkeley Reticulitermes, is represented. A large queen is depicted in the center. A king is to the left of the queen. A worker and soldier are he ordinal name Isoptera is of Greek origin and refers to below. (Adapted, with permission from Aventis Environmental the two pairs of straight and very similar wings that termites Science, from The Mallis Handbook of Pest Control, 1997.) Thave as reproductive adults. Termites are small and white to tan or sometimes black. They are sometimes called “ white ants ” and can be confused with true ants (Hymenoptera).
    [Show full text]
  • Dictyoptera: Blattaria: Polyphagidae) from Korea Reveal About Cryptocercus Evolution? a Study in Morphology, Molecular Phylogeny, and Chemistry of Tergal Glands
    PROCEEDINGS OF THE ACADEMY OF NATURAL SCIENCES OF PHILADELPHIA 151: 61±79. 31 DECEMBER 2001 What does Cryptocercus kyebangensis, n.sp. (Dictyoptera: Blattaria: Polyphagidae) from Korea reveal about Cryptocercus evolution? A study in morphology, molecular phylogeny, and chemistry of tergal glands PHILIPPE GRANDCOLAS,1 YUNG CHUL PARK,2 JAE C. CHOE,3 MARIA-DOLORS PIULACHS,3 XAVIER BELLEÂS,3 CYRILLE D'HAESE,1 JEAN-PIERRE FARINE,4 AND REÂMY BROSSUT4 1ESA 8043 CNRS, Laboratoire d'Entomologie, MuseÂum national d'Histoire naturelle, 45, rue Buffon, 75005 Paris, FranceÐ [email protected] 2School of Biological Sciences, Seoul National University, Kwanak-ku Shilim-dong San 56-1, Seoul 151-742, South Korea 3Department of Physiology and Molecular Biodiversity, Institut de Biologia Molecular de Barcelona (CSIC), Jordi Girona 18, 0834 Barcelona, Spain 4UMR 5548 CNRS, Faculte des Sciences, Universite de Bourgogne, 6, bd. Gabriel, 21000 Dijon, France ABSTRACTÐThe description of a new species of the woodroach Cryptocercus kyebangensis Grandcolas from South Korea offers the opportunity to bring comparative information within the genus. This species, though morphologically very similar to other East Asian and North American species, presents conspicuous differentiation of both ribosomal genes (sequenced fragments of 12S and 16S) and chemical blends from tergal glands (proportions of linalyl acetate and the alcohol 4, 6, 8-trimethyl-7, 9- undecadien-5-ol, compounds previously identi®ed in females originating from North America). A phylogenetic reconstruction involving Blatta orientalis as an outgroup, Therea petiveriana as a polyphagid relative, C. kyebangensis and 17 North American Cryptocercus populations showed that C. kyebangensis stands as a sister-group of North American Cryptocercus, thus suggesting that one beringian vicariance has taken place in the early differentiation of the genus.
    [Show full text]
  • Termite Biology and Research Techniques
    Termite Biology and Control 2017 ENY 4221 / ENY 6248 2 credit hours Ft. Lauderdale Research and Education Center University of Florida 3205 College Ave. Ft. Lauderdale, FL 33314 Dates: Registration Deadline is Friday May 5, 2017 for Summer C Lectures and Laboratory Activities June 19-23, 2017 in FLREC Teaching Lab Rm 121 Exam and Term Papers due Friday July 28, 2017 Instructors: Dr. Rudolf Scheffrahn (954) 577-6312 [email protected] Dr. Nan-Yao Su (954) 577-6339 [email protected] Dr. William Kern, Jr. (954) 577-6329 [email protected] Dr. Thomas Chouvenc (954) 577-6320 [email protected] Teaching Assistant: Aaron Mullins (954) 577-6395 [email protected] Course Objectives: • Students will learn about the natural history, ecology, behavior, and distribution of all seven major termite families. • Students will be able to recognize three major termite families and 16 important genera. • Six primary invasive pest species must be recognized to species. • Students will produce a reference collection of termites for their future use. • Student will learn and gain field experience in a range of techniques for the collection and control of subterranean and drywood termites. Topics to be covered Monday 8:00 Introduction to the Isoptera Anatomy and Terminology – Chouvenc Higher Taxonomy - Scheffrahn Evolution – Chouvenc Ecological Significance – Su/Scheffrahn 12:00 Lunch 1:00 Biology and ecology of Kalotermitidae – Scheffrahn 2:00 Biology and ecology of Rhinotermitidae – Chouvenc 3:00 Principles of IPM and the Use of Bait and Alternative Technologies for Control of Subterranean Termites – Mullins 4:00 Biology and ecology of Termitidae - Scheffrahn 5:00 Biology and ecology of “minor” families (Hodotermitidae, Serritermitidae, Mastotermitidae, Termopsidae) – Scheffrahn 5:30 Welcome Dinner Tuesday 8:00 – 12:00 Termite collection field trip to FLL property or Secret Woods Park – Scheffrahn/Kern 1:00 – 5:00 ID Laboratories (Rm 205) Scheffrahn Identification of Important Rhinotermitidae Laboratory: Coptotermes, Heterotermes, and Reticulitermes, Prorhinotermes.
    [Show full text]
  • Treatise on the Isoptera of the World Kumar
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by American Museum of Natural History Scientific Publications KRISHNA ET AL.: ISOPTERA OF THE WORLD: 7. REFERENCES AND INDEX7. TREATISE ON THE ISOPTERA OF THE WORLD 7. REFERENCES AND INDEX KUMAR KRISHNA, DAVID A. GRIMALDI, VALERIE KRISHNA, AND MICHAEL S. ENGEL A MNH BULLETIN (7) 377 2 013 BULLETIN OF THE AMERICAN MUSEUM OF NATURAL HISTORY TREATISE ON THE ISOPTERA OF THE WORLD VolUME 7 REFERENCES AND INDEX KUMAR KRISHNA, DAVID A. GRIMALDI, VALERIE KRISHNA Division of Invertebrate Zoology, American Museum of Natural History Central Park West at 79th Street, New York, New York 10024-5192 AND MICHAEL S. ENGEL Division of Invertebrate Zoology, American Museum of Natural History Central Park West at 79th Street, New York, New York 10024-5192; Division of Entomology (Paleoentomology), Natural History Museum and Department of Ecology and Evolutionary Biology 1501 Crestline Drive, Suite 140 University of Kansas, Lawrence, Kansas 66045 BULLETIN OF THE AMERICAN MUSEUM OF NATURAL HISTORY Number 377, 2704 pp., 70 figures, 14 tables Issued April 25, 2013 Copyright © American Museum of Natural History 2013 ISSN 0003-0090 2013 Krishna ET AL.: ISOPtera 2435 CS ONTENT VOLUME 1 Abstract...................................................................... 5 Introduction.................................................................. 7 Acknowledgments . 9 A Brief History of Termite Systematics ........................................... 11 Morphology . 44 Key to the
    [Show full text]
  • Sultan Qaboos University Journal for Scientific Research
    Agricultural and Marine Sciences, 10(1):33-40 (2005) ©2005 Sultan Qaboos University Identification, Geographical Distribution and Hosts of Subterranean Termites in the United Arab Emirates Arid Ecosystem W. Kaakeh Department of Arid Land Agriculture, College of Food Systems, P. O. Box 17555, United Arab Emirates University, Al-Ain, United Arab Emirates وﻟﯿﺪ ﻛﻌﻚ اﻟﺨﻼﺻﺔ: ﺗﻢ ﺗﻌﺮﻳﻒ ﺳﺘﺔ أﻧﻮاع ﻣﻦ اﻟﻨﻤﻞ اﻷﺑﯿﺾ (اﻷرﺿﺔ) ﺗﺎﺑﻌﺔ إﻟﻰ ﺧﻤﺴﺔ أﺟﻨﺎس وﺛﻼث ﻓﺼﺎﺋﻞ (ھﻮدوjرﻣﯿﺘﯿﺪي Hodotermitidae، راﻳﻨﻮﺗﺮﻣﯿﺘﯿﺪي Rhinotermi،Rhinotermitidaetidae، وﺗﺮﻣﯿﺘﯿﺪي T(Termitidaeermitidae) ﻓﻲ اﻹﻣﺎرات اﻟﻌﺮﺑﯿﺔ اﻟﻤﺘﺤﺪة. وأﻧﻮاع اﻷرﺿﺔ اﻟﺘﻲ ﺗﻢ ﺗﺴﺠﯿﻠﮭﺎ ھﻲ اﻷرﺿﺔ اﻟﺤﺎﺻﺪة أو اﻷرﺿﺔ اﻟﻼﺷﻮﻛﯿﺔ Anacanthotermes ochraceusochraceus (Burmeister(Burmeister) و Anacanthotermes ubachi (Navas(Navas)، وأرﺿﺔ اﻟﺮﻣﻞ اﻟﺜﻐﺮﻳﺔ Psammotermes hypostomahypostoma (Desneux)، واﻷرﺿﺔ اﻟﺸﻤﻌﯿﺔ اﻟﺼﻐﯿﺮة MicrocerotermesMicrocerotermes diversusdiversus Silvestri))، واﻷرﺿﺔ اﻟﻨﺠﺪﻳﺔ اﻟﺪﻗﯿﻘﺔ Microtermes najdensis (Harris) ، واﻷرﺿﺔ Heterotermes aethiopicus (Sjostedt)، وﺑﺎﺳﺘﺜﻨﺎء اﻟﻨﻮع H. aethiopicus، ﻓﺈﻧﻪ ﺗﻢ ﺗﺴﺠﯿﻞ اﻷﻧﻮاع اﻟﺨﻤﺴﺔ اﻷﺧﺮى ﻟﻠﻤﺮة اﻷوﻟﻰ ﻓﻲ اﻹﻣﺎرات اﻟﻌﺮﺑﯿﺔ اﻟﻤﺘﺤﺪة. وﺗﻌﯿﺶ ﻛﻞ اﻷﻧﻮاع ﺗﺤﺖ اﻷرض وﺗﺼﻞ إﻟﻰ ﻣﺼﺎدر اﻟﻐﺬاء اﻟﺨﺸﺒﯿﺔ ﻣﻦ ﺧﻼل أﻧﻈﻤﺔ اﻷﻧﻔﺎق اﻟﻄﯿﻨﯿﺔ. وﻗﺪ وﺟﺪت اﻷرﺿﺔ ﻓﻲ ﻣﻨﺎﻃﻖ ﻣﺨﺘﻠﻔﺔ ﻣﻦ اﻟﺪوﻟﺔ واﻟﺘﻲ ﺗﺘﻤﯿﺰ ﺑﺎﺧﺘﻼف ﻇﺮوﻓﮭﺎ اﻟﻤﻨﺎﺧﯿﺔ وﻏﻄﺎءھﺎ اﻟﻨﺒﺎﺗﻲ وﻧﻮع ﺗﺮﺑﺘﮭﺎ. وﺗﻔﻀﻞ اﻷرﺿﺔ اﻟﺘﻐﺬﻳﺔ ﻋﻠﻰ اﻟﻌﻮاﺋﻞ اﻟﺤﯿﺔ أو اﻟﻤﯿﺘﺔ أو اﻟﻤﺘﻌﻔﻨﺔ، ﺑﺎﻹﺿﺎﻓﺔ إﻟﻰ اﻟﻤﻮاد ﻏﯿﺮ اﻟﺴﯿﻠﯿﻠﻮزﻳﺔ. وﻣﻦ أﻛﺜﺮ أﻧﻮاع اﻷرﺿﺔ ًﺗﻮزﻳﻌﺎ ﻓﻲ اﻹﻣﺎرات اﻟﻌﺮﺑﯿﺔ اﻟﻤﺘﺤﺪة ھﻲ A. ochraceusochraceus وﺗﺘﺒﻌﮭﺎ ﻛﻞ ﻣﻦ P.P. hypostomahypostoma وdiversusوM. diversus. وﻗﺪ اﺧﺘﻠﻒ ﺗﻮزﻳﻊ اﻷﻧﻮاع اﻟﺴﺘﺔ ﺿﻤﻦ
    [Show full text]
  • A Nondichotomous Key to Protist Species Identification of Reticulitermes
    SYSTEMATICS A Nondichotomous Key to Protist Species Identification of Reticulitermes (Isoptera: Rhinotermitidae) 1 J. L. LEWIS AND B. T. FORSCHLER Department of Entomology, 413 Biological Sciences Building, University of Georgia, Athens, GA 30602 Ann. Entomol. Soc. Am. 99(6): 1028Ð1033 (2006) ABSTRACT A key was developed using morphological and behavioral characters to identify nine genera and 13 species of protists found in the hindgut of three Reticulitermes speciesÑ Reticulitermes flavipes (Kollar), Reticulitermes virginicus (Banks), and Reticulitermes hageni BanksÑby using the online IDnature guides by Discover Life. There are seven characters and 13 taxa, each attached to species descriptions, digital stills, or movies to aid in protist species identiÞcation. We chose characters for protist species identiÞcation that were easy to observe with live samples and a light microscope at 400ϫ magniÞcation. All 11 protists from R. flavipes and nine each in R. virginicus and R. hageni were recognized using original and revised species descriptions. This was the Þrst report of the protist genera Trichomitus from both R. virginicus and R. hageni. KEY WORDS symbiotic protists, termite identiÞcation, anaerobic protists identiÞcation, Parabasa- lia, Oxymonadida The anaerobic symbiotic protist orders found in the (workers have Ϸ57 Ϯ 11%), because it is not found in hindgut of lower termites (Isoptera) include Tricho- R. virginicus and R. hageni (Lewis and Forschler monadida Kirby, Oxymonadida Grasse´, and Hyper- 2004b). Trichonympha agilis Leidy (1877) is Ϸ19 Ϯ 5% mastigida Grassi & Foa` (Yamin 1979). None of these of the protist population in R. virginicus compared protist species are found outside of the insect host with 4 Ϯ 3% in R.
    [Show full text]
  • Termites (Isoptera) in the Azores: an Overview of the Four Invasive Species Currently Present in the Archipelago
    Arquipelago - Life and Marine Sciences ISSN: 0873-4704 Termites (Isoptera) in the Azores: an overview of the four invasive species currently present in the archipelago MARIA TERESA FERREIRA ET AL. Ferreira, M.T., P.A.V. Borges, L. Nunes, T.G. Myles, O. Guerreiro & R.H. Schef- frahn 2013. Termites (Isoptera) in the Azores: an overview of the four invasive species currently present in the archipelago. Arquipelago. Life and Marine Sciences 30: 39-55. In this contribution we summarize the current status of the known termites of the Azores (North Atlantic; 37-40° N, 25-31° W). Since 2000, four species of termites have been iden- tified in the Azorean archipelago. These are spreading throughout the islands and becoming common structural and agricultural pests. Two termites of the Kalotermitidae family, Cryp- totermes brevis (Walker) and Kalotermes flavicollis (Fabricius) are found on six and three of the islands, respectively. The other two species, the subterranean termites Reticulitermes grassei Clemént and R. flavipes (Kollar) of the Rhinotermitidae family are found only in confined areas of the cities of Horta (Faial) and Praia da Vitória (Terceira) respectively. Due to its location and weather conditions the Azorean archipelago is vulnerable to coloni- zation by invasive species. The fact that there are four different species of termites in the Azores, all of them considered pests, is a matter of concern. Here we present a comparative description of these species, their known distribution in the archipelago, which control measures are being used against them, and what can be done in the future to eradicate and control these pests in the Azores.
    [Show full text]