COX6A2 Antibody (Center) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap9616c
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Cell Development and Peripheral Survival Heme Exporter FLVCR Is
Heme Exporter FLVCR Is Required for T Cell Development and Peripheral Survival Mary Philip, Scott A. Funkhouser, Edison Y. Chiu, Susan R. Phelps, Jeffrey J. Delrow, James Cox, Pamela J. Fink and This information is current as Janis L. Abkowitz of September 28, 2021. J Immunol 2015; 194:1677-1685; Prepublished online 12 January 2015; doi: 10.4049/jimmunol.1402172 http://www.jimmunol.org/content/194/4/1677 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2015/01/09/jimmunol.140217 Material 2.DCSupplemental http://www.jimmunol.org/ References This article cites 44 articles, 11 of which you can access for free at: http://www.jimmunol.org/content/194/4/1677.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 28, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Heme Exporter FLVCR Is Required for T Cell Development and Peripheral Survival Mary Philip,*,† Scott A. -
Associated 16P11.2 Deletion in Drosophila Melanogaster
ARTICLE DOI: 10.1038/s41467-018-04882-6 OPEN Pervasive genetic interactions modulate neurodevelopmental defects of the autism- associated 16p11.2 deletion in Drosophila melanogaster Janani Iyer1, Mayanglambam Dhruba Singh1, Matthew Jensen1,2, Payal Patel 1, Lucilla Pizzo1, Emily Huber1, Haley Koerselman3, Alexis T. Weiner 1, Paola Lepanto4, Komal Vadodaria1, Alexis Kubina1, Qingyu Wang 1,2, Abigail Talbert1, Sneha Yennawar1, Jose Badano 4, J. Robert Manak3,5, Melissa M. Rolls1, Arjun Krishnan6,7 & 1234567890():,; Santhosh Girirajan 1,2,8 As opposed to syndromic CNVs caused by single genes, extensive phenotypic heterogeneity in variably-expressive CNVs complicates disease gene discovery and functional evaluation. Here, we propose a complex interaction model for pathogenicity of the autism-associated 16p11.2 deletion, where CNV genes interact with each other in conserved pathways to modulate expression of the phenotype. Using multiple quantitative methods in Drosophila RNAi lines, we identify a range of neurodevelopmental phenotypes for knockdown of indi- vidual 16p11.2 homologs in different tissues. We test 565 pairwise knockdowns in the developing eye, and identify 24 interactions between pairs of 16p11.2 homologs and 46 interactions between 16p11.2 homologs and neurodevelopmental genes that suppress or enhance cell proliferation phenotypes compared to one-hit knockdowns. These interac- tions within cell proliferation pathways are also enriched in a human brain-specific network, providing translational relevance in humans. Our study indicates a role for pervasive genetic interactions within CNVs towards cellular and developmental phenotypes. 1 Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA 16802, USA. 2 Bioinformatics and Genomics Program, The Huck Institutes of the Life Sciences, The Pennsylvania State University, University Park, PA 16802, USA. -
Structure of the Intact 14-Subunit Human Cytochrome C Oxidase
www.nature.com/cr www.cell-research.com ARTICLE Structure of the intact 14-subunit human cytochrome c oxidase Shuai Zong 1, Meng Wu1, Jinke Gu1, Tianya Liu1, Runyu Guo1 and Maojun Yang1,2 Respiration is one of the most basic features of living organisms, and the electron transport chain complexes are probably the most complicated protein system in mitochondria. Complex-IV is the terminal enzyme of the electron transport chain, existing either as randomly scattered complexes or as a component of supercomplexes. NDUFA4 was previously assumed as a subunit of complex-I, but recent biochemical data suggested it may be a subunit of complex-IV. However, no structural evidence supporting this notion was available till now. Here we obtained the 3.3 Å resolution structure of complex-IV derived from the human supercomplex I1III2IV1 and assigned the NDUFA4 subunit into complex-IV. Intriguingly, NDUFA4 lies exactly at the dimeric interface observed in previously reported crystal structures of complex-IV homodimer which would preclude complex- IV dimerization. Combining previous structural and biochemical data shown by us and other groups, we propose that the intact complex-IV is a monomer containing 14 subunits. Cell Research (2018) 28:1026–1034; https://doi.org/10.1038/s41422-018-0071-1 INTRODUCTION states under physiological conditions, either being assembled into Mitochondria are critical to many cellular activities. Respiration is supercomplexes or freely scattered on mitochondrial inner the central function of mitochondria, and is exquisitely regulated membrane.36 NDUFA4 was originally considered as a subunit of in multiple ways in response to varying cell conditions.1–3 The Complex-I37 but was proposed to belong to Complex-IV recently.38 assembly of respiratory chain complexes, Complex I–IV (CI, NADH: However, the precise location of NDUFA4 in CIV remains unknown, ubiquinone oxidoreductase; CII, succinate:ubiquinone oxidoreduc- and thus this notion still lacks structural support. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name cytochrome c oxidase subunit VIa polypeptide 2 Gene Symbol COX6A2 Organism Human Gene Summary Cytochrome c oxidase (COX) the terminal enzyme of the mitochondrial respiratory chain catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (heart/muscle isoform) of subunit VIa and polypeptide 2 is present only in striated muscles. Polypeptide 1 (liver isoform) of subunit VIa is encoded by a different gene and is found in all non-muscle tissues. These two polypeptides share 66% amino acid sequence identity. Gene Aliases COX6AH, COXVIAH RefSeq Accession No. NC_000016.9, NT_010393.16 UniGene ID Hs.250760 Ensembl Gene ID ENSG00000156885 Entrez Gene ID 1339 Assay Information Unique Assay ID qHsaCED0002180 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000287490 Amplicon Context Sequence GGTGCGGATGCGGAGGTGTTGGTAGGGACGGAACTCGGGGCGCGGGCGGTGG CCCGAGTGGAGATAGGAGTTGAAGGTGCAGAGGGCCACGCTGGGCAGCGCC Amplicon Length (bp) 73 Chromosome Location 16:31439339-31439441 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 98 R2 0.9997 cDNA Cq 28.87 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) -
A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase. -
The Overexpression of Cytochrome C Oxidase Subunit 6C Activated by Kras Mutation Is Related to Energy Metabolism in Pancreatic Cancer
300 Original Article The overexpression of cytochrome c oxidase subunit 6C activated by Kras mutation is related to energy metabolism in pancreatic cancer Jigang Yang1, Jun Liu1, Shuxin Zhang1, Yuanyuan Yang1, Jianhua Gong2 1Department of Nuclear Medicine, Beijing Friendship Hospital, affiliated to Capital Medical University, Beijing 100050, China; 2Department of Oncology, Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China. Contributions: (I) Conception and design: J Yang, J Gong; (II) Administrative support: J Gong; (III) Provision of study materials: J Liu; (IV) Collection and assembly of data: S Zhang, Y Yang; (V) Data analysis and interpretation: S Zhang, Y Yang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. Correspondence to: Jianhua Gong. Oncology department, Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, 1# Tiantan Xili, Beijing 100050, China. Email: [email protected]. Background: Kras mutation is frequently detected in pancreatic cancers and leads to altered energy metabolite. Here we investigated molecule markers related with Kras mutation, which could be used as developing new target for Kras mutant driven cancer. Methods: A knockin BxPC-3/KrasG12D cell line was constructed by CRISPR/Cas9 system. Proliferation and metabolite characterization in BxPC-3/KrasG12D was compared with wild type BxPC-3 by using colony formation assay and mitochondrial dyes. The differential genes were screened using mitochondrial metabolite-related genes PCR array. The expression of COX6C was confirmed by real time polymerase chain reaction (RT-PCR) and western blot. COX6C expression in 30 pairs of tissue microarray of pancreatic carcinoma and matched adjacent tissues was analyzed by immunohistochemistry. -
Product Sheet CP10253
COX4I1 Antibody Applications: WB, IP, ICC, FACS Detected MW: 19 kDa Cat. No. CP10253 Species & Reactivity: Human, Mouse, Rat Isotype: Mouse IgG1 BACKGROUND Cytochrome c oxidase (EC 1.9.3.1) (COX) belongs from invertebrates to mammals, in most cases to the superfamily of terminal oxidases present in mimic the pathological features of the human all aerobic organisms. In eukaryotic cells, diseases.3 cytochrome c oxidase is embedded as a dimer in the mitochondrial inner membrane. Electron References transfer by the enzyme from cytochrome c to 1. Capaldi, R.A.: Annu. Rev. Biochem. 59: 569-596, 1990 molecular oxygen is coupled to proton pumping 2. Pecina, P. et al: Physiol. Res. 53(Suppl. 1):S213-S223, across the membrane, contributing to the 2004 mitochondrial membrane potential, resulting in a 3. Diaz, F.: Biochim Biophys Acta. 1802:100-10, 2010 proton and charge gradient that is then employed by the F0F1-ATPase to synthesize ATP. The redox TECHNICAL INFORMATION centers involved in electron transfer are two copper centers (CuA and CuB) and two heme A Source: moieties (a and a3). The eukaryotic enzyme COX4I1 Antibody is a mouse monoclonal antibody contains three mitochondrial DNA (mtDNA)- raised against purified recombinant human COX4I1 encoded subunits: MTCO1, MTCO2, and MTCO3. fragments expressed in E. coli. These subunits are homologous to polypeptides found in bacterial cytochrome c oxidases. They Specificity and Sensitivity: form both the catalytic and structural core of the This antibody detects endogenous COX4I1 proteins enzyme. The hydrophobic interior of enzyme without cross-reactivity with other related subunit 1 (MTCO1) coordinates the heme a group proteins. -
Human Primitive Brain Displays Negative Mitochondrial-Nuclear Expression Correlation of Respiratory Genes
Downloaded from genome.cshlp.org on October 7, 2021 - Published by Cold Spring Harbor Laboratory Press Research Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes Gilad Barshad, Amit Blumberg, Tal Cohen, and Dan Mishmar Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA)- and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic coregulation is poorly understood. To address this question, we analyzed ∼8500 RNA-seq exper- iments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity, and morphology, we found overall positive mtDNA-nDNA OXPHOS genes’ co-expression across human tissues. Nevertheless, negative mtDNA- nDNA gene expression correlation was identified in the hypothalamus, basal ganglia, and amygdala (subcortical brain re- gions, collectively termed the “primitive” brain). Single-cell RNA-seq analysis of mouse and human brains revealed that this phenomenon is evolutionarily conserved, and both are influenced by brain cell types (involving excitatory/inhibitory neu- rons and nonneuronal cells) and by their spatial brain location. As the “primitive” brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co-expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring toward glycolysis. Accordingly, we found “primitive” brain-specific up-regula- tion of lactate dehydrogenase B (LDHB), which associates with high OXPHOS activity, at the expense of LDHA, which pro- motes glycolysis. Analyses of co-expression, DNase-seq, and ChIP-seq experiments revealed candidate RNA-binding proteins and CEBPB as the best regulatory candidates to explain these phenomena. -
Oxidative-Phosphorylation Genes from the Mitochondrial and Nuclear
bioRxiv preprint doi: https://doi.org/10.1101/136457; this version posted May 11, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Oxidative-phosphorylation genes from the mitochondrial and nuclear genomes co-express in all human tissues except for the ancient brain Gilad Barshad1, Amit Blumberg1 and Dan Mishmar1* Department of Life Sciences, Ben-Gurion University of the Negev, Beer Sheva 8410501, Israel *Corresponding author Address: Dan Mishmar, PhD Department of Life Sciences Ben-Gurion University of the Negev Beer Sheva 8410501, Israel Tel: +972-86461355 FAX: 972-86461356 Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/136457; this version posted May 11, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract In humans, oxidative phosphorylation (OXPHOS), the cellular energy producer, harbors ~90 nuclear DNA (nDNA)- and mitochondrial DNA (mtDNA)-encoded subunits. Although nDNA- and mtDNA-encoded OXPHOS proteins physically interact, their transcriptional regulation profoundly diverges, thus questioning their co-regulation. To address mtDNA-nDNA gene co- expression, we analyzed ~8,500 RNA-seq Gene-Tissue-Expression (GTEx) experiments encompassing 48 human tissues. We found overall positive cross-tissue mtDNA-nDNA OXPHOS gene co-expression. -
Investigating the Effect of Chronic Activation of AMP-Activated Protein
Investigating the effect of chronic activation of AMP-activated protein kinase in vivo Alice Pollard CASE Studentship Award A thesis submitted to Imperial College London for the degree of Doctor of Philosophy September 2017 Cellular Stress Group Medical Research Council London Institute of Medical Sciences Imperial College London 1 Declaration I declare that the work presented in this thesis is my own, and that where information has been derived from the published or unpublished work of others it has been acknowledged in the text and in the list of references. This work has not been submitted to any other university or institute of tertiary education in any form. Alice Pollard The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives license. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the license terms of this work. 2 Abstract The prevalence of obesity and associated diseases has increased significantly in the last decade, and is now a major public health concern. It is a significant risk factor for many diseases, including cardiovascular disease (CVD) and type 2 diabetes. Characterised by excess lipid accumulation in the white adipose tissue, which drives many associated pathologies, obesity is caused by chronic, whole-organism energy imbalance; when caloric intake exceeds energy expenditure. Whilst lifestyle changes remain the most effective treatment for obesity and the associated metabolic syndrome, incidence continues to rise, particularly amongst children, placing significant strain on healthcare systems, as well as financial burden. -
Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions
International Journal of Molecular Sciences Review Mitochondrial Structure and Bioenergetics in Normal and Disease Conditions Margherita Protasoni 1 and Massimo Zeviani 1,2,* 1 Mitochondrial Biology Unit, The MRC and University of Cambridge, Cambridge CB2 0XY, UK; [email protected] 2 Department of Neurosciences, University of Padova, 35128 Padova, Italy * Correspondence: [email protected] Abstract: Mitochondria are ubiquitous intracellular organelles found in almost all eukaryotes and involved in various aspects of cellular life, with a primary role in energy production. The interest in this organelle has grown stronger with the discovery of their link to various pathologies, including cancer, aging and neurodegenerative diseases. Indeed, dysfunctional mitochondria cannot provide the required energy to tissues with a high-energy demand, such as heart, brain and muscles, leading to a large spectrum of clinical phenotypes. Mitochondrial defects are at the origin of a group of clinically heterogeneous pathologies, called mitochondrial diseases, with an incidence of 1 in 5000 live births. Primary mitochondrial diseases are associated with genetic mutations both in nuclear and mitochondrial DNA (mtDNA), affecting genes involved in every aspect of the organelle function. As a consequence, it is difficult to find a common cause for mitochondrial diseases and, subsequently, to offer a precise clinical definition of the pathology. Moreover, the complexity of this condition makes it challenging to identify possible therapies or drug targets. Keywords: ATP production; biogenesis of the respiratory chain; mitochondrial disease; mi-tochondrial electrochemical gradient; mitochondrial potential; mitochondrial proton pumping; mitochondrial respiratory chain; oxidative phosphorylation; respiratory complex; respiratory supercomplex Citation: Protasoni, M.; Zeviani, M. -
Mice Deficient in the Respiratory Chain Gene Cox6a2 Are Protected Against High-Fat Diet-Induced Obesity and Insulin Resistance
Mice Deficient in the Respiratory Chain Gene Cox6a2 Are Protected against High-Fat Diet-Induced Obesity and Insulin Resistance Roel Quintens1¤a, Sarvjeet Singh2, Katleen Lemaire1, Katrien De Bock3,4, Mikaela Granvik1, Anica Schraenen1, Irene Olga Cornelia Maria Vroegrijk5, Veronica Costa6, Pieter Van Noten7, Dennis Lambrechts8, Stefan Lehnert1, Leentje Van Lommel1, Lieven Thorrez1¤b, Geoffroy De Faudeur1, Johannes Anthonius Romijn5, John Michael Shelton2, Luca Scorrano6, Henri Roger Lijnen9, Peter Jacobus Voshol5, Peter Carmeliet3,4, Pradeep Puthenveetil Abraham Mammen2, Frans Schuit1* 1 Gene Expression Unit, Department of Molecular and Cellular Medicine, Katholieke Universiteit Leuven, Leuven, Belgium, 2 Division of Cardiology, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, Texas, United States of America, 3 Vesalius Research Center, Katholieke Universiteit Leuven, Leuven, Belgium, 4 Vesalius Research Center, Vlaams Instituut voor Biotechnologie (VIB), Leuven, Belgium, 5 Department of Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, The Netherlands, 6 Department of Cell Physiology and Metabolism, University of Geneva, Geneve, Switzerland, 7 Physical Activity and Health Laboratory, Biomedical Kinesiology Department, Katholieke Universiteit Leuven, Leuven, Belgium, 8 Department of Metallurgy and Materials Engineering, KU Leuven, Leuven, Belgium, 9 Center for Molecular and Vascular Biology, Katholieke Universiteit Leuven, Leuven, Belgium Abstract Oxidative phosphorylation in mitochondria is responsible for 90% of ATP synthesis in most cells. This essential housekeeping function is mediated by nuclear and mitochondrial genes encoding subunits of complex I to V of the respiratory chain. Although complex IV is the best studied of these complexes, the exact function of the striated muscle- specific subunit COX6A2 is still poorly understood. In this study, we show that Cox6a2-deficient mice are protected against high-fat diet-induced obesity, insulin resistance and glucose intolerance.