Final Report

FRDC Project 2006/064

FINAL REPORT

Aquatic Animal Health Subprogram: Development of diagnostic tests to assess the impact of haplosporidian infections in pearl oysters.

D. Bearham, S.R Raidal, John Creeper, Frances Stephens, Brian Jones, Brett McCallum, P.K. Nicholls.

November 2009

FRDC Project 2006/064

Authors: D. Bearham, P.K. Nicholls, S.R Raidal, John Creeper, Frances Stephens, Brian Jones, Brett McCallum.

Title: Aquatic Animal Health Subprogram: Development of diagnostic tests to assess the impact of haplosporidian infections in pearl oysters

ISBN: 978-0-86905-989-0 © Copyright, Fisheries Research and Development Corporation, Murdoch University, The Western Australian Department of Fisheries, Pearl Producers Association and Douglas Bearham, 2009. This work is copyright. Except as permitted under the Copyright Act 1968 (Cth), no part of this publication may be reproduced by any process, electronic or otherwise, without the specific written permission of the copyright owners. Neither may information be stored electronically in any form whatsoever without such permission.

The Fisheries Research and Development Corporation plans, invests in and manages fisheries research and development throughout Australia. It is a federal statutory authority jointly funded by the Australian Government and the fishing industry.

The authors do not warrant that the information in this book is free from errors or omissions. The authors do not accept any form of liability, be it contractural, tortious or otherwise, for the contents of this book or for any consequences arising from its use or any reliance placed upon it. The information, opinions and advice contained in this book may not relate to, or be relevant to, reader’s particular circumstances. Opinions expressed by the authors are the individual opinions of those persons and are not necessarily those of the publisher or research provider.

FRDC Project 2006/064

Aquatic Animal Health Subprogram: Development of diagnostic tests to assess the impact of Haplosporidian infections in pearl oysters

D. Bearham, P.K. Nicholls, S.R Raidal, John Creeper, Frances Stephens, Brian Jones, Brett McCallum. November 2009

FRDC Project 2006/064

August 2008

FRDC Project 2006/064 Table of Contents Table of Contents ...... 4 Non-technical summary...... 7 Objectives and extent of progress towards the objectives...... 10 Accepted peer-reviewed manuscripts resulting from this research...... 12 Other Publications and Presentations: ...... 12 List of Abbreviations, acronyms and definitions ...... 13 Acknowledgments ...... 15 Chapter 1 Background, Needs and Objectives...... 16 1.1 Introduction to bivalve aquaculture...... 17 1.2 The pearling industry...... 17 1.3 Current disease management in the pearling industry...... 19 1.4 Major pathogens affecting Australian pearl oysters...... 19 1.5 Phylum Haplosporidia (Caullery & Mesnil, 1899)...... 20 1.5.1 The characteristics of the Haplosporidia...... 20 1.6 The current management of the Haplosporidium sp. in Western Australia 1.7 The requirement for information regarding the infection of Pinctada maxima by a Haplosporidium sp. and the haplosporidian infecting rock oysters Saccostrea cucculata...... 25 Chapter 2 General Site Observations and Sampling Methods...... 27 2.1 Materials and Methods...... 28 2.1.1 Sampling regime and details of collection sites for the pearl oyster Haplosporidium sp...... 28 2.1.1.1 Pearl oyster sampling at Cascade Bay ...... 29 2.1.1.2 Pearl oyster sampling at Willie Creek...... 30 2.1.2 Sampling regime and details of collection sites for rock oyster Haplosporidium sp...... 32 2.1.2.1 Rock oyster sampling at the Montebello Islands ...... 33 2.1.2.2 Rock oyster sampling at Cascade bay, Willie creek and Carnarvon sites...35 2.2 Processing of pearl oyster and rock oyster samples...... 37 2.2.1 Processing of pearl oyster samples...... 37 2.2.1.1 Cascade bay pearl oyster spat...... 37 2.2.1.2 Willie Creek and Carnarvon pearl oyster samples...... 38 2.2.2 Processing of rock oyster samples...... 38 2.2.2.1 Rock oyster samples from the Montebello islands...... 38 2.2.2.2 Rock oyster samples from Cascade bay, Willie Creek Carnarvon and Koolan Island...... 39 Chapter 3 : Molecular characterisation of a haplosporidian parasite infecting rock oysters Saccostrea cuccullata in north Western Australia...... 41 3.1 Introduction...... 42 3.2 Materials and methods ...... 43 3.2.1 Oyster sampling ...... 43 3.2.2 DNA extraction ...... 44 3.2.3 DNA extraction: archived samples ...... 45 3.2.4 Amplification by Polymerase Chain Reaction ...... 45 3.2.5 DNA sequencing...... 47 3.2.6 In situ hybridisation ...... 49 3.2.7 Phylogenetic analysis...... 50 3.3 Results...... 51 3.4 Discussion...... 59

FRDC Project 2006/064 Chapter 4 : The detection of the haplosporidian parasites in rock oysters Saccostrea cuccullata (Born, 1778) using DNA probes...... 61 4.1 Introduction...... 62 4.2 Methods and Materials...... 64 4.2.1 DNA extraction...... 64 4.2.2 Amplification by Polymerase Chain Reaction...... 65 4.2.3 Generation of polynucleotide probe for ISH...... 66 4.2.4 In-situ hybridisation...... 67 4.2.5 Minchinia sp. diagnosis ...... 68 4.3 Results...... 69 4.3.1 Polymerase Chain Reaction...... 69 4.3.2 In-situ hybridisation: DNA probe specificity...... 69 4.3.3 Sensitivity ...... 75 4.3.4 Diagnosis comparison...... 75 4.4 Discussion...... 79 4.4.1 Specificity and sensitivity of the PCR assay ...... 79 4.4.2 The 30 bp oligonucleotide ISH assay...... 80 4.4.3 The polynucleotide ISH assay...... 81 Chapter 5 : Detection of Minchinia sp. in Haplosporidium sp. infected pearl oysters Pinctada maxima (Jameson, 1901)...... 83 5.1 Introduction...... 84 5.2 Methods and materials ...... 84 5.2.1 DNA extraction: Archived samples...... 85 5.2.2 Amplification by Polymerase Chain Reaction...... 85 5.2.3 DNA sequencing...... 87 5.2.4 In-situ hybridisation...... 87 5.2.5 Genealogical comparisons of the SSU rRNA sequences ...... 88 5.2.5.1 Interspecific relationships...... 88 5.2.5.2 Intraspecific variation: The Minimum Spanning Network...... 89 5.3 Results...... 91 5.3.1 Polymerase Chain Reaction...... 91 5.3.2 In situ Hybridisation ...... 96 5.4 Discussion...... 104 Chapter 6 : Spore ornamentation of Haplosporidium hinei n.sp. in pearl oysters Pinctada maxima...... 109 6.1 Introduction...... 110 6.2 Methods and materials ...... 111 6.3 Results...... 113 6.3.1 Light microscopy...... 113 6.3.2 Electron microscopy ...... 113 6.3.3 Taxonomic summary ...... 118 6.4 Discussion...... 119 Chapter 7 : Spore ornamentation of Minchinia occulta n. sp. in rock oysters Saccostrea cuccullata (Born, 1778)...... 123 7.1 Introduction...... 124 7.2 Materials and Methods...... 126 7.2.1 In-situ hybridisation...... 126 7.2.2 Electron microscopy ...... 126 7.3 Results...... 127 7.3.1 Light microscopy...... 127 7.3.2 In-situ Hybridisation...... 128 7.3.3 Electron microscopy ...... 134 5

FRDC Project 2006/064 7.3.4 Taxonomic summary...... 135 7.4 Discussion...... 137

Chapter 8 : Surveys of the previous outbreak locations, the search for intermediate and alternative hosts and infection experiments...... 141 8.1 Introduction...... 142 8.2 Materials and Methods...... 144 8.2.1 Infection trials...... 144 8.2.2 The inoculation experiments:...... 144 8.2.3 Infection by deployment of spat to a previous infection site and the sampling of rock oysters from the previous infection sites...... 147 8.2.4 Diagnosis of Minchinia occulta and Haplosporidium hinei...... 148 8.3 Results...... 149 8.3.1 Infection by cohabitation ...... 150 8.3.2 Pearl oyster samples from Cascade Bay and Willie Creek...... 150 8.3.3 Rock oyster samples...... 154 8.3.4 Koolan Island Tropical Oyster sample...... 154 8.4 Discussion...... 157 8.4.1 The inoculation experiments...... 157 Chapter 9 Conclusions and Further Development...... 160 9.1 Objective one: Complete DNA isolation and PCR amplification of material from previous WA outbreaks, with molecular identification of species...... 161 9.1.1 Molecular characterisation of a haplosporidian parasite infecting rock oysters Saccostrea cuccullata in north Western Australia...... 161 9.1.2 Suggesting a potential molecular assay for the rock oyster parasite and commencing an assessment of their sensitivity and specificity...... 163 9.1.3 Determining whether the detected parasite is present in past haplosporidian outbreaks in pearl oysters...... 164 9.1.4 Describing the spore ornamentation of the haplosporidian in pearl oysters using both scanning and transmission electron microscopy ...... 164 9.1.5 Describing the spore ornamentation of the haplosporidian in rock oysters using both scanning and transmission electron microscopy...... 165 9.2 Objectives 2 and 3: Determining whether the parasite is still present at the previous infection sites by completing a survey with DNA isolation and PCR amplification of material from spats deployed in, and/or collection of wild shell from various sites, including previous outbreak locations...... 166 9.3. Objective 4: To develop a means for the assessment of infectivity and pathogenicity using rock oysters and their endemic haplosporidians as a model. 167 9.4 Overall ...... 168 Literature Cited ...... 170 Chapter 10 Appendix...... 180 10.1 Appendix 1:Intellectual Property...... 180 10.2 Appendix 2: Staff engaged on the project...... 180 10.3 Appendix 3: Minchinia occulta SSU rRNA sequence and position of the primers and probes used in the study...... 181 10.4 Appendix 4: Primers used to attempt to obtain a sequence from the Haplosporidium hinei infected pearl oyster samples...... 182

FRDC Project 2006/064

FRDC Project 2006/064 Aquatic Animal Health Subprogram: Development of diagnostic tests to assess the impact of Haplosporidium infections in pearl oysters

Principal Investigator: Dr Philip Nicholls Address: Faculty of Health Sciences School of Veterinary and Biomedical Sciences Murdoch University Murdoch Drive Murdoch W.A. 6051 Telephone: (08) 9360 2599 Fax: (08) 9310 4144 email: [email protected]

OUTCOMES ACHIEVED A significant outcome of the project was the training of a biologist in molluscan pathology thus addressing the international shortage of specialists in this field. There was also significant output of knowledge in the form of a completed PhD thesis and five scientific publications in international peer reviewed journals on the parasites. Presentations were also given at the Virginia Institute of Marine Science (VIMS) and at the Paspaley Pearls Pty Ltd Research and Development forum.

A number of molecular diagnostic assays for the haplosporidians were developed at varying levels of specificity. These assays should allow the sensitive detection of the parasites by management authorities. In addition, both parasites were formally described and named. During this process they were compared to other haplosporidian parasites such as H. nelsoni. The parasites were endemic and therefore Australia has met its international obligations to ensure neither parasite was notifiable under OIE guidelines.

Pearling Industry stakeholders also benefit directly from the outcome of this project by better understanding the haplosporidian parasites as a disease threat. This information is required by pearling companies in assessing their level of risk of getting or transmitting the parasite. The biologist trained in molluscan pathology is currently employed in the pearling industry ensuring a considerable skills transfer from the project to industry.

These outcomes will give greater opportunities for informed and thus appropriate management by industry and government authorities in response to any future disease threats.

FRDC Project 2006/064 Non-technical summary

Haplosporidians are protozoa that are internal parasites of lower vertebrates and invertebrates, and can be amongst the most dangerous of diseases of molluscs. They are able to cause disease particularly where naïve hosts are exposed to the parasite. Haplosporidium nelsoni is the agent of the highly pathogenic Multinucleate Sphere X (MSX) disease in the eastern oyster Crassostrea virginica that along with the protozoan Perkinsus marinus, has devastated wild oyster populations and hindered oyster aquaculture development on the eastern seaboard of the USA. A further Haplosporidian parasite, Bonamia ostrea has severely affected the European flat oyster Ostrea edulis industry in Western Europe. Locally, Bonamia roughleyi, believed to be the agent of Winter Mortality, has had a considerable impact on the production of Sydney rock oysters. The association of haplosporidian parasites with commercially significant mortalities means they are important parasites for study.

An infection of pearl oysters, P. maxima, attributed to a Haplosporidium sp. has been detected on three occasions and is considered to represent a serious concern to the pearling industry. Cascade Bay in King Sound in northern Australia last recorded a haplosporidian infection in 1995 while Willie Creek recorded an outbreak in 2000. In both of these cases, pearl oysters were never again deployed to the sites of the original infection. The site of the third infection, the Carnarvon pearl oyster hatchery, implemented management measures to prevent further infections. In all three outbreaks the entire batch of infected pearl oysters was culled. As a result, little is known about the identity of these pearl oyster parasites or their ability to cause disease.

During the course of this study DNA from a cryptic haplosporidian parasite was detected in rock oysters from the Montebello Islands in north-western Australia. The minimum prevalence of the detected parasite was 39.01% (with 95% confidence). The detected DNA was sequenced allowing a phylogenetic analysis of the parasites, to determine their inter- relatedness and identity. This analysis indicated a Minchinia species (Haplosporidia). The DNA sequences generated were also used to develop a series of diagnostic assays to detect the parasite. These included three in situ hybridisation assays (in which a labelled DNA probe binds specifically to the parasite’s DNA) to visualise the parasite in histological sections as well as a diagnostic polymerase chain reaction (PCR) assay to detect the parasite by specific amplification of its DNA. These molecular assays were assessed for specificity and sensitivity and were then used to compare the parasite to previous haplosporidian parasite infections of pearl oysters. Both assays produced positive results from the infected

FRDC Project 2006/064 pearl oysters but not from other closely related haplosporidian species. These results suggested the same parasite infected both rock and pearl oysters, or the rock oyster parasite occurs in both host species.

An electron microsopy analysis was performed on spores from both parasite species to assist further in their identification. These studies resulted in the formal naming of the parasites as Haplosporidium hinei and Minchinia occulta. The spores of the pearl oyster parasite had two spore wall filaments wound around the spore originating from a posterior thickening while the spores of the rock oyster parasite were covered in microtubule-like structures. No evidence of a posterior thickening could be found on the spores of the rock oyster parasite. These data suggest pearl oysters where co-infected with both

Haplosporidium hinei and Minchinia occulta. The occurrence of haplosporidian co- infections in pearl oysters suggests the immuno-competence of juvenile oysters may be an important factor in preventing infection and therefore preventing mortalities in juvenile pearl oysters.

Sampling of wild rock and pearl oysters from the previous infection sites was completed.

An analysis of archived tropical oysters from Koolan Island in the Kimberley region of WA was also completed. All rock and pearl oyster samples obtained from the previous infection sites were negative for both haplosporidian parasites. In the case of the pearl oysters sampled from Cascade Bay the diagnostic tests used would have detected a haplosporidian infection with a minimum prevalence of 2 to 3% with 95% confidence for each of the samples using histology (Table 8.3). However, archived tropical oysters from Koolan

Island in Northern Western Australia did produce positive results with the developed diagnostic assays with a minimum prevalence of 5.92% (with 95% confidence). These assays indicate a Minchinia species most likely to be Minchinia occulta. Pearl oyster spat have been deployed by industry to one of the outbreak locations (Willie Creek) and to date no haplosporidian parasites have been detected from the site. 9

FRDC Project 2006/064 Objectives and extent of progress towards the objectives

1. Complete DNA isolation and PCR amplification of material from previous WA outbreaks, with molecular identification of species.

Progress: Haplosporidian DNA from pearl oysters was successfully amplified from the Carnarvon and Willie Creek outbreaks cloned and sequenced. To confirm that the sequence generated was not spurious, in situ hybridisation (ISH) was performed with two different oligonucleotide probes to confirm that the probes (derived from the sequence data) hybridised to the appropriate target DNA in histological sections. Minchinia occulta DNA was identified from haplosporidian infected pearl oysters and ISH confirmed these results. A scanning and transmission electron microscopy analysis of parasite spore morphology was undertaken to allow better interpretation of molecular results. The results from the molecular and electron microscope analysis suggest two haplosporidian species were present in some infected pearl oysters. The electron microscope analysis resulted in the formal description of the parasites. The Haplosporidium parasite was named Haplosporidium hinei while the Minchinia parasite was named Minchinia occulta.

2. Complete survey with DNA isolation and PCR amplification of material from spats deployed in, and/or collection of wild shell from various sites, including previous outbreak locations.

Progress: Sampling of wild rock and pearl oysters from the previous infection sites was completed. An analysis of archived tropical oysters from Koolan Island in the Kimberley region of WA was also completed. All rock and pearl oyster samples obtained from the previous infection sites were negative for both haplosporidian parasites. However, archived tropical oysters from Koolan Island in Northern Western Australia did produce positive results with ISH and histological examination revealed haplosporidian parasites most likely Minchinia occulta.

3. To determine whether the parasite is still present in the original outbreak sites and in other sites not historically affected, by the deployment and assessment of spat in these locations.

Progress: While no evidence of either Haplosporidium hinei or Minchinia occulta could be found at the previous infection sites. An unidentified “microcell” parasite of pearl oysters was identified from Cascade Bay and Willie Creek pearl oysters using a non-specific polynucleotide ISH. TEM analysis of the parasite failed to identify any taxonomic features and no haplosporidian DNA could be isolated from the samples. The parasite is therefore unlikely to be either Minchinia occulta or Haplosporidium hinei. Spat has been deployed by industry to one of the infection sites (Willie Creek) to date no haplosporidian parasites have been detected.

4. To develop a means for the assessment of infectivity and pathogenicity using rock oysters and their endemic Minchinia occulta as a model.

Progress: Transmission experiments were performed using Minchinia occulta and a variety of transmission techniques including direct injection however; transmission of the parasite was not demonstrated. Consequently, it was hypothesised that an intermediate host was required for successful transmission of the parasite and/or a period of maturation. A number of plankton samples were obtained from the Montebello Islands where the parasite 10

FRDC Project 2006/064 is common as well as the locations of its detection in pearl oysters (Cascade Bay and Willie Creek). These samples were assessed for the presence of the parasite through the PCR and ISH assays developed during this study as well as through histology, however no evidence of infection could be detected.

5. Completion of PhD thesis.

Progress: A thesis has been completed and passed by examination. The PhD student has also received training in molluscan pathology at Murdoch University, the Tasmanian Fish Pathology Course and at Cornell University’s AQUAVET 2 program. The PhD student is currently employed within the pearling industry.

FRDC Project 2006/064

Accepted peer reviewed manuscripts resulting from this research. Accepted: • Bearham, D., Spiers, Z., Raidal, S., Jones, J.B., Nicholls, P.K (2007) Molecular characterisation of a haplosporidian parasite infecting rock oysters Saccostrea cuccullata in north Western Australia. Journal of Invertebrate Pathology 95, 33-40. Cited: 7 times • Bearham, D., Spiers, Z., Raidal,S., Jones. J.B., Nicholls, P.K (2008) Detection of Minchinia sp., in rock oysters Saccostrea cuccullata (Born, 1778) using DNA probes. Journal of Invertebrate Pathology 97, 50-60. Cited: 4 times • Bearham, D., Spiers, Z., Raidal, S., Jones. J.B., Burreson, E.M., Nicholls, P.K (2008) Spore ornamentation of Haplosporidium hinei n.sp. (Haplosporidia) in pearl oysters Pinctada maxima (Jameson, 1901). Parasitology 135, (4) 521-527. Cited: 2 • Bearham, D., Spiers, Z., Raidal, S., Jones. J.B., Nicholls, P.K (2008) Spore ornamentation of Minchinia occulta n. sp. (Haplosporidia) in rock oysters Saccostrea cuccullata (Born, 1778). Parasitology 135, (11) 1271-1280. Cited:3 times • Bearham, D., Spiers, Z., Raidal, S., Jones. J.B., Nicholls, P.K (2009) Detection of Minchinia occulta in Haplosporidium hinei infected pearl oysters Pinctada maxima (Jameson, 1901). Australian Veterinary Journal 87 430-437

Other Publications and Presentations:

• Bearham, D., Spiers, Z., Raidal, S., Nicholls, P.K (2005). Haplospridian parasites in pearl and rock oysters in Western Australia. Murdoch University. Poster.

• Bearham, D., Spiers, Z., Raidal, S., Nicholls, P.K (2006). Identification of a haplosporidian parasite of Pearl Oysters (Pinctada maxima). Murdoch University, Perth. Poster. Prize: Best poster on disease control.

• Bearham, D., Spiers, Z., Raidal, S., Nicholls, P.K (2007). Morphological characterization and molecular detection of Haplosporidium hinei n. sp. Murdoch University, Perth. Poster.

• Bearham D. (2007). Haplosporidian parasites of Western Australia. Presentation at the Virginia Institute of Marine Science (VIMS). USA.

• Bearham, D. (2008). Haplosporidian parasites of pearl oysters (Pinctada maxima) and rock oysters (Saccostrea cucullata) in Western Australia. Presentation at Paspaley Pearls Pty Ltd Research and Development Forum.

• Bearham, D. (2008). Identification and characterisation of two haplosporidian parasites of oysters in north Western Australia. PhD Thesis. Murdoch University. Perth Western Australia.

FRDC Project 2006/064 List of Abbreviations, acronyms and definitions bp Base pair(s) ddH2O Double distilled water dNTP dATP, dCTP, dGTP or dTTP

DIG Digoxigenin

ECE Epispore Cytoplasmic Extensions

EDTA Ethylene diamine tetraacetic acid

H&E Hematoxylin and Eosin

Inflammation Infiltration of haemocytes in oyster tissues

ISH In situ hybridization

Longline Rope with anchors and bouys attached. Common method used to maintain pearl oysters in the water column.

MDS Multidimensional scaling min Minutes

MSN Minimum Spanning Network

NPV Negative predictive value (or number of negative test results for truly disease-free animals divided by the total number of negative test results.

OIE Office Internationale d’Epizootie or World Organisation for Animal Health.

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

Pearl Oyster Pinctada maxima

Rock Oyster Saccostrea cuccullata s Seconds

SEM Scanning Electron Microscopy

Sensitivity The number of disease-free animals that test negative divided by the number of truly disease-free animals.

FRDC Project 2006/064 SSC Standard Saline Citrate

SSU Small Subunit region of the rRNA gene

Spat Juvenile pearl oysters

Sydney rock oyster Saccostrea glomerata

TBSBT Tris-buffered saline containing 3% bovine serum albumin and 0.1% Triton X-100

TE Buffer containing 10 nM Tris – HCl (pH 8.0), 1 nM EDTA

TEM Transmission Electron Microscopy

Tris Trishydroxymethylaminomethane

Tropical oyster Saccostrea echinata

Keywords Pearl oyster, Pinctada maxima, mollusc pathology, haplosporidia, molecular diagnostics, aquatic animal health, Haplosporidium hinei, Minchinia occulta.

FRDC Project 2006/064

Acknowledgments This work was supported by the Australian Government’s Fisheries Research and Development Corporation Project No. 2006/064, Murdoch University and the Pearl Producers Association.

This project was a collaborative effort and would not have been possible without the contributions of many people around Australia and the world. We would like to thank Zoe Spiers, Peter Fallon, Gerard Spoelstra, Michael Slaven, Ian Robertson and Alan Lymbery from Murdoch University. Dave Mills (Paspaley), Sam Buchanan (Blue Seas), Patrick Moase (MG Kailis), Michael Hood and Mark Longhurst (Morgan & Co.),Leigh Taylor (WA Dept. Fisheries) Donna Cahill (Maxima), Roger Barnard (MG Kailis)and all the members of the Haplosporidian Project Steering Committee, for their support and assistance over the course of this project. Without their immense investment of time, technical support, financial aid and knowledge, this project would not have been possible.

We also need to thank Eugene Burreson and Nancy Stokes at the Virginia Institute of Marine Science for their guidance and advice on all aspects of the haplosporidia especially the morphology of haplosporidian parasites, the use of molecular diagnostics and scanning electron microsopy. Nancy Stokes also provided Haplosporidium nelsoni, H. costale and M. teredinis sections as well as H. nelsoni and H. costale DNA for specificity tests. This project would not have been possible or have achieved as much as it did without their help.

We would also like to acknowledge the contribution of the reviewers of manuscripts that were published as part of this study. There expertise indirectly contributed a considerable amount to this project.

FRDC Project 2006/064 Chapter 1: Introduction Chapter 1 Background, Needs and Objectives.

FRDC Project 2006/064 Chapter 1: Introduction 1.1 Introduction to bivalve aquaculture.

Shellfish farming represents almost a quarter of world aquaculture output, and is still growing rapidly (Grizel, 2003). Its history has been characterised by periods of development and profitability, but also by crises. Most often, these crises are due to over- exploitation or diseases. The latter, when they occur have severely disrupted production, and can constitute a major hurdle to shellfish aquaculture (Grizel, 2003). Australia’s most valuable shellfish culturing industry is the pearling industry (ABARE, 2007). The industry is second only to rock lobsters in export value (Figure 1.1)

600

500

400

300 Export Value ($A Millions) 200

100

0 abalone pearls prawns rock lobster scallops tuna Fishery

Figure 1.1 Total value of all Australian fisheries by export value ($A; ABARE, 2007).

1.2 The pearling industry.

The Australian pearl oyster industry is one of the world’s largest producers of the highly prized, south sea pearls that come from the silver lipped pearl oyster Pinctada maxima (Jameson, 1901). The product is marketed primarily to Japan, the United States of America, Hong Kong and Europe (ABARE, 2007). The pearling industry based on

FRDC Project 2006/064 Chapter 1: Introduction Pinctada maxima extends from northern Australia to several Asian countries (including Indonesia, Malaysia and Thailand).

The pearling industry in Western Australia is vertically integrated and involves four basic activities (Fletcher et al., 2006): • Collection of wild pearl oysters. • Seeding oysters involving the implanting of nuclei. • Grow out of seeded oysters. • Marketing of the product.

The industry is primarily based on the collection of wild oysters that are seeded on the fishing grounds where they are dumped on the seabed (Fletcher et al., 2006). The oysters are turned over approximately once per month to prevent rejection of the implanted nucleus and to aid in the formation of round pearls. The oysters are transported to farms at the end of the fishing season where they are usually cultured in panels suspended from long-lines. Pearls are harvested after approximately 2 years on the farm. Generally, about half of these harvested oysters are reseeded with a nucleus of a similar size to the cultured pearl that is removed depending on the health of the oysters. Since the oysters can produce pearls several times over their lifespan, they are a valuable livestock and understanding mortality issues for this industry is therefore of paramount importance.

The international market price of pearls has declined by approximately 75% since 1997, primarily as a result of increased production by overseas competitors. The quota controlled Australian industry hopes to improve profitability by intensification through increased farm densities, and hatchery production of selectively bred juvenile pearl oysters. However, the survival of hatchery raised spat can be low after they are deployed to the open ocean and the causes of spat mortalities are not well described (Humphrey et al., 1998).

As a result, production from spat is less predictable than for adult wild oysters. For this reason, disease management is likely to play a more important role in the industry than it has in the past.

FRDC Project 2006/064 Chapter 1: Introduction 1.3 Current disease management in the pearling industry.

Currently, disease does not have a major influence on the pearling industry in Western Australia (Anon, 2004). One possible explanation for this is that Western Australia is isolated relative to the major areas of shellfish disease concern worldwide (Anon, 2004). The transport of live animals for breeding or stocking has caused significant disease problems internationally (Burreson & Ford, 2004). Previously, this movement could have been undertaken without regard for, or in spite of, the known disease risk. Disease management also plays an important role in ensuring the pearling industry remains relatively pathogen free.

The management of the industry in Western Australia is complex (Brayford & Paust, 2000) and includes a diagnostic capacity to identify causative agents and the existence of passive and targeted surveillance programs aimed at identifying endemic diseases (Jones & Creeper, 2006) to ensure that only the movement of healthy oysters occurs (Hine, 2000; Jones & Creeper, 2006).

1.4 Major pathogens affecting Australian pearl oysters.

The most significant disease problem to have affected the Australian pearling industry to date is vibriosis, mainly due to the bacterium Vibrio harveyi (Dybdahl & Pass, 1985). Mortalities occurred from about 1974 onwards and on occasion reached 90 percent, although 30 to 60 percent was more common (Dybdahl & Pass, 1985). Investigations found that the mortality was related to transporting pearl oysters from fishing grounds to lease sites (Dybdahl & Pass, 1985). During the longer fishing periods, collected oysters would remain in vessel transport tanks for up to four or five days. The oysters were kept in high densities with inadequate water circulation and higher than usual water temperatures. This caused a build-up of Vibrio in the transport tanks (Dybdahl & Pass, 1985). Improved transport methods have all but eliminated the problem.

Recently, the industry has suffered serious mortalities from a condition named as oyster oedema disease (OOD). The mortalities were greatest in juvenile oysters but mature oysters have also been affected. Mortalities were most intense in and around Exmouth Gulf. An infectious agent has not yet been identified.

Haplosporidian parasites have also been detected in pearl oysters (see below). 19

FRDC Project 2006/064 Chapter 1: Introduction 1.5 Phylum Haplosporidia (Caullery & Mesnil, 1899).

The phylum Haplosporidia comprises a small group of spore forming obligate protozoan parasites of a number of fresh water and marine invertebrates (Burreson & Ford, 2004). Haplosporidian parasites can be amongst the most dangerous of all molluscan pathogens particularly where naïve hosts are exposed to the parasite (Anon, 2002; Burreson et al., 2000b). At present there are 39 recognised species in the phylum, however numerous others have been reported, but not specifically identified, from many invertebrate hosts. They have received considerable attention since several are known to cause significant mortalities in commercially important mollusc species.

1.5.1 The characteristics of the Haplosporidia. The Haplosporidia were most recently characterized morphologically as possessing ovoid, walled spores lacking polar filaments or polar tubes, and with an orifice at one pole. The orifice is covered either externally by a hinged lid or internally by a flap of wall material (Cavalier-Smith & Chao, 2003).

Currently, there are four genera allocated to the phylum; Urosporidium Caullery and Mesnil 1905; Minchinia Labbe, 1895; Haplosporidium Caullery and Mesnil 1899 and Bonamia Pictot, Comps, Tige, Grizel and Rabouin 1980 (Reece et al., 2004). The primary taxonomic feature used to differentiate species and genera within the Phylum is the morphology and origin of spore ornamentation, usually described as filaments, tails, wrappings or extensions.

Presently, the genera Haplosporidium and Bonamia are separated from the Minchinia based on the origin of the spore ornamentation, from either the spore wall in the case of the Haplosporidium and Bonamia, or from the epispore cytoplasm in the Minchinia (Azevedo, 2001; Burreson & Ford, 2004; Burreson & Reece, 2006; Carnegie et al., 2006; Hine & Thorne, 1998). The spore ornamentation from only one species of Bonamia has been characterised. That species Bonamia perspora has been found to possess strap like projections derived from the spore wall (Carnegie et al., 2006).

Haplosporidian parasites have devastated production of some commercially important mollusc species. Haplosporidium nelsoni is the aetiological agent of the highly pathogenic Multinucleate Sphere X (MSX) disease in the eastern oyster Crassostrea virginica. The Haplosporidium was evidently introduced to the western seaboard of the United States by

FRDC Project 2006/064 Chapter 1: Introduction importation of infected Pacific oysters (Crassostrea gigas) from Japan (Burreson et al., 2000a). It also appeared on the eastern seaboard of the United States, where it has had devastating effects on wild oyster populations and hindered oyster aquaculture development in the region (Ford & Haskin, 1982). Haplosporidium nelsoni has also been found to occur in France, probably the result of the importation of infected oysters (Renault et al, 2000).

Haplosporidium costale, the agent of Sea Side Organism (SSO) disease, is morphologically similar to H. nelsoni and has also been responsible for mortalities of eastern oysters on the US mid-Atlantic coast (Burreson & Reece, 2006).

Bonamia ostrea, pathogenic in the European flat oyster Ostrea edulis, has devastated the flat oyster industry in Western Europe. A microcell parasite that closely resembled B. ostreae in O. edulis has been reported from California. (Elston et al., 1986). The presence of B. ostreae in France was later traced to the importation of oysters from California (Elston et al., 1986). More recently, this parasite was also found on the east coast of the United States (Friedman & Perkins, 1994), presumably by introductions of infected O. edulis from the west coast.

Between 1986 and 1992, massive mortalities of over 90 percent of dredge oysters (Ostrea chilensis) were recorded in a wild fishery in Foveaux Strait in New Zealand (Hine et al., 2001). The mortalities were found to be associated with a new Bonamia species Bonamia exitosa. There is some evidence to suggest that B. exitosa may also be present in Europe (Abollo et al., 2008). More recently, the importation of European Abalone (Haliotis tuberculata) from Ireland to Spain in 2004 resulted in the detection of a new haplosporidian Haplosporidium montforti (Azevedo et al., 2006). The affected abalone underwent mortality rates of up to 100% in the six months following deployment in Spain (Balseiro et al., 2006).

1.5.2 Haplosporidians in Western Australia. Four haplosporidian parasites have been detected in Western Australia.

Bonamiosis in flat oysters (Ostrea angasi). The aquaculture of flat oysters (Ostrea angasi) was attempted in Albany on the South Coast of Western Australia in the 1990s (Anon, 2004). However, the project was abandoned due to mortalities caused by Bonamia sp. (Anon, 2004). This incident indicates the potential 21

FRDC Project 2006/064 Chapter 1: Introduction damage haplosporidian parasites are capable of inflicting to fledgling aquaculture industries.

Figure 1.2 Map of north Western Australia indicating the locations of 3 past haplosporidian outbreaks in pearl oysters at Cascade Bay (1995), Carnarvon (1996), Willie Creek (2000) and the location of the haplosporidian outbreak in rock oysters from the Montebello Islands (1990s).

Bonamia roughleyi in Sydney Rock oysters Bonamia roughleyi is believed to be the aetiological agent of Winter Mortality in Sydney Rock Oysters (Saccostrea glomerata). Bonamia roughleyi has also been detected in Carnarvon, Western Australia infecting Sydney Rock Oysters. It has not been associated with widespread mortalities perhaps because of warmer water temperatures. The relationship between the Western Australian isolate of B. roughleyi and its eastern counterpart is unknown. There have also been sporadic reports of B. roughleyi like

FRDC Project 2006/064 Chapter 1: Introduction infections in pearl oysters (Humphrey et al., 1998; SCFH, 1993). A single infected pearl oyster was detected in Carnarvon in 1992 (Norris, 1996). Although the exact nature of this infection as not been determined.

Haplosporidosis in rock oysters (Saccostrea cuccullata). An undescribed haplosporidian species also occurs in rock oysters (Saccostrea cuccullata; Hine and Thorne, 2000). This parasite was first recognised after energy companies on the north-west shelf of Western Australia reported high mortalities in oysters in the early 1990s. The companies involved were using rock oysters for pollution monitoring (Anon, 1992; Hine & Thorne, 2000). The parasite was morphologically described by Hine and Thorne (2002) who tentatively placed the parasite in the genus Haplosporidium (Hine & Thorne, 2002). The identified haplosporidian was associated with extensive mortalities (up to 80%) in the host species and would likely prove an impediment to any attempts at tropical rock oyster aquaculture (Anon, 2004).

Haplosporidosis in pearl oysters (Pinctada maxima). An undescribed Haplosporidium sp. infection of pearl oysters, Pinctada maxima, has been detected on at least three occasions (Humphrey et al., 1998; Jones & Creeper, 2006). The locations of the infections are shown in Figure 1.2. On each of these occasions, the parasite was detected in pearl oyster spat less than 12 mm in size (Jones, 2006). While no apparent mortalities were observed, the almost total replacement of the digestive gland epithelium with spores suggests that the infected oysters would not have survived (Figure 1.3; Hine and Thorne 1998). In any case, mortalities directly resulting from the parasite would be difficult to isolate against the relatively high levels of background mortality present in spat. The prevalence of infection determined histologically in the Carnarvon outbreak was 4% (6/150) and in Cascade Bay in King Sound it was 4.7% (7/150). However, when the oysters from the latter outbreak were culled 15 days later the prevalence of infection had increased to 10% (Jones & Creeper, 2006). At the Willie Creek outbreak the prevalence of infection was estimated to be 1.3% (2/150). The organism is considered to represent a serious potential threat to the pearling industry (Humphrey & Norton, 2005).

In addition, haplosporidian-like bodies have also been detected in mature oysters within the Northern Territory and in Western Australia (Humphrey et al., 1998). These bodies were derived from oyster populations undergoing mortalities on one occasion from the Northern Territory. 23

FRDC Project 2006/064 Chapter 1: Introduction

It is certain that many more haplosporidians remain to be discovered, especially as more aquaculture species are subject to aquaculture or the environmental stresses associated with economic activity. Because of the long isolation of the Australian continent it is also likely that many more endemic haplosporidians remain to be discovered.

Figure 1.3 Hematoxylin and Eosin (H&E) stained microscope slide of two oyster digestive glands. (A) is an uninfected gland showing intact digestive tubule epithelium. Scale bar represents 150 μm. (B) is the digestive gland of a pearl oyster infected with Haplosporidium spp. parasites. Scale bar represents 75 μm. The digestive tubule epithelium has been invaded although it still retains its circular structure.

1.6 The current management of the Haplosporidium sp. in Western Australia. On each of the three occasions where a Haplosporidium sp. infection has been detected in pearl oysters the entire batch of oysters was destroyed (Jones, 2006). This policy has caused a considerable financial loss to the industry. Currently, the policy of the Western Australian Department of Fisheries is to quarantine movement of pearl oysters where an infection has been detected (Jones, 2006). Since the Haplosporidium sp. is only known to affect pearl oyster spat, the current policy would result in substantially less spat being moved to pearling leases for grow out if the parasite became widespread. The consequence

FRDC Project 2006/064 Chapter 1: Introduction of this policy, from an industry perspective, results in fewer oysters being seeded and a smaller harvest of pearls in the following years.

1.7 The requirement for information regarding the infection of Pinctada maxima by a Haplosporidium sp. and the haplosporidian infecting rock oysters Saccostrea cucculata.

There are two major reasons for studying the haplosporidian parasites of northern Western Australia. Firstly, from an academic perspective, information regarding the haplosporidians is important in assessing the taxonomic and phylogenetic status of this group. The haplosporidians constitute a major group of molluscan pathogens which cause a considerable level of mortality to oyster stocks worldwide. Research into any haplosporidian increases the overall understanding of the group as a whole. Secondly, from a practical point of view, information regarding the haplosporidians has important implications for the management of the pearling industry in Australia. This point is particularly relevant for a number of reasons. Information regarding these parasite species can be used to determine if the haplosporidians are a genuine threat to pearl oyster stocks, and confirm that neither parasite is H. nelsoni. This organism is a dangerous pathogen and is notifiable under OIE guidelines. In addition, because of the precautionary approach adopted by authorities, the detection of any Haplosporidium results in the quarantine of a considerable number of valuable pearl oysters and, consequently, results in a considerable financial loss to the industry. Assessment of the threat posed to the pearling industry by the parasite will allow a more informed management policy to be developed by the WA Department of Fisheries for dealing with the parasite.

The primary objectives of this study are to describe the haplosporidian parasites of northern Western Australia. Appropriate molecular, pathological and electron microscopy techniques are to be used. The specific aims are to use these methods to:

1. Complete DNA isolation and PCR amplification of material from previous WA outbreaks, with molecular identification of species. 2. Complete survey with DNA isolation and PCR amplification of material from spats deployed in, and/or collection of wild shell from various sites, including previous outbreak locations.

FRDC Project 2006/064 Chapter 1: Introduction 3. To determine whether the parasite is still present in the original outbreak sites and in other sites not historically affected, by the deployment and assessment of spat in these locations. 4. To develop a means for the assessment of infectivity and pathogenicity using rock oysters and their endemic Minchinia occulta as a model. 5. Completion of PhD thesis.

FRDC Project 2006/064 Chapter 2: Site Observations Chapter 2 General Site Observations and Sampling Methods.

FRDC Project 2006/064 Chapter 2: Site Observations 2.1 Materials and Methods.

2.1.1 Sampling regime and details of collection sites for the pearl oyster Haplosporidium sp.

Formalin fixed paraffin embedded tissue from pearl oyster spat infected with Haplosporidium sp. were obtained from the Western Australian Department of Fisheries. These samples included all three of the pearl oyster Haplosporidium sp. infections that have been detected (Figure 1.1).

Table 2.1 Date, Location and number of pearl oysters collected and used in this study. * indicates replicate samples from the same individual oysters as fixed in formalin.

Pearl Location Latitude Longitude Date Method n n oyster: Formalin Ethanol fixed stored Cascade bay -16.59’ S 123.54’ E 14/3/06 Spat deployed on 171 152 longline 30/5/06 “ 120 120*

22/9/06 “ 124 124*

15/4/07 “ 122 122*

Willie creek -17.42’ S 122.10’ E 8/05/2006 Sample wild 20 20* oysters In addition to the samples mentioned above, an attempt to procure fresh Haplosporidium sp. from pearl oysters was made by sampling the sites that had previously produced an infection (Figure 1.1 Table 2.1). This strategy would not only provide fresh material for molecular assays (if successful) but would also help ascertain whether the parasite is still present at these locations. This information would allow some assessment of whether the parasite’s occurrence in pearl oysters was a rare event at each of the sites or whether this parasite is persistent in the environment but remains localised due to the actions of the pearling companies and the WA Department of Fisheries. However, the occurrence of the Haplosporidium sp. is a sensitive issue for lease holders and this fact limited the number of fresh pearl oysters that could be acquired. Pearl oyster samples were not obtained from the Carnarvon site due to the reluctance of the lease holder and the cost of deploying spat to the site.

FRDC Project 2006/064 Chapter 2: Site Observations

Figure 2.1 Map of Cascade bay indicating the position of the deployed pearl oyster spat ( ) and the site where the Cascade bay rock oyster sample was obtained ( ). The green areas indicate the intertidal zones. Map outline was obtained from WALIS (2006).

2.1.1.1 Pearl oyster sampling at Cascade Bay Cascade Bay, in King Sound, was subject to a Haplosporidium sp. infection in 1995. This site was sampled by deploying approximately 6000 pearl oyster spat in February 2006 with the assistance of Blue Seas Pty Ltd (Figure 2.1). The spat were obtained from the Broome pearl oyster hatchery and were approximately 5 mm in size. As a whole, the area consists predominately of mangroves and rocky outcrops. The site is within 200 m of where the original infection occurred (Brown, 2006). The deployment site is within a narrowing of the bay (Figure 2.1) and would therefore be subjected to a high volume of water flow. The co-ordinates of the deployment site was latitude of -16.59’ S with a longitude of -123.54’ E

FRDC Project 2006/064 Chapter 2: Site Observations (Table 2.1). The exact date and number of samples obtained for each sampling trip is indicated in Table 2.1.

The pearl oyster spat deployed at Cascade bay were suspended in the water from a longline in plastic panels at an approximate depth of two meters in a similar manner to the oysters that were infected in 1995 (Figure 2.1). The depth of the site was 12 m with a substrate consisting of mud.

Figure 2.2 The deployment of pearl oyster spat on a longline in Cascade Bay, King Sound. Picture A shows the panel that the pearl oyster spat were deployed in. Picture B shows the longline the panels of spat were suspended from.

2.1.1.2 Pearl oyster sampling at Willie Creek. Sampling also occurred at the Willie Creek lease site in May 2006. The lease runs half a mile either side of 17o 42’.12 S 122o 10’ 33 E on the northern edge and 17o 43’.21 S 122o 10’.35 E on the southern side (Figure 2.3). This site was subject to an infection in February 2000. Pearl oyster spat could not be deployed to the site due to the reluctance of the current lease holder. Consequently, the site was dived for pearl oysters in May 2006 with the assistance of Kailis Pearls Pty Ltd and Paspaley Pearls Pty Ltd.

FRDC Project 2006/064 Chapter 2: Site Observations The lease area consists of an area of garden bottom with exposed rocks and coral while the remainder is covered in a silty mud with numerous bivalve species.

Figure 2.3 Map indicating sampling sites for the Willie Creek rock oyster ( ) and pearl oyster samples ( ). Source of map outline was WALIS (2006).

FRDC Project 2006/064 Chapter 2: Site Observations

2.1.2 Sampling regime and details of collection sites for rock oyster Haplosporidium sp.

The rare occurrence of the Haplosporidium sp. in pearl oysters is suggestive of a parasite that may be naturally occurring in an alternative host. One possible candidate was the Haplosporidium sp. occurring in rock oysters since it had already been reported twice previously in this species (Anon, 1992; Hine & Thorne, 2002). In order to assess this possibility, samples of rock oysters were obtained from the intertidal zones of four locations (Bluebell Island, West bay, Chartreude bay and Crocus Island) at the Montebello Islands in July 2005 (Figure 2.4). Samples of rock oysters were also obtained from each of the positive pearl oyster sites (Cascade bay, Willie creek, and Carnarvon; Figure 1.1; Table 2.1). Archived histologically negative samples of rock oysters from Carnarvon and tropical oysters (Saccostrea echinata) from Koolan Island were obtained from the archives of the Western Australian Department of Fisheries.

Table 2.2 Location and number of rock oysters and tropical oysters collected and used for this study Location Latitude Longitude Date of Method n collection Rock Montebello -20°.4’ S 115°.53’ E July 2005 Removed from intertidal 291 Oyster: Islands rocks Cascade bay -16°.59’ S 123°.54’ E March 2006 Removed from intertidal 72 rocks Quondong -17°.66’ S 122°.18’ E May 2006 Removed from intertidal 65 point near rocks Willie creek Carnarvon -24°.53’ S 113°. 40’ E 1995 Archived samples 36 Tropical Koolan -16° 60’ S 123° 45' E 1994 Archived samples 27 Oyster Island

Formalin fixed paraffin embedded tissues from positive Haplosporidium sp. rock oyster infections were also obtained from the Western Australian Department of Fisheries. This infection was described by Hine and Thorne (2002).

FRDC Project 2006/064 Chapter 2: Site Observations 2.1.2.1 Rock oyster sampling at the Montebello Islands The Montebello Islands were selected since at least two infections of rock oyster Haplosporidium sp. had been detected there (Anon, 1992; Hine & Thorne, 2002). Four sites were chosen for sampling since the oysters present at each appeared to be undergoing a higher than usual mortality relative to the surrounding areas (Personal observations; Figure 2.4; Figure 2.6).

Figure 2.4 Map of Western Australia with the Montebello Islands shown in the insert (WALIS, 2006). The four sampling locations are indicated as a yellow dot.

Two hundred and ninety one rock oysters were removed from the intertidal zones at each site using a hammer and chisel (Table 2.3). The numbers from each of the four sites are indicated within Table 2.3.

Figure 2.5 shows the West bay sample site (Figure 2.5). The Montebello Islands are characterised by low lying intertidal rocks interspaced by beaches and mangroves. This site was typical of all four sample sites.

FRDC Project 2006/064 Chapter 2: Site Observations

Figure 2.5 Picture of West bay rock oyster sample site at the Montebello Islands. This site was typical of the four sites from which rock oysters were obtained.

Table 2.3 The total number of rock oysters collected from each of the four Montebello Island sample sites.

Location: n Bluebell Island 92 West bay 97 Chartreude bay 58 Crocus Island 44 Total 291

The four sample sites were chosen because the oysters at these sites appeared to be suffering from a higher level of mortality than the surrounding areas. Figure 2.6 shows a number of recently deceased oysters although the cause is not certain.

FRDC Project 2006/064 Chapter 2: Site Observations

Figure 2.6 Picture of rock oysters at the West bay sample site in the Montebello Islands. The site appeared to have higher levels of oyster mortality present than the surrounding areas although the cause is not certain.

Sampling at the Montebello sites was carried out with the assistance of Morgan Pty Ltd.

2.1.2.2 Rock oyster sampling at Cascade bay, Willie creek and Carnarvon sites Rock oysters were sampled from intertidal areas as close as possible to the sites where the pearl oyster Haplosporidium sp. had been previously detected. These samples were obtained so that the presence of the parasite in rock oysters at these sites could be confirmed. In accordance with these aims, seventy two individuals were collected from the Cascade bay site (Table 2.4) approximately 400 m from the pearl oyster spat deployment site (Figure 2.1). Sixty five rock oysters were sampled from the Quondong point site approximately two kilometres from the Willie creek lease site and thirty six rock oysters were obtained from Oyster creek. Oyster creek is approximately 2 km from the site of the Carnarvon outbreak (Table 2.4). The Carnarvon rock oysters and Koolan Island tropical oysters were obtained as archived samples from the Western Australian Department of Fisheries. These samples were formalin fixed and paraffin embedded and were collected in 1994 (Koolan Island sample) and 1995 (Carnarvon sample).

FRDC Project 2006/064 Chapter 2: Site Observations Table 2.4 Number of rock oysters taken from Cascade Bay, Willie Creek, Carnarvon and Koolan Island.

Location Oysters obtained Cascade bay 72 Quondong point (near 65 Willie Creek) Carnarvon# 36 Koolan Island* 27 Total 200

* Koolan island sample consisted of archived tropical oysters (Saccostrea echinata). # Carnarvon samples consisted of archived rock oyster samples.

FRDC Project 2006/064 Chapter 2: Site Observations

2.2 Processing of pearl oyster and rock oyster samples.

Rock and pearl oyster Rock oyster samples samples from: from Montebello Cascade bay islands Willie creek Carnarvon

Each oyster cut in half down the sagittal plane and placed in corresponding labeled containers Transported live to Murdoch University. Maintained in aquaria

Fixed in 10 % Formalin Infection Stored in 100 for H/E and experiments % Ethanol for ISH (Chapter 8) DNA extraction Direct comparison of samples. Detection in one allows confirmation with the other. (Chapter 3,4 and 8).

Figure 2.7 Flow diagram indicating the treatment of samples obtained from the Cascade bay, Willie creek Carnarvon and Montebello Island sample sites.

An outline of the treatment of samples from each of the sites is indicated in Figure 2.7

2.2.1 Processing of pearl oyster samples.

2.2.1.1 Cascade bay pearl oyster spat. Since approximately 6000 pearl oyster spat had been deployed to Cascade bay, a number of sampling trips occurred. On each of these occasions approximately one hundred and twenty spat were removed from the longline and placed in 10% sea water buffered formalin for 24 hours. Replicate sampling was performed for all sampling trips except the first so samples of the same individual oysters were also preserved in ethanol (Table 2.2). The 37

FRDC Project 2006/064 Chapter 2: Site Observations number of samples was viewed as adequate since the OIE list this volume to be capable of detecting a 2% infection with 95% confidence (OIE, 2006). A similar number is required for health certification by the Western Australian Department of Fisheries. The deployment size also allows for a sizeable natural mortality which is expected when pearl oyster spat are transferred from the sheltered conditions of the hatchery to the ocean.

2.2.1.2 Willie Creek and Carnarvon pearl oyster samples. Sampling at the Willie Creek site resulted in the capture of 20 adult pearl oysters. The pearl oysters were removed from their shells and cut down the sagittal plane so that a piece of gill and digestive gland were present in each oyster section. The first half from each oyster was fixed in 10% sea water buffered formalin for 24 h while the other half was stored in 100% ethanol.

2.2.2 Processing of rock oyster samples.

2.2.2.1 Rock oyster samples from the Montebello islands. A total of 291 rock oysters were obtained from the Montebello Islands. Of these 198 were transported alive to Murdoch University for cross infection trials (Table 2.5). The numbers of oysters transported alive from each of the sample sites are indicated in Table 2.5.

Table 2.5 The number of rock oysters obtained from each of the different sampling sites in the Montebello islands and their treatment.

Location: Number with Number Total tissue fixed in transported to 10% Formalin Murdoch and 100% University alive. Ethanol Bluebell Island 24 68 92 West bay 29 68 97 Chartreude bay 23 35 58 Crocus Island 17 27 44 Total 93 198 291

Foam boxes were used to transport the live rock oysters. Holes were cut in the lid and damp newspaper was wrapped around freezer blocks. These were then placed in the bottom of the box. Rock oysters were placed on top of the freezer block with the cup side down.

FRDC Project 2006/064 Chapter 2: Site Observations The total time the oysters were out of the water to the aquaria was approximately 14 h. The method used to maintain the rock oysters is described in Chapter 5.

The remaining oysters (93) were processed by removing the soft tissue from each oyster. This was then cut into two pieces along the sagittal plane. A sagittal section was used so that a piece of gill tissue and digestive organ was present in each oyster section. One piece was placed into a labeled container and fixed in 10% sea water buffered formalin for 24 h. This tissue was embedded in paraffin on return to Murdoch University and examined using conventional histological techniques or in situ hybridization (Chapter 3). The other piece was placed into another corresponding labeled container and fixed in ethanol for genomic DNA extraction and subsequent PCR analysis (Chapter 3). By using this method it was possible to cross reference oyster samples so that a positive result by traditional histology or by molecular tests could be used to optimise the alternative method. The numbers from each of the four sites are indicated within the table 2.5.

2.2.2.2 Rock oyster samples from Cascade bay, Willie Creek Carnarvon and Koolan Island. For the remaining sites, rock oysters were removed from intertidal locations as close as possible to the sites of previous pearl oyster Haplosporidium sp. infections using a hammer and chisel. Samples were split into approximately equal groups. One group was stored in ethanol for DNA extraction while the other was fixed in 10% sea water buffered formalin. A 5 mm diameter hole was made in the shells of each oyster to ensure the fixative could penetrate the oyster tissues. The numbers of oysters fixed by each method from each of the sites are given within Table 2.6. The Carnarvon and Koolan Island samples were obtained as archived formalin fixed paraffin embedded samples from the Western Australian Department of Fisheries.

FRDC Project 2006/064 Chapter 2: Site Observations Table 2.6 Numbers of rock oyster samples taken from Cascade bay, Willie creek and Carnarvon and the method used to store them.

Location 100% Ethanol 10% Formalin Total Cascade bay 72 72 72 Quondong Point 62 62 65 near Willie Creek Carnarvon - 36 36 Koolan Island* - 27 27

* Koolan Island samples consisted of tropical oysters.

FRDC Project 2006/064 Chapter 3: Molecular characterization Chapter 3 : Molecular characterisation of a haplosporidian parasite infecting rock oysters Saccostrea cuccullata in north Western Australia.

This chapter describes the initial detection and sequencing of a haplosporidian parasite in rock oysters within the pearling zones of Western Australia. The detection of this parasite is important for later work studying the haplosporidian parasites of pearl oysters.

FRDC Project 2006/064 Chapter 3: Molecular characterization 3.1 Introduction Many haplosporidians are very cryptic and are likely to be missed in histology sections. These parasites are also often present at a very low prevalence and there are a variety of morphologically similar species that can be difficult to differentiate during cytological or histological diagnosis. Attempts by others to diagnose the haplosporidian parasite at the Montebello Islands following the development of a specific probe for Haplosporidium nelsoni were unsuccessful despite several attempts (Hine & Thorne, 2002).

Detection of the parasite and sequencing of its rRNA gene would allow speciation of the parasite and confirm that it is not a described species. Sequencing of the parasite’s small ribosomal subunit (SSU) rRNA gene would also allow the development of molecular assays for the parasite and thus gain some understanding of the parasite’s biology and why it has been so difficult to detect in the past despite causing extensive mortalities in the host species (up to 80%; Hine et al.,2002). The development of sensitive and specific molecular assays, utilizing polymerase chain reaction and in situ hybridization, provides a means to detect the cryptic life stages of haplosporidian parasites and to identify them. The SSU region of the parasite’s rRNA gene can be used for this purpose since it has both conserved and variable regions.

This chapter describes the detection of a haplosporidian parasite in rock oysters from north Western Australia by successful amplification of the SSU region of the parasite’s rRNA gene and provides evidence of the identity of this parasite by using in situ hybridisation (ISH). The parasite detected is compared to the parasite described by Hine and Thorne (2002) using the molecular tools developed in this study.

FRDC Project 2006/064 Chapter 3: Molecular characterization

3.2 Materials and methods The outline of the strategy adopted to target the haplosporidian parasite parasitizing rock oysters is indicated in Figure 3.1.

3.2.1 Oyster sampling . Rock Oyster sample

Ethanol stored Formalin fixed sagittal sagittal rock oyster sections from the rock sections from same oyster samples from individuals. the Montebello Islands.

PCR products Extraction and cloned and amplification using sequenced published degenerate HAP PCR primers. (Molecular methods can be targeted to histologically positive samples if diagnosed.) Sequence used to Phylogenetic design novel primers analysis to obtain additional SSU rRNA gene Sections for in Histological examination sequence situ hybridisation.

Develop in situ hybridisation assay. (ISH can Sequence used to Compare and be used to develop more specific verify results target parasite primers for PCR from all in histology). assays. methods for each individual sample.

Figure 3.1 A flow diagram indicating the strategy adopted to target the haplosporidian parasite in the rock oyster samples from the Montebello Islands. This integrated approach can only be employed when using a replicate sampling regime as described in Chapter 2. Dotted line indicates the results of one diagnostic test can be compared to the other for each individual oyster.

FRDC Project 2006/064 Chapter 3: Molecular characterization Adult rock oysters were obtained from the Montebello Islands (latitude -20.4’ S longitude 115.53’ E) on the north-west coast of Western Australia in July 2005 as described in Chapter 2. In order to assess the specificity of the ISH assay unstained Haplosporidium costale and Minchinia teredinis sections were obtained from the Virginia Institute of Marine Science (VIMS). Representative histologically positive formalin fixed paraffin embedded rock oysters infected with the parasite described by Hine and Thorne (2002) were obtained from the Western Australian Department of Fisheries for DNA extraction and ISH.

3.2.2 DNA extraction

Two different methods of DNA extraction were used. Genomic DNA from 26 ethanol stored rock oysters was extracted from approximately 5 mg of gill tissue using a Masterpure™ DNA purification kit (Epicentre Technologies, Sydney) and was performed according to the manufacturer’s protocol. Briefly, approximately 5 mg of tissue from each individual was homogenized in a labelled 1.5 ml eppendorf tube containing 300 μL of Tissue and Cell Lysis Solution (Epicentre Technologies, Sydney). A 1 μL aliquot of Proteinase K (50 μg/μL; 50 mM Tris – HCl (pH 7.5), 100 mM NaCl, 0.1 mM EDTA, 10

mM CaCl2, 0.1% Triton X-100, 1 mM dithiothreitol, 50% glycerol) was added to each tube followed by a brief vortex. Individual samples were subsequently incubated in a 65 °C water bath for 15 minutes, and each tube was vortexed at five minute intervals. This incubation period allowed the Proteinase K to fully digest the tissue. The water bath containing the tubes was then cooled to 37 °C, with a 1 μL aliquot of RNase A (5 μg/μL; 25

mM NH4OAc (pH 4.5), 50% glycerol) being added to each tube, followed by vigorous mixing and incubated at 37 °C for 30 minutes. The tubes were then placed on ice for 3 to 5 minutes.

A 150 μL aliquot of MPC Protein Precipitation Reagent (Cat No MCD 85201, Epicentre Technologies, Sydney) was added to each sample followed by vigorous mixing for 10 seconds. Tubes were centrifuged at 10000 rpm for 10 minutes. The supernatant from each sample was then transferred to a clean labelled 1.5 mL tube and the pellet discarded. To precipitate the DNA, 100% isopropanol (500 μL) was added to each and the tubes inverted 40 times.

FRDC Project 2006/064 Chapter 3: Molecular characterization The DNA was pelleted by centrifuging the samples at 15 000 rpm for 10 minutes. The supernatant was removed and the resulting pellet washed twice with 500 μL of 75% ethanol. The ethanol was removed by gently pipetting or pouring off. The tubes were then left to dry overnight. 35 µL of TE buffer (10 nM Tris – HCl (pH 8.0), 1 nM EDTA) was used to resuspend the DNA pellet, which was then stored in a – 20°C freezer.

3.2.3 DNA extraction: archived samples Genomic DNA was extracted from the formalin fixed paraffin embedded rock oysters by following a freeze thaw extraction method (Anon, 1998). The procedure was performed as follows. For each sample three 12 μm sections were cut from the block and placed in a sterile 1.5ml centrifuge tube. Considerable care was taken to ensure that no DNA could be transferred between samples with each block being processed on separate occasions and new sterile blades being used. The tube was centrifuged at 16100 g for 1min in order to pellet the tissue. Two hundred microliters of sterile water with 0.5% v/v Tween 20 was added followed by 10 min boiling. The sample was then frozen in liquid nitrogen for 10 min. The freeze thaw process was repeated another two times and followed by a 20 min centrifuge at 4500 rpm. The supernatant was removed to a fresh 1.5 ml eppendorf. Another eppendorf containing a 1:5 dilution of the extract was also produced. The quality of the genomic DNA and absence of inhibitory factors from the extractions was verified with bivalve primers 16 R3 5’-GCT GTT ATC CCT RNR GTA-3’ and Proto 16_F 5’-AWK WGA CRA GAA GAC-3’ (Chase et al., 1998) that target a region of the 18 s rRNA gene.

3.2.4 Amplification by Polymerase Chain Reaction Originally, degenerate haplosporidian primers (Hap F1 and Hap R3; Table 3.1) were used in the polymerase chain reaction (PCR) to detect a haplosporidian species in ethanol preserved rock oyster tissue. These primers amplify a 344 bp section of the parasite’s small subunit (SSU) region of the rRNA gene and were chosen as previous studies, such as those of Renault et al. (2000), have used this primer set to amplify DNA from undescribed haplosporidians. Haplosporidium nelsoni DNA was used as a positive control in the initial PCRs. All amplifications were performed on an Eppendorf Mastercycler Gradient Thermocycler.

Each PCR was performed using reaction mixtures that had a total volume of 50 μL and contained reaction buffer (67 mM Tris–HCl, 16.6 mM [NH4]2SO4, 0.45% Triton X- 100,

0.2 mg/ml gelatin, and 0.2 mM dNTP’s), 2mM of MgCl2, 40 pmol of each primer, and 0.55 45

FRDC Project 2006/064 Chapter 3: Molecular characterization U of Taq polymerase and template DNA. Each of the reaction mixtures was subjected to: (i) an initial denaturation phase of 5 min at 94°C, (ii) 35 amplification cycles, each cycle consisting of 30 s of denaturation at 94°C, 30 s of annealing at 48°C, 4 min of extension at 68°C and (iii) a final 7min extension at 68°C. The success of each PCR was determined by loading a 10 μL aliquot of the PCR products on a 2% agarose gel where it underwent electrophoresis it for 20 min at 46 mA. Detection of the PCR products was performed using ethidium bromide staining.

Table 3.1 Polymerase Chain Reaction primer sequences employed in the study. Primer Sequence (5’ -3’) Position Reference Hap F1 gttctttcwtgattctatgma 1144 (Renault et al., 2000) Hap R3 akrhrttcctwgttcaagayga 1467 (Renault, T. et al., 2000) Minch F1B ctcgcgggctcagctt 1295 Present study Minch R2B ggcgctttgcagattcccca 1439 Present study FSSUF ctcaaagattaagccatgcatgtccaagtata * Present study 16 s b gatcccttccgcaggttcacctac 1682 (Medlin et al., 1988) In situ agcccaaaaccaacaaaacgtccacatgcg 754 Present study probe: SSR 69 *FSSUF primer starts at base 15 of most haplosporidian sequences in Genbank.

94.0 oC 94.0 oC 68.0 oC 68.0 oC

48.0 oC 5:00 0:30 4:00 7:00 min min o min min 14.0 C 0:30 min

Figure 3.2 Polymerase Chain Reaction (PCR) conditions used for DNA amplification of the SSU rRNA gene utilised in the study. Each of the PCR reactions was subjected to 25 cycles.

The success of each PCR reaction was determined by loading a 10 μL aliquot of the PCR products on a 2% agarose gel which was electrophoresed for 20 min at 46 Amps. 46

FRDC Project 2006/064 Chapter 3: Molecular characterization Electrophoresed gels were then subjected to approximately 25 min ethidium bromide staining. A Phi / HaeIII Marker (Promega, Sydney) was used as a DNA standard and viewed using UV light supplied by a Gel Doc TM (Bio Rad, Sydney). Digital images were viewed and saved by using the Quantity One TM computer program (Appendix 2; Bio Rad, Sydney). QIAQUICK spin-columns were used to purify the successful PCR amplifications following the manufacturer’s protocol (Qiagen, 2000).

96.0 oC 96.0 oC 60.0 oC 50.0 oC 2:00 0:10 min min 4:00 min 14.0 oC 0:05 min

Figure 3.3 Conditions for the cycle sequencing of the cloned PCR products. The PCR reactions were subjected to 25 cycles.

3.2.5 DNA sequencing To enable sequencing, the PCR products were cloned into a plasmid vector PCR2.1 using the TA cloning kit (Invitrogen Life Technologies) following the manufacturer’s protocol. The cycle sequencing of the purified PCR products was completed using Big Dye 3.1 sequencing chemistry. The PCR products were run on polyacrylamide gels in an ABI 377 XL Automated Sequencer (Applied Biosystems, 2001), with reaction mixtures as follows (per tube); ca 350 ng template (ca 4 μL PCR product), 4 μL dye terminator mix, 1.0 μL

ddH20, 1.6 picomoles (1.6 μL at working solution) of either forward or reverse primer. Each cycle sequencing reaction was performed at half the volume of the manufacturers’ recommendations (Applied Biosystems, 2001), so that a significant cost saving could be made. Each reaction was denatured at 96°C for 2 min (Figure 3.3). Each reaction was subjected to 25 reaction cycles, with each cycle consisting of 10 seconds denaturation at 96oC, five seconds of annealing at 50°C, four minutes of extension at 60°C and finally cooling to 8°C (Figure 3.3).

The sequencing products were cleaned using an ethanol precipitation procedure to exclude unincorporated dye terminators. This process consisted of adding 1 μL of 3M sodium acetate (pH 5.2), 1 μL of 125 mM EDTA and 25 μL of 100% ethanol to each product,

FRDC Project 2006/064 Chapter 3: Molecular characterization followed by a brief vortex and storing on ice for 20 min. The mixtures were then centrifuged at 13 000 rpm for 30 min. The supernatant was discarded using a pipette and the remaining pellet washed with 125 μL of 80% ethanol and then centrifuged at 13 000 rpm for a further five minutes. The supernatant was again discarded, with the final pellet dried in a vacuum manifold for 15 min.

Before automated sequencing, the PCR products were mixed with a loading buffer consisting of 5:1 deionised formamide, 25 mM EDTA (pH 8.0) and 50 mg/mL blue dextran (Applied Biosystems, 2001). The mixtures were then denatured at 95 °C for five minutes and stored on ice until loading. Approximately 0.8 μL of each sample was loaded into wells on a 48 cm well-to-read LongRanger™ polyacrylamide gel and run for about 11 h according to the manufacturer’s protocol (Applied Biosystems, 2001).

Three cloned DNA inserts were each sequenced and forward and reverse sequences were aligned and any alignment errors or base misreads were corrected by comparing to the alternative sequence. The primer sequences were removed from each end of the resulting consensus sequence. The position and direction of the rRNA PCR products were verified by BLAST searches of the GenBank database: (http://www.ncbi.nlm.nih.gov/blast/).

Sequences were aligned for further primer development to host 18 s and other haplosporidian SSU sequences using the CLUSTALW algorithm (Thompson et al., 1994) within the MEGA 3.1 software (Kumar et al., 2004). As a result, synthetic oligonucleotides were designed to more precisely target the haplosporidian parasite DNA in PCR. These primers were designated Minch F1B and Minch R2B (Table 3.1) and amplify a 144 bp region of the SSU rRNA gene sequence. The Minch primers were used to amplify parasite DNA from histologically positive formalin fixed rock oyster samples containing the parasite described by Hine and Thorne (2002). The PCR products of four reactions were cloned and sequenced using the method outlined above.

The remaining SSU sequence of the rRNA gene was obtained by (i) using a new forward primer (FSSUF) for the sequence at the 5’ end of the SSU rDNA paired with the Minch R2B primer and (ii) pairing the Minch F1B primer with the 16 s universal eukaryotic SSU rRNA gene primer for the sequence at the 3’ end (Medlin et al., 1988). The sequence generated in these reactions was compared to the overlapping sequence obtained from the HAP PCR reactions to ensure the correct organism and species was sequenced. Each of 48

FRDC Project 2006/064 Chapter 3: Molecular characterization these PCR reactions was performed using the same method as for the HAP primers except

the final concentration of MgCl2 in the reactions was lowered to 1.5mM and the annealing temperature was 61°C for the FSSUF/Minch R2B reactions and 48°C for the Minch F1B/16 s b reactions. Extension temperatures were also raised to 72°C. The success of each PCR reaction was determined using the same method described for the PCR utilising HAP primers. The cloning and sequencing of these PCR products was performed using the same method as the HAP primer reactions. The SSU rRNA gene sequence was obtained from the clones of three positive oysters each sequenced three times to give nine sequences. Each sequence was verified as belonging to a haplosporidian parasite using BLAST searches of the GenBank database.

3.2.6 In situ hybridisation In order to identify the parasite in histological sections, the SSU rRNA gene sequence obtained was compared to other haplosporidian sequences and a region with high sequence variability was identified. This region was used to design a 30 bp oligonucleotide probe for use with in situ hybridisation. The probe was labeled with digoxigenin at the 5’ end using a DIG Oligonucleotide Tailing Kit (Roche Diagnostics) according to the manufacturer’s instructions. The probe was designated SSR 69 and its sequence is given in Table 3.1.

Labeling efficiency was assessed by spotting 1 μL serial aqueous dilutions of probe on a positively charged nylon membrane (Boehringer Mannheim). The DNA was fixed by baking at 120°C for 30 min, washed in buffer 1 (0.1 M Tris pH 7.5, 0.1 M NaCl, 2 mM

MgCl2, and 0.05% Triton X-100) for 2x5 min and incubated for 30 min in antibody (alkaline- phosphatase conjugated anti-digoxigenin Fab fragments; Roche Applied Science) diluted 1:5000 in buffer 1. After two 10 min washes in buffer 1, and 5min equilibrium in

buffer 3 (0.1 M Tris pH 9.5, 0.1 M NaCl, and 50 mM MgCl2), the reaction was developed overnight in BM purple (Roche Applied Science).

Formalin fixed oyster tissue was embedded in paraffin blocks. Unstained sections were cut 6 μm thick and placed on aminoalkylsilane-coated slides. Sections were dewaxed with xylene and rehydrated in an ethanol series. They were then rinsed and immersed in pure water. The sections were digested in a Proteinase K solution (Proteinase K 0.5 g/ml, 0.5 mM Tris–HCl, pH 7.6) for 45 min and immersed in pure water at 4 °C (2x10 min). Post fixing was performed using 0.4% paraformaldehyde in x1 PBS pre cooled to 4°C for 20

FRDC Project 2006/064 Chapter 3: Molecular characterization min. Sections were then washed in pure water and incubated in a pre-hybridisation solution: 1mM Tris–HCl pH 7.4, 20 mM standard saline citrate (SSC), 0.1 mM EDTA, 5% (w/v) dextran sulfate, and 50%(v/v) formamide for 1 h at 42°C. Slides were covered in 50 μL of hybridisation solution: 1 μg labelled probe with 1 mM Tris–HCl pH 7.4, SSC 20 mM, 0.1mM EDTA, 5% dextran sulfate (w/v) and 50% (v/v) formamide, coverslipped and denatured for 15 min at 95°C in an oven. The slides were then transferred to a 42°C oven and incubated overnight in a humid chamber. The hybridisation solution was drained off and the slides were rinsed and immersed in 40 mM SSC (2x20 min). This was followed by

a 30 min incubation in a solution containing 0.1% SSC, 2 mM MgCl2, 0.1% Triton X-100 at 42°C. Slides were then covered in Tris-buffered saline containing 3% bovine serum albumin and 0.1% Triton X-100 (TBSBT) for 5 min. Hybridisation of the probes was detected by incubating the sections in anti-digoxigenin alkaline-phosphatase conjugate prediluted 1:600 in TBSBT for 30 min. Sections were then washed in Tris-buffered saline and alkaline-phosphatase substrate buffer for 5 min each. Slides were then stained with BM purple (Roche Applied Science) overnight and finally counterstained with brazilin haematoxylin. Negative controls included PCR negative sections and incubation with an identical hybridisation mix but without any labeled PCR product.

3.2.7 Phylogenetic analysis The SSU rRNA gene sequences employed in the phylogenetic analysis were obtained from GenBank. Sequences were aligned using CLUSTALW (Thompson et al., 1994) in MEGA 3.1 software (Kumar et al., 2004). Alignments were visually checked and an opening gap penalty of 10 and a gap extension penalty of 3 for both pairwise and multiple alignments were found to be the most effective. Phylogenetic analysis was conducted using MEGA3.1 with the haplosporidian parasites of Haliotis iris (AF492442), Ruditapes decussatus (AY435093) and Pandalus platyceros (AY449715) as an out-group. Phylogenetic tree construction was performed using a maximum parsimony analysis with the close neighbour interchange (CNI) heuristic option with a search factor of 2 and random initial trees addition of 2000 replicates (Azevedo et al., 2006). Bootstrap values were also calculated over 300 replicates.

FRDC Project 2006/064 Chapter 3: Molecular characterization

3.3 Results A protozoan parasite identified as a haplosporidian was detected by PCR in rock oysters (S. cuccullata) from northwest Australia using degenerate HAP primers. Of the sixty three oysters processed twenty nine were positive by in-situ hybridisation. The parasite measured 6 μm in diameter and was disseminated throughout the gonad follicles (Figure 3.4) and to a lesser extent the gills and digestive glands of the infected oyster. No parasites were observed in the connective (Leydig) tissue surrounding the follicles or infecting any other tissue in the oyster. The only parasite life stages observed were uninucleate naked cells (Figure 3.4) and rarely binucleate plasmodia. There appeared to be little in the way of a defensive response from the oyster to the parasite. Indeed, there appeared to be few haemocytes in the vicinity of the parasites or in the Leydig tissue surrounding the oyster reproductive tissue. No phagocytosis of parasite cells was observed.

The parasite was identified in haematoxylin-eosin stained sections using in situ hybridisation by designing a 30 bp oligonucleotide probe from the parasite’s SSU rRNA gene. The oligonucleotide probe was labeled with dioxigenin at the 5’ end and applied to unstained tissue sections in in-situ hybridisation.

The probe produced strong hybridisation signals with little background staining (Figure 3.5A). This signal was not reproduced in tissues processed from uninfected oysters or in sections where no labeled DNA probe was applied (Figure 3.5B).

FRDC Project 2006/064 Chapter 3: Molecular characterization

Figure 3.4 Rock oyster reproductive tissue containing haplosporidian parasites. (A) a hematoxylin-eosin stained section. Scale bar = 25 µm. (B) Higher magnification view of the same section. Parasites are identified with an arrow. Scale bar = 15 µm.

FRDC Project 2006/064 Chapter 3: Molecular characterization

Figure 3.5 Haplosporidian parasites (arrows) identified in an in-situ hybridisation of rock oyster gonad follicles. (A) Parasites are identified by a darker colouration and are indicated by an arrow. (B) Negative control serial section from the same in-situ hybridisation. Sections are counterstained in a brazilin haematoxylin. Scale bar = 10 µm.

FRDC Project 2006/064 Chapter 3: Molecular characterization Table 3.2 The number of oysters sampled as well as the number of oysters diagnosed as positive from each of the sampling locations. Oysters were diagnosed by in situ hybridisation.

Location: n positive % Bluebell Island (D) 10 5 40 West bay (B) 22 10 41 Chartreude bay (A) 21 13 62 Crocus Island (C) 10 1 10 Total 63 29 43

The parasite was present at each of the four locations sampled (Table 3.2) although at varying prevalence. Chartreude Bay had the highest infection rate at 62% (13/21) while Crocus Island had the lowest at 1/10 (10%). None of the pearl oyster samples obtained from the Montebello Islands were positive (data not shown).

Spores were not detected so the parasite was not able to be identified using the established morphological criteria (Burreson, 2001). In order to carry out a phylogenetic analysis, additional primers were developed to sequence the remaining sections of the parasite’s SSU rRNA gene (Table 3.1). The PCR products generated were cloned and sequenced. The 1682 bp SSU rRNA gene sequence was found to be unique, and consequently it was submitted to GenBank (Accession No. EF 165631). The sequence is also displayed in Appendix 1 along with the position of target sequences for the primers and probes used in the study.

FRDC Project 2006/064 Chapter 3: Molecular characterization

98 Minchinia teredinis (U20319) 93 Minchinia sp from Cyrenoida floridana (AY449712) 85 Minchinia chitonis (AY449711) 58 Parasite of Saccostrea cuccullata (EF 165631) Minchinia tapetis (AY449710) 32 81 Bonamia ostreae (AF262995) Bonamia perspora (DQ356000) 98 Bonamia exitiosa (AF337563) 31 90 Bonamia roughleyi (AF508801)

100 Haplosporidium costale (AF387122) Haplosporidium sp of European flat oyster (AY81176)

62 14 Parasite of Syllis nipponica (DQ444238)

31 Haplosporidium pickfordi (AY452724)

97 94 Haplosporidium lusitanicum (AY449713) 54 Haplosporidium montforti (DQ219484) Haplosporidium nelsoni (U19538) Haplosporidium louisiana (U47851) Urosporidium crescens (U47852) 100 Urosporidium sp from Stictodora lari (AY449714) Haplosporidian sp from Haliotis iris (AF492442)

84 Haplosporidian sp from Ruditapes decussates (AY435093) 76 Haplosporidian sp from Pandalus platyceros (AY449715)

Figure 3.6 A maximum parsimony tree illustrating the relationships of the SSU rRNA gene sequences within phylum Haplosporidia including the rock oyster parasite. The analysis was conducted using 2218 aligned nucleotide positions with the previously reported basal haplosporidians as an outgroup. The analysis was supported by a 300 replicate bootstrap analysis. Numbers at nodes are percentages out of bootstrap analysis. Bar represents the equivalence between the distance and the number of changes.

The parasite SSU rRNA gene sequence obtained falls inside the genus Minchinia and is sister taxon to a clade composed of M. chitonis, M. teredinis, and Minchinia sp. Overall, bootstrap support for the monophyly of the genus Minchinia is at 58% (Figure 3.5). Monophyly for the genus Bonamia is strongly supported (98%) while support for the Haplosporidium excluding H. nelsoni and Haplosporidium louisiana is weakly supported at 14% (Figure 3.5).

FRDC Project 2006/064 Chapter 3: Molecular characterization

Figure 3.7 Agarose gel electrophoresis of the Minch PCR products from archived rock oyster tissues containing the haplosporidian parasite described by Hine and Thorne (2002). Samples were electrophoresed in a 2% agarose gel for 45 min at 46 milliamps. Lane 1: PhiX/HaeIII molecular weight markers. The size of each marker in base pairs is indicated to the left. Lanes 2-4: PCR products from archived tissues. Lane 5: Negative control (no DNA).

The Minch F1B/R2B primers also were used to amplify a 144 bp section of formalin fixed archived samples of the parasite described by Hine and Thorne (2002). The Minch primers encompass a variable section of the SSU region of the parasite’s rRNA gene. The Minch F1B/R2B reactions produced consistently positive results with no indication of contamination (Figure 3.6). When compared to the parasite detected in this study the sequences were within the levels expected for intraspecific variation.

FRDC Project 2006/064 Chapter 3: Molecular characterization

Figure 3.8 Serial sections of rock oyster gill tissue containing the parasite described by Hine and Thorne (2002). (A): A H/E stained section. Parasites are indicated with an arrow. (B): An in situ hybridisation assay containing the SSR 69 probe. (C): An in situ hybridisation assay with no probe in the hybridisation solution (negative control). Parasites are identified by a darker colouration. Sections are counterstained in a brazilin hematoxylin. All scale bars = 10 μm.

FRDC Project 2006/064 Chapter 3: Molecular characterization Overall, two sites within the 144 bp SSU sequence produced by the archived rock oyster parasites were different to that produced by the parasite detected in this study. At site 1489 the archived samples contained a T instead of a C, while at site 1459 the archived samples contained a G instead of an A (Appendix 1).

In order to ascertain whether the oligonucleotide probe reacted with the parasite described by Hine and Thorne (2002) an in situ hybridisation was performed on archived tissue used in that study. The in situ hybridisation produced strong hybridisation signals with little background staining (Figure 3.7).

FRDC Project 2006/064 Chapter 3: Molecular characterization

3.4 Discussion Haplosporidian parasites associated with oyster mortality have been infrequently detected on the north Western Australian coastline. However, the geographic isolation of the region and difficulties in locating the parasites by techniques such as traditional histology have hampered further research into the biology of these parasites (Hine & Thorne, 2002).

The results obtained here demonstrate through PCR and in situ hybridisation the presence of a cryptic haplosporidian parasite in rock oysters. A phylogenetic analysis of the parasite indicates a Minchinia species between Minchinia tapetis and Minchinia chitonis (Figure 3.5). However, confirmation of this assessment, using spore ornamentation, is required. Spore ornamentation is the most accepted characteristic used to assess the taxonomic placement of haplosporidian parasites excepting the Bonamia species in which spores have not been detected (Burreson & Ford, 2004). The most accepted morphological characteristic used to separate the Minchinia from the Haplosporidium is the presence of an epispore cytoplasmic extension (ECE) within the spore ornaments, while the Haplosporidium possess ornamentation consisting of spore wall material (Azevedo et al., 2006; Burreson & Ford, 2004; Hine & Thorne, 1998). Consequently, if the genus Minchinia is genuinely monophyletic, one would expect the spores of this parasite to possess ECEs. A monophyletic Minchinia genus is suggested with bootstrap support at 58% (Figure 3.5). The samples used in the present study were obtained from within the geographic range of a haplosporidian parasite described by Hine and Thorne (2002) from the same host. The phylogenetic assessment of a Minchinia species is consistent with the parasite described by Hine and Thorne (2002) where a conclusive placement of the parasite in either Minchinia or Haplosporidium genera was not possible. An in situ hybridisation of archived rock oyster tissue infected with the parasite described by Hine and Thorne (2002) produced a positive reaction (Figure 3.7). A 144 bp sequence was obtained from archived formalin fixed tissues containing the parasite described by Hine and Thorne (2002). The sequence encompasses a variable region of the parasite’s SSU rRNA gene. However, the sequence differed by only two base pairs from the SSU rRNA gene sequence obtained from the rock oyster parasite detected in this study. While only nine samples have tested positive to date, the parasite present in those samples appears unusual to other haplosporidians as the primary site of its detection is not connective tissue, gill or digestive gland epithelium but the gonad follicles of the host (Figures. 3.3 and 3.4). The association of the parasite with the host reproductive tissue may be subject to environmental or seasonal influence

FRDC Project 2006/064 Chapter 3: Molecular characterization explaining the differences between the parasite detected in this study and the parasite described by Hine and Thorne (2002). Hine and Thorne (2002) noted the parasite had a higher prevalence of infection and more common sporogenesis in oysters with empty gonad follicles.

All of the oysters used in this study were leading towards spawning. Hine and Thorne (2002), who did find spores in their study, noted that the spore surface microtubules derived from the episporoplasm resemble similar microtubules in epispore cytoplasmic vacuoles of Minchinia in crabs except that the microtubules are unaligned and that only Haplosporidium ascidiarum from tunicates had similar unaligned microtubules. Thus, it is possible that H. ascidiarum may also be member of genus Minchinia.

The uni-nucleated naked cells identified as the origin of the Minchinia sequence in this study, appear similar to many Bonamia species. The Minchinia are a sister taxon to the Bonamia (Figure 3.5) and consequently the prevalence of uni-nucleated cells may be a result of the evolutionary relationship between these genera. Also, there appears to be little information in the literature on the life stages of many Minchinia species rather most authors appear to have preferred to concentrate on spore morphology. Speculatively, if the cryptic uni-nucleated stages detected in this study are a major part of the life-cycle of the Minchinia then this may explain this lack of information.

FRDC Project 2006/064 Chapter 4: Detection Chapter 4 : The detection of the haplosporidian parasites in rock oysters Saccostrea cuccullata (Born, 1778) using DNA probes.

This chapter describes and assesses the specificity and sensitivity of the molecular assays developed from the SSU rRNA sequence obtained in the previous chapter. The validation of the assays is important so that their results in later experiments can be properly assessed.

FRDC Project 2006/064 Chapter 4: Detection 4.1 Introduction The effective control of diseases of aquatic animals requires access to diagnostic methods that are rapid, reliable, and highly sensitive. Histopathology has traditionally been used as the primary method for the diagnosis of shellfish diseases (Mialhe et al., 1995) since it can provide considerable information about the general health of a shellfish as well as the detection of a wide range of pathogens. However, histopathology requires professional training and many pathogens are difficult to detect by this method, if there are low numbers of parasites present within infected tissues. It can also be difficult to definitively diagnose infections based on parasite species morphology criteria.

DNA marker technology has several advantages over traditional techniques such as histopathology. DNA markers are extremely sensitive and are ideal for specifically recognizing target DNA sequences regardless of the life history stage present (Burreson & Ford, 2004). The small ribosomal subunit (SSU) region of the rRNA gene has been widely targeted since it contains both conserved and variable regions interspaced within the sequence allowing the design of universal or specific markers. While personnel involved in the development of molecular markers require a considerable amount of professional training, the molecular assays once developed may be used by laboratory staff and technicians familiar with molecular diagnostic techniques.

Some caution needs to be applied to the use of molecular assays. Often it is not known whether an assay will detect all strains of a pathogen throughout its range or if the assay reacts with other pathogen species (Burreson & Ford, 2004). The assay should be sensitive enough to detect low levels of infection in positive samples. Consequently, qualification of the specificity and quantification of the sensitivity of a molecular assay is required and the assay needs to be validated against other techniques, such as histology, so that its reliability can be determined (Burreson & Ford, 2004; Kleeman et al., 2002). The proper qualification and quantification of a molecular assay can take a considerable amount of time and can be an expensive process.

Two techniques utilising DNA marker technology are the polymerase chain reaction (PCR) and in situ hybridisation (ISH). Polymerase chain reaction allows high throughput of samples and enhanced sensitivity but can lead to false negatives (Burreson, 2000; Carnegie et al., 2003). Polymerase chain reaction also requires other visual confirmation methods so

FRDC Project 2006/064 Chapter 4: Detection as to rule out the possibility of false positives from contamination. In situ hybridisation can determine the locality of the parasite within the host and allow subsequent morphological characterisation.

Several haplosporidian parasites have demonstrated the capacity to jump hosts including Haplosporidium nelsoni and Bonamia ostrea (Burreson et al., 2000b; OIE, 2006). The ability to jump host is a concern for the management of these parasites since many haplosporidians are very cryptic and are likely to be missed in histology sections if they are not being specifically targeted.

The development of sensitive and specific PCR and ISH assays is required for a number of reasons. These include: • Enable identification of the parasite’s intermediate host despite what may be varying morphological features in an alternative stage in the parasites life-cycle. • Understanding the distribution of the parasite within the host’s tissues and the detection of any cryptic life stages in the host. • To aid in determining the geographic distribution of the rock oyster parasite. • Allow the sensitive detection of the rock oyster parasite in cross infection trials. • To assess whether the rock oyster and pearl oyster haplosporidians are the same species or are present in the same tissues.

This chapter suggests a potential PCR assay for the Minchinia sp. detected and described in Chapter 3 and commences an assessment of its sensitivity and specificity. The 30 bp oligonucleotide ISH assay developed in Chapter 3 is also assessed. Both molecular methods are compared to histology. In addition, a polynucleotide ISH assay is also developed and assessed for specificity.

FRDC Project 2006/064 Chapter 4: Detection

4.2 Methods and Materials The sources of histologically positive bivalve sections infected with target parasites are indicated in Table 4.1. Ethanol stored and formalin fixed paraffin embedded samples of Minchinia sp. were obtained from the Montebello Islands (latitude -20.4’ S longitude 115.53’ E) as described previously in Chapter 2. Extracts of genomic oyster DNA infected with Haplosporidium costale and H. nelsoni were obtained from the Virginia Institute of Marine Science (VIMS).

Table 4.1 The sources of representative pathogens and host species used in the in situ hybridisation assays. Parasite species* Phylum Host species n Sample obtained Location of Date of from infection@ infection Minchinia sp. Haplosporidia Saccostrea 20 As in Chapter 2 Montebello 2005 cuccullata Islands. Minchinia Haplosporidia Shipworm 1 Virginia Institute Wachapreague 1985 teredinis Teredo sp of Marine Science. Virginia USA Haplosporidium Haplosporidia Crassostrea 1 Virginia Institute Wachapreague 2006 costale virginica of Marine Science. Virginia USA Haplosporidium Haplosporidia Crassostrea 1 Virginia Institute Machipongo 2005 nelsoni virginica of Marine Science. River, Virginia USA. Bonamia Haplosporidia Saccostrea 4 WA Department of Oyster Creek, 1995 roughleyi glomerata Fisheries Carnarvon Marteilia sp Cercozoa Saccostrea 4 WA Department of North West 1994 cuccullata Fisheries Shelf Rhynchodid-like Ciliophora Pinctada 1 WA Department of Montebello 2001 ciliates maxima Fisheries Islands. * Representative samples were histologically positive. @ All samples were obtained from Western Australia unless otherwise stated.

4.2.1 DNA extraction. Genomic DNA from infected rock oysters was extracted from approximately 5 mg of gill tissue using a Masterpure TM DNA purification kit (Epicentre Technologies, Sydney) according to the manufacturer’s protocol.

FRDC Project 2006/064 Chapter 4: Detection 4.2.2 Amplification by Polymerase Chain Reaction. The Minchinia sp. SSU rDNA gene sequence (Genbank accession number EF 165631) was aligned with the sequences of the haplosporidian parasites Minchinia teredinis (U20319), Minchinia sp from Cyrenoida floridana (AY449712), Minchinia chitonis (AY449711), Minchinia tapetis (AY449710), Bonamia ostreae (AF262995), Bonamia roughleyi (AF508801), Haplosporidium costale (F387122), Haplosporidium pickfordi (AY452724), Haplosporidium lusitanicum (AY449713), Haplosporidium nelsoni (U19538), Urosporidium crescens (U47852) and host 18s sequences using the CLUSTALW algorithm within the MEGA 3.1 sequence analysis program (Kumar et al., 2004). The variable regions were assessed for sequences that appeared to be species specific. Sequences were then assessed for use as potential PCR primers using the software Genetool (Doubletwist). Once suitable priming regions were identified the potential primers were sent as queries to the Genbank database (http://www.ncbi.nlm.nih.gov/blast/) to determine if the primers would anneal to non target genes. Two oligonucleotides, designated SSF66 and SSR69 (Table 2) were selected and commercially synthesized (Geneworks, Sydney). The sequence of the SSR69 primer is the same as the Minchinia sp. ISH probe described earlier in Chapter 3. Genomic parasite and rock oyster DNA was subjected to polymerase chain reaction using the primers designated SSF66 and SSR69 (Table 4.2). Each PCR was performed in a total volume of 25 μL and contained 67 mM Tris-HCl, 16.6 mM [NH4]2SO4,

0.45% Triton X-100, 0.2 mg/mL gelatin and 0.2 mM dNTP’s, 1.5 mM of MgCl2, 40 pmol of each primer, and 0.55 units of Taq polymerase and template DNA. Each of the reaction mixtures were subjected to an initial denaturation phase of 5 min at 94°C, then 35 amplification cycles, each cycle consisting of 30 sec of denaturation at 94°C, 30 sec of annealing at 62°C, 2 min of extension at 72°C and then a final 7 min extension at 72°C.

A 10 μL aliquot of each of the PCR products was then loaded on a 2% agarose gel and subjected to electrophoresis for 20 min at 95 volts. Detection of the PCR products was performed using ethidium bromide staining. PhiX/Hae III (promega USA) markers were used to determine the size and concentration of the PCR products.

Primer specificity was tested in PCR reactions using genomic DNA extracted from oysters which were both positive and negative for Minchinia sp. by histopathology. Haplosporidium nelsoni and Haplosporidium costale DNA obtained from the Virginia Institute of Marine Science was also used to test PCR specificity. The infected oyster PCR reaction contained 50 ng genomic DNA isolated from the gill tissue of a histologically 65

FRDC Project 2006/064 Chapter 4: Detection positive rock oyster collected from the Montebello Islands, Western Australia. To ensure the PCR assay did not cross react with host DNA a 500 ng aliquot of genomic oyster DNA isolated from the gill tissue of an uninfected oyster was also tested.

Table 4.2 Polymerase Chain Reaction primer sequences employed in Chapter 4. Primer Sequence (5’ -3’) Position Use Reference SSF 66 ccg cgc gat gcc cag ccg tat 551 PCR Present Chapter SSR 69 agc cca aaa cca aca aaa cgt cca cat gcg 750 PCR and in situ Chapter 3 probe MinchF1B ctc gcg ggc tca gct t 1295 Generate in situ Chapter 3 probe MinchR2B ggc gct ttg cag att ccc ca 1439 Generate in situ Chapter 3 probe

94.0 oC 94.0 oC 72.0 oC 72.0 oC

62.0 oC 5:00 0:30 2:00 7:00 min min o min min 14.0 C 0:30 min

Figure 4.1 Polymerase Chain Reaction (PCR) conditions used for the PCR assay with the SSF66 and SSR69. Each of the PCR reactions was subject to 35 cycles.

4.2.3 Generation of polynucleotide probe for ISH. The first ISH assay utilised a 144 bp polynucleotide probe which was generated by PCR. Genomic parasite and rock oyster DNA was subjected to polymerase chain reaction using the primers designated Minch F1B and Minch R2B (Table 4.2). Each PCR was performed using reaction mixtures that had a total volume of 50 μL and contained 67 mM Tris-HCl,

16.6 mM [NH4]2SO4, 0.45% Triton X-100, 0.2 mg/mL gelatin and 0.2 mM dNTP’s, 2 mM

of MgCl2, 40 pmol of each primer, and 0.55 units of Taq polymerase and template DNA. Each of the reaction mixtures were subjected to an initial denaturation phase of 5 min at 94°C, then 35 amplification cycles, each cycle consisting of 30 sec of denaturation at 94°C,

FRDC Project 2006/064 Chapter 4: Detection 30 sec of annealing at 48° C , 2 min of extension at 68°C and then a final 7 min extension at 68°C (Figure 4.2). The successful amplification of target DNA by each PCR reaction was determined using the method outlined above.

94.0 oC 94.0 oC 68.0 oC 68.0 oC

48.0 oC 5:00 0:30 2:00 7:00 min min o min min 14.0 C 0:30 min

Figure 4.2 Polymerase Chain Reaction (PCR) conditions used for DNA amplification of the SSU rRNA gene utilised in the study. Each of the PCR reactions was subjected to 35 cycles.

4.2.4 In-situ hybridisation A 144 bp polynucleotide probe obtained by PCR using the primers Minch F1B and Minch R2B (Table 4.2) was purified with a QiAquick PCR purification kit (Qiagen) and labeled using a nick-translation mix (Boehringer-Mannheim), both according to manufacturer’s instructions. The second ISH assay used a 30 bp synthetic oligonucleotide (SSR69*; Table 4.2) and was labeled using a DIG Oligonucleotide Tailing Kit (Roche diagnostics).

The presence and location of each parasite species was confirmed using hematoxylin-eosin (H&E) stained serial sections. The in situ hybridisation procedure was performed as in Chapter 3. The assay was optimised by varying the Proteinase K incubation time and the concentration of the DIG-labeled probe. The optimal Proteinase K incubation time was found to be 15 min (at 50 μg/ml) while the optimal concentration of DIG labeled probe was found to be 2 ng/ml of hybridisation mix. Negative controls included histologically uninfected sections and incubation with an identical hybridisation mix but containing an irrelevant oligonucleotide probe. Parasite identity and location were confirmed in adjacent sections stained with H&E.

FRDC Project 2006/064 Chapter 4: Detection 4.2.5 Minchinia sp. diagnosis

In order to compare the diagnostic capabilities of the Minchinia sp. primers and the oligonucleotide ISH assay against the established techniques of histological examination, 56 oysters were tested using all three techniques to determine the presence of the Minchinia sp. in each individual. Histological examinations using H&E stained sections were undertaken first, with sections examined for approximately five minutes each. The PCR assay was performed next followed by ISH. The oligonucleotide ISH assay was performed using serial sections cut adjacent to the sections stained for H&E examination. Since the rate of detection in histology depends in part on the ability of the operator, a retrospective examination of the H&E stained serial sections was performed excepting sections that were negative by all three tests. The use of serial sections between the ISH and H&E stained sections meant the retrospective histological examination could be performed in less than 5 minutes since the location of the parasites could be identified within the positive ISH section. Each oyster was examined only once by the PCR and ISH assays and only a single H&E section was taken from each oyster.

The results of the comparison were evaluated using standard epidemiological methods (OIE, 2006) for sensitivity (proportion of oysters with Minchinia sp. that test positive – proportion of true positives), specificity (proportion of oysters without Minchinia sp, that test negative – proportion of true negatives), positive predictive value (PPV; the probability that an oyster returning a positive test is actually positive) and negative predictive value (NPV; the probability that an oyster that returns a negative test actually does not have Minchinia sp). The results from the molecular methods were assessed against each of the histological examinations. A chi-squared test was performed using SPSS for Windows (version 13.0) and compared the number of positives generated by each diagnostic test. The results for each diagnostic test were treated as either positive or negative regardless of the level of infection.

FRDC Project 2006/064 Chapter 4: Detection 4.3 Results

4.3.1 Polymerase Chain Reaction The PCR primer pair SSF66/SSR69 amplified a 220 bp region of the Minchinia sp. small subunit rRNA gene (Figure 4.3). The assay did not amplify the SSU sequences from H. nelsoni or H. costale infected oyster genomic DNA (Figure 4.3). The primers did not produce a product from 500 ng of genomic DNA from an oyster not infected with Minchinia DNA (Figure 4.3).

The product was easily detectable after PCR amplification using 10 fg of Minchinia sp. amplified DNA (Figure 4.4). The primers amplified the Minchinia sp. SSU rDNA from 50 ng of genomic DNA from an oyster histologically positive for the Minchinia sp. (Figure 4.4).

It was evident that increasing amounts of host DNA hindered the PCR when concentrations greater than 250 ng were added to the reaction (Figure 4.5). The PCR failed when 300 ng was added to the reaction.

4.3.2 In-situ hybridisation: DNA probe specificity In order to assess the specificity of the in situ hybridisation assays using two different SSU rDNA probes, paraffin embedded samples of oysters infected with a variety of parasites from the phyla Haplosporidia and Ciliophora, as well as a paramyxian, were subjected to in situ hybridisation. Parasite identity and location were confirmed in adjacent sections after staining with Hematoxylin-eosin (H&E; Figure 4.6).

FRDC Project 2006/064 Chapter 4: Detection

Figure 4.3 Agarose gel electrophoresis of the SSF66/SSR69 PCR products demonstrating specificity for Minchinia sp. Samples were electrophoresed in a 2% agarose gel for 45 min at 90V. Lane 1: PhiX/HaeIII molecular weight markers. The size of each marker in base pairs is indicated to the left. Lane 2: No DNA negative control. Lane 3: Positive Minchinia sp. infected rock oyster sample. Lane 4:Uninfected rock oyster. Lane 5: Haplosporidium nelsoni sample. Lane 6: Haplosporidium costale sample.

Figure 4.4 Agarose gel electrophoresis of the SSF66/SSR69 PCR products with varying amounts of amplified Minchinia sp. Samples were electrophoresed in a 2% agarose gel for 45 min at 90V. Lane 1: PhiX/HaeIII molecular weight markers. The size of each marker in base pairs is indicated to the left. Lane 2: No DNA negative control. Lane 3: 1 ng of template DNA. Lane 4: 100 pg. Lane 5: 10 pg. Lane 6: 1 pg. Lane 7 10 fg. Lane 8 1 fg

FRDC Project 2006/064 Chapter 4: Detection

Figure 4.5 Agarose gel electrophoresis of the SSF66/SSR69 PCR products with of 1 pg of amplified Minchinia sp. DNA and varying amounts of host DNA. Samples were electrophoresed in a 2% agarose gel for 45 min at 90V. Lane 1: PhiX/HaeIII molecular weight markers. The size of each marker in base pairs is indicated to the left. Lane 2: No DNA negative control. Lane 3: Positive control. Lane 4: 200 ng of host DNA. Lane 5: 250 ng. Lane 6: 300 ng. Lane 7: 400 ng. Lane 8 500 ng.

Both the ISH probes were found to hybridise to all presporulating and sporulating stages of the Minchinia sp. in rock oyster sections (Saccostrea cuccullata; Figure 4.6). The polynucleotide probe also detected intracellular Bonamia roughleyi infecting the digestive gland of a Sydney rock oyster (Figure 4.7) and produced positive results from the plasmodial stages of all of the other haplosporidian parasites tested (Figures 4.7 and 4.8) including Haplosporidium nelsoni (Figure 4.7) and H. costale infecting the digestive gland of an Eastern Oyster (Crassostrea virginica; Figure 4.8) and Minchinia teredinis from the gills of the shipworm Teredo sp (Figure 4.8). Both probes produced little background staining and did not reproduce a signal in tissues processed from uninfected oysters or in other negative control material where an irrelevant oligonucleotide probe was applied (Figures 4.5 to 4.8). Both probes failed to detect the paramyxian parasite (Marteilia sp) or the ciliate (data not shown).

FRDC Project 2006/064 Chapter 4: Detection

Figure 4.6 In-situ hybridisation both the SSR69 and polynucleotide ISH probes on a gill lesion from the rock oyster parasite described by Hine and Thorne (2002). (A): Hematoxylin-eosin stained section containing Minchinia sp. in rock oyster gill tissue. (B): Serial section used in an in situ hybridisation with the polynucleotide probe. Parasites are identified by a darker colouration. (C): Serial section used in an in situ hybridisation with the oligonucleotide probe. Sections are counterstained in a brazilin hematoxylin. (D): Negative control in situ hybridisation with an irrelevant probe. Scale bar is equal to 15 μm and applies to each picture. Example parasites are indicated by the arrow.

FRDC Project 2006/064 Chapter 4: Detection

Figure 4.7 Sections of various haplosporidian parasites used to test the specificity of the ISH probes. (A): Hematoxylin-eosin stained section containing Bonamia roughleyi in a Sydney rock oyster digestive diverticula. Scale bar = 5 μm (B): Polynucleotide in situ hybridisation from the same region. Parasites are identified by a darker colouration. Scale bar = 15 μm. (C): Oligonucleotide ISH hybridisation also from the same region. Scale bar = 5 μm. Sections are counterstained in a brazilin hematoxylin. (D): H/E of Haplosporidium nelsoni plasmodia in an Eastern Oyster (Crassostrea virginica) digestive gland. Scale bar = 5 μm (E): Serial section used in an ISH with the polynucleotide probe. Parasites are identified by a darker colouration. Scale bar = 15 μm. (F): Serial section used in an in situ hybridisation with the oligonucleotide probe. Scale bar = 15 μm.

FRDC Project 2006/064 Chapter 4: Detection

Figure 4.8 Sections of various haplosporidian parasites used to test the specificity of the ISH probes. (A): Hematoxylin-eosin stained section containing Minchinia teredinis in Teredo sp. (B): Serial section used in an ISH with the polynucleotide probe. Scale bar = 15 μm. Parasites are identified by a darker colouration. (C): Serial section used in an ISH with the oligonucleotide probe. Scale bar = 15 μm. (D): H/E stained section containing Haplosporidium costale plasmodia in an Eastern Oyster (Crassostrea virginica) digestive gland. Scale bar = 10 μm. (E): Serial section used in an ISH with the polynucleotide probe. Scale bar = 10 μm. (F): Serial section used in an ISH with the oligonucleotide probe. Scale bar = 10 μm.

FRDC Project 2006/064 Chapter 4: Detection 4.3.3 Sensitivity Both probes recognised all presporulating Minchinia sp. stages in repeated assays including uninucleate and binucleate stages (Figure 4.6). Plasmodia also produced strong positive results along with immature sporonts. The assay did not detect Minchinia sp. spores.

4.3.4 Diagnosis comparison. Infection by Minchinia sp. was detected by histological examination (an initial examination and a retrospective examination) PCR and in situ hybridisation with the oligonucleotide probe. The parasites were generally present at low levels of infection making them difficult to detect by histological examination alone. Parasites were detected in the reproductive follicles, digestive gland and gills of the host. The initial histological examination detected 14 infected oysters among the 56 oysters examined while PCR amplification detected 26 infected oysters (Table 4.3). In-situ hybridisation detected a total of 29 infected oysters (Table 4.3).

Initial histological examination diagnosed thirteen oysters as uninfected that were described as infected by PCR (Oysters 7, 8, 11, 14, 17, 18, 20, 35, 37,43, 47, 53, and 56 ; Table 4.3). These oysters were diagnosed as a light infection by in situ hybridisation. Once PCR and ISH assays were competed, a retrospective histological examination was performed. The retrospective histological examination detected parasites in eight of these oysters (oysters: 14, 17, 18, 20, 33, 37, and 47) previously described as uninfected. The intensity of infection determined by histological examination was often lower than that determined by in situ hybridisation. PCR diagnosed 3 oysters as negative that were described as a light infection by histological examination and in situ hybridisation (oyster 10, 17 and 43; Table 4.3).

FRDC Project 2006/064 Chapter 4: Detection Table 4.3 Comparison of histology, in-situ hybridisation (ISH) and PCR for detecting Minchinia sp. in 56 rock oysters. Oyster number Histology PCR ISH Retrospective All tests histology combined 1 heavy positive heavy heavy heavy 2 medium positive heavy medium heavy 3 negative negative negative negative 4 light positive light light light 5 medium positive medium medium medium 6 negative negative negative negative 7 negative positive light negative light 8 negative positive light negative light 9 negative negative negative negative 10 light negative light light light 11 negative positive light negative light 12 negative negative negative negative 13 negative negative negative negative 14 negative positive light very light* light 15 negative negative negative negative 16 negative negative negative negative 17 negative negative light very light* light 18 negative positive light very light* light 19 negative negative negative negative 20 negative positive light very light* light 21 light positive medium light medium 22 negative negative negative negative 23 light positive light light light 24 negative negative negative negative 25 light positive light light light 26 negative positive light negative light 27 negative negative negative negative 28 negative positive light very light* light 29 light positive light light light 30 negative negative negative negative 31 negative negative negative negative 32 negative negative negative negative 33 negative positive light very light* light 34 light positive light light light 35 negative negative negative negative 36 medium positive medium medium medium 37 negative positive light very light* light 38 negative negative negative negative 39 negative negative negative negative 40 negative negative negative negative 41 negative negative negative negative 42 light positive medium light light 43 negative negative light very light* light 44 Negative negative negative negative 45 light positive medium light light 46 negative negative negative negative 47 negative positive light very light* light 48 negative negative negative negative 49 negative negative negative negative 50 light positive light light light 51 negative negative negative negative 52 negative negative negative negative 53 negative positive light negative light 54 negative negative negative negative 55 negative negative negative negative 56 negative positive very Light negative very light Diagnosed positive (n) 14 26 29 23 29 Apparent prevalence 25% 46 % 52% 41 % 52 % False negatives# 26.8 % 5.4 % 0 % 10.7 % 0 % Chi-square statistic 14.0 .286 0.71 1.786 df 1 1 1 1 Significance .000 .593 .789 .181 Heavy is defined as more than 20 parasites per x20 field of view, medium is between 10-19 parasites per x20 field of view light is between 4-9 parasites per x20 field of view while very light refers between 1-3 parasites per x20 field of view. # False negatives defined relative to the all tests combined category. * Represents a change between the initial histological examination and the retrospective histological examination. Diagnoses in bold are in disagreement with the alternative tests.

FRDC Project 2006/064 Chapter 4: Detection The traditional diagnostic method provided an apparent Minchinia sp. prevalence of 25% (Table 4.4). In comparison, ISH provided the highest apparent prevalence of 52% with the highest sensitivity of 100% and an NPV of 100%. However, the specificity and PPV of ISH was relatively low (64.2% and 48.2%; Table 4.4) compared to histology because ISH allowed visualisation of low intensity Minchinia infections in 15 oysters which were negative by histology. A chi-squared test detected a significantly different result between the ISH assay and histology but a significantly different result could not be obtained compared to PCR. The retrospective histological examination, performed with the benefit of a serial ISH section, diagnosed 23 positive oysters at 41% prevalence. A chi-squared test did not detect a significantly different result between the retrospective examination and the PCR and ISH assays.

Polymerase chain reaction had a sensitivity of 92.8% and this method recorded an apparent prevalence of 46% (Table 4.4). The NPV of PCR was relatively low at 75% since this method failed to detect three low intensity Minchinia sp infections in three oysters, which were positive in ISH and retrospective histological examination. Specificity and PPV were again relatively low (69% and 50%) compared to histology because PCR obtained positive results from 12 oysters which were negative by histology (but positive by ISH). A chi- squared test detected a significantly different result between the PCR assay compared to the initial histological examination.

When histology was compared to the pooled PCR and ISH results, the molecular methods provided an apparent Minchinia sp. prevalence of 52% and a minimum prevalence of 39.01% with 95% confidence (Table 4.5). The sensitivity of histology compared to the pooled molecular methods was relatively low at 48 % with an NPV of 64%. This was because of 15 false negative results when compared to the molecular methods. Specificity and PPV were both 100% for histology (Table 4.5).

FRDC Project 2006/064 Chapter 4: Detection

Table 4.4 Evaluation of each of the diagnostic assays; PCR and ISH relative to histology. PCR ISH Histology Sensitivity 92.8% 100% 100% Specificity 69.0% 64.2% 100% PPV* 50% 48.2% 100% NPV* 75% 100% 100% Apparent 46% 52% 25% prevalence True prevalence 25% 25% 25% 95% CI of Upper:59.3% Upper:64.33% Upper:36.34% estimated true Lower:34.02% Lower:39.01% Lower:13.66% prevalence* *PPV is the positive predictive value, NPV is the negative predictive value. * Estimated using Epi Tools available at url: www.ausvet.com.au.

Table 4.5 Evaluation of each of the diagnostic assays; Histology compared to ISH and PCR. Histology PCR/ISH Sensitivity 48% 100% Specificity 100% 100% PPV* 100% 100% NPV* 64% 100% Apparent 25% 52% prevalence True prevalence 52% 52% 95% CI of Upper:79.65% Upper:64.33% estimated true Lower:24.52% Lower:39.01% prevalence* *PPV is the positive predictive value, NPV is the negative predictive value. * Estimated using Epi Tools available at url: www.ausvet.com.au.

FRDC Project 2006/064 Chapter 4: Detection

4.4 Discussion These results indicate that both the PCR assay developed in this study and the in-situ hybridisation assay developed in Chapter 3 were capable of detecting Minchinia sp. in rock oysters. The comparison of diagnostic techniques suggested the ISH assay was the most sensitive followed by PCR (Tables 4.3 and 4.4).

4.4.1 Specificity and sensitivity of the PCR assay. The SSF66/SSR69 PCR assay targeted variable sections within the SSU region of the parasite’s rRNA gene. The assay recognised only the Minchinia sp. infected rock oyster and did not detect either Haplosporidium nelsoni or Haplosporidium costale DNA (Figure 4.3). Further testing is required using closely related Minchinia species such as M. tapetis and M. teredinis in order to confirm the PCR assay doesn’t cross react with these species. All of the negative control material including uninfected oysters and irrelevant probe controls were negative.

The assay did appear to suffer from the focal or patchy distribution of the parasite in the host. One oyster produced a negative result by PCR which was subsequently found to be positive by the initial histological examination (oyster 10; Table 4.3) while two oysters were found to be very lightly infected in the retrospective histological examination (oysters 17 and 43; Table 4.3). All three of these oysters were diagnosed as infected by the oligonucleotide ISH assay. These results suggest that DNA was extracted from tissues of the host that did not contain sufficient numbers of parasites to produce a positive PCR result and that section-based methods are potentially more accurate because more tissue types are examined. The parasite appears to have a localised distribution in lightly infected oysters, and hence it may be difficult to detect early or very light infections using PCR. A similar result was also obtained by Diggles et al (2003) in their comparison of diagnostic techniques for Bonamia exitiosus from flat oysters (Ostrea chilensis) in New Zealand.

The amount of host DNA in the reproductive tissue can be substantial and needs to be greatly diluted to avoid inhibition of the PCR reaction. A small quantity of target DNA in a very high amount of host DNA can result in a marked decrease in PCR sensitivity, perhaps because of decreased potential for primer template binding (Zimmermann et al., 1994). The assay was successful in detecting 10 fg of template DNA in 250 ng of host DNA (Figure 4.5).

FRDC Project 2006/064 Chapter 4: Detection

While PCR doesn’t allow quantification of infection intensity, it did detect low intensity infections in the majority of cases when the results of the tests were compared for each oyster (Table 4.3). Histological examination did not detect fifteen oysters described as infected by PCR and/or in-situ hybridisation. Subsequent re-examination of these oysters resulted in an additional nine infections being detected (Table 4.3). The retrospective examination indicated the parasite was present in the H&E sections but was not easily detectable after five minutes of searching. It is possible that the efficiency of detection for histological examination may be different for alternative personnel depending on their skill, level of experience and the length of time they spend examining the sections. The retrospective histological examination did not detect infection in six oysters described as infected by PCR and in-situ hybridisation. Overall, the PCR assay was found to be more sensitive than the initial histological examination for detecting the Minchinia sp. infecting rock oysters (Tables 4.3, 4.4 and 4.5). No statistically significant difference was detected between the PCR and ISH assays and therefore PCR assay may provide an inexpensive method for detecting the parasite.

4.4.2 The 30 bp oligonucleotide ISH assay The 30 bp oligonucleotide probe targeted a variable section of the SSU region of the parasite’s rRNA gene in order to confer a higher level of specificity than the polynucleotide ISH probe. The oligonucleotide probe only recognized the Minchinia sp. infecting rock oysters. The probe did not recognize closely related haplosporidian parasites such as Minchinia teredinis, Bonamia roughleyi, Haplosporidium costale or Haplosporidium nelsoni or cross react with any of the host species tested (Figures 4.6, 4.7 and 8). Consequently, the ISH assay utilising the 30 bp oligonucleotide probe is likely to be species specific. It is impossible to ensure the assay does not react to uncharacterised or untested haplosporidian parasites. The assay was successful in localising individual parasites thereby detecting low levels of infection.

The comparison of diagnostic techniques summarised in Table 4.3 suggests the oligonucleotide ISH assay is more sensitive than the initial histological examination (Tables 4.3, 4.4 and 4.5). These data highlight the difficulty in detecting low numbers of relatively cryptic parasites in H&E sections that may be present in a variety of different tissue types. The oligonucleotide ISH assay detected the highest number of infected oysters in the comparison (29 from 56 oysters examined; Table 4.3). The sensitivity of the assay means

FRDC Project 2006/064 Chapter 4: Detection the pathogen is detected earlier in the infection cycle and lower levels of infection can be detected. In-situ hybridisation costs considerably more that PCR and therefore it may be most suited to detecting the pathogen in low numbers of oysters where high sensitivity is required. Alternatively, in-situ hybridisation could be used to confirm the results of high volume PCR screening, when histology proves difficult.

Further testing of rock oysters infected with Minchinia sp. is required to ensure the assay detects all strains of the parasite throughout its range. The oligonucleotide assay will be a useful confirmatory diagnostic test to ensure no contamination of PCR has occurred since it allows visualisation of the parasite within host tissues.

4.4.3 The polynucleotide ISH assay A polynucleotide ISH probe was used by (Cochennec et al., 2000) to detect Bonamia ostrea in Ostrea edulis and was found to also detect Bonamia sp. in infected Tiostrea chilensis and H. nelsoni in infected Crassostrea virginica. The 144 bp polynucleotide probe obtained from the Minchinia sp. produced strong hybridisation signals with all of the haplosporidian parasites tested (Minchinia sp., Minchinia teredinis, Haplosporidium nelsoni, Haplosporidium costale and Bonamia roughleyi) and did not cross react with any host tissues in the five bivalve species tested (Saccostrea cuccullata, Saccostrea glomerata, Crassostrea virginica, Pinctada maxima and Teredo sp; Figures 4.7 and 4.8). Further testing is required in order to assess whether the assay recognises basal or putative haplosporidian parasites such as the parasite detected in New Zealand paua, Haliotis iris (Diggles et al., 2002) or Urosporidium species. However, since the polynucleotide probe recognised three of the four Haplosporidia genera (Minchinia, Haplosporidium and Bonamia) the ISH assay may be a phylum specific test. The polynucleotide ISH probe failed to recognise Marteilia sp. from rock oysters (Saccostrea cuccullata) or the Rhynchodid-like ciliate (Ciliophora). In addition, incidental parasites that did not belong to the Haplosporidia, found in rock oysters (copepods, gregarines) did not cross-react (unpublished observations).

Disease has not been a major problem for the mollusc industries of Western Australia since major mortalities have not been reported for sometime. However, it is certain that many more pathogenic organisms remain to be discovered, especially as molluscs become subject to aquaculture or are subjected to environmental stresses associated with economic activity

FRDC Project 2006/064 Chapter 4: Detection (Jones & Creeper, 2006). Because of the age of the Australian continent and its relative isolation, many of these pathogens may prove to be unique to Western Australia (Jones & Creeper, 2006). The polynucleotide ISH assay may be a useful tool for disease surveys of wild bivalve populations for haplosporidian parasites at low levels of infection. Many haplosporidians are known to cause considerable losses in naïve hosts following translocation (Burreson & Ford, 2004; Burreson et al., 2000b). Eradication of these parasites, once they have become established, is usually not feasible. The polynucleotide ISH assay is able to detect a variety of haplosporidian parasites in a variety of bi-valve species. Thus, it may provide target tissues for further analysis in the detection of undescribed or difficult to detect haplosporidian parasites at low levels of infection. Once a positive result has been obtained, the polynucleotide ISH assay must be used in conjunction with alternative assays (such as PCR, histological examination or electron microscopy) that will confirm the haplosporidian infection and allow speciation. It is possible that the polynucleotide assay may cross react with other untested parasite groups and consequently needs to be used with caution just as it is also possible for untested haplosporidian parasite species to cross react with the oligonucleotide probe.

Neither ISH assay recognised mature haplosporidian spores. The inability of the assay to detect mature spores is consistent with other haplosporidian parasites. Stokes et al., (1995a) and Stokes et al., (1995b) reported similar results in two haplosporidian species (Haplosporidium nelsoni and Minchinia teredinis). These findings were attributed to the inability of either the probe and/or the anti dioxigenin antibody to penetrate the spore wall. The lack of spore recognition may hamper the use of the assay in life cycle studies, such as the identification of an intermediate host. These results contrast with (Carnegie et al., 2006) whose ISH assay did recognise the spores of Bonamia perspora. Since Bonamia perspora is the only species of Bonamia recognized to produce spores it is likely that it’s spores may enable penetration of the spore wall by either the probe and/or the anti dioxigenin antibody.

The PCR and in situ hybridisation tests developed and optimised in this study should prove a valuable research tool. Highly sensitive and reliable detection methods for the Minchinia sp. infecting rock oysters will facilitate and speed up further research into this parasite and the interactions between the parasite and its host.

FRDC Project 2006/064 Chapter 5: Co-infection Chapter 5 : Detection of Minchinia sp. in Haplosporidium sp. infected pearl oysters Pinctada maxima (Jameson, 1901).

This chapter describes how the identity of the haplosporidian parasites of pearl oysters was determined using the molecular assays developed in the previous chapters. This chapter relates to objective 1.

FRDC Project 2006/064 Chapter 5: Co-infection 5.1 Introduction

The infection of pearl oysters, Pinctada maxima, attributed to a Haplosporidium sp. by Hine and Thorne (1998) has been detected on three occasions (Jones & Creeper, 2006). The location of these infections was indicated in Figure 1.1. The prevalence of infection determined histologically in the Carnarvon outbreak was 4.0% (6/150) and in Cascade Bay in King Sound it was 4.7% (7/150). However, when the oysters from the latter outbreak were culled 15 days later the prevalence of infection had increased to 10.0% (Jones & Creeper, 2006). The parasite is recognized as a significant concern for the pearling industry (Humphrey & Norton, 2005; Humphrey et al., 1998).

Chapter 3 demonstrated an infection by Minchinia sp. in rock oysters (Saccostrea cuccullata) in pearl producing zones of Western Australia (Hine & Thorne, 2002). The differential diagnosis of the rock and pearl oyster haplosporidians is based on the ultrastructural characteristics of the spores (Hine & Thorne, 1998; Hine & Thorne, 2002).

In an effort to determine whether Haplosporidium sp. infected pearl oyster spat from past outbreaks also contained Minchinia sp. previously detected in rock oysters (Saccostrea cuccullata; Chapter 3) a polymerase chain reaction (PCR) and in situ hybridisation (ISH) assay for Minchinia sp. was used to analyze haplosporidians in archived tissues from Haplosporidium sp. infected pearl oysters.

5.2 Methods and materials Representative histologically-positive paraffin-embedded pearl oyster spat infected with Haplosporidium sp. Hine and Thorne, 1998 were obtained from archived cases of previously reported outbreaks (Hine, 1996; Hine & Thorne, 1998; Jones & Creeper, 2006). The original geographic location of the source material is shown in Figure 5.1. Formalin fixed paraffin embedded samples of Minchinia sp. in S. cuccullata were obtained from the Montebello Islands as described in Chapter 2.

In order to assess whether Minchinia sp. was present in Haplosporidium sp. infected pearl oysters, archived formalin fixed samples of pearl oysters infected with the parasite were subjected to PCR. Overall, twelve histologically positive Haplosporidium sp. samples were analysed. Six of these samples were from Carnarvon, four were from Cascade Bay and two were from Willie Creek. Two regions were identified for amplification. The Minch 84

FRDC Project 2006/064 Chapter 5: Co-infection F1B/R2B primers encompass a variable section of the small ribosomal subunit (SSU) region of the parasite’s rRNA gene while an additional amplification was performed using the SSF66 and SSR69 primers.

5.2.1 DNA extraction: Archived samples. Genomic DNA was extracted from the formalin-fixed paraffin embedded pearl oysters using the freeze thaw method outlined in Chapter 3. The quality of the genomic DNA and absence of inhibitory factors from the extractions was verified using PCR with bivalve primers 16R3 5’-GCT GTT ATC CCT RNR GTA-3’ and Proto 16’F’-AWK WGA CRA GAA GAC-3’ (Chase et al., 1998). Genomic DNA was extracted from the formalin-fixed paraffin-embedded pearl oysters using the freeze thaw method outlined in Chapter 3.

5.2.2 Amplification by Polymerase Chain Reaction. Histologically positive Haplosporidium sp. samples from the Willie Creek and Carnarvon infection sites were amplified using Minch F1B and Minch R2B primers. These primers amplify a 144 bp section within the SSU region of the rRNA gene from Minchinia sp. infecting Saccostrea cuccullata on the same coastline as the pearl oyster parasite. The Minch F1B and R2B primers encompass a variable section within the SSU region of the rRNA gene.

Each PCR was performed using the method outlined in Chapter 3. An additional measure was taken to ensure the absence of contamination from genomic Minchinia sp. DNA in the F1B/R2B reactions. This measure involved the attempted amplification of a 754 bp section of the Minchinia sp rRNA gene using the FSSUF/SSR69 primers. A positive amplification from these primers would indicate contamination since formalin fixation results in the cross linking of histones and fragmentation of sample DNA making amplification of sequences larger than 300 to 500 bp difficult (Paabo, 1990). Thos primer combination was assessed using genomic rock oyster DNA to ensure successful amplification of the target sequence. The reaction conditions for the FSSUF/SSR69 reactions were as follows: Reaction mixtures had a total volume of 25 μL and contained reaction buffer (67 mM Tris-HCl, 16.6 mM [NH4]2SO4, 0.45% Triton X-100, 0.2 mg/mL Gelatin and 0.2 mM dNTP’s), 2 mM of

MgCl2, 40 pmol of each primer, and 0.55 units of Taq polymerase and template DNA. Each of the reaction mixtures was subjected to (i) an initial denaturation phase of 5 min at 94°C, (ii) 35 amplification cycles, each cycle consisting of 30 sec of denaturation at 94°C, 85

FRDC Project 2006/064 Chapter 5: Co-infection 30 sec of annealing at 59°C, 4 minutes of extension at 68°C and (iii) a final 7 min extension at 68°C. Polymerase chain reaction products were visualised by loading a 10 μL aliquot of the products on a 2% agarose gel and electrophoresing it for 20 min at 90 volts. Detection of the PCR products was performed using ethidium bromide staining.

Given the assessment of potential contamination by the FSSUF/SSR69 reactions may be confounded if the source of contamination were shorter gene fragments from the F1B/R2B PCR and cloning reactions an alternative region was selected for amplification. This assay was required since the F1B/R2B reactions were commonly used in this laboratory to assess rock oyster samples for Minchinia sp. Consequently, potential contamination by shorter rRNA gene fragments, such as those from the F1B/R2B PCR reactions were assessed by using the primers designated SSF66 and SSR69 (Chapter 4). These primers were designed to target a 220 bp sequence (Appendix 1) so that amplification from formalin fixed tissues could be reliably performed. The successful amplification of a 220 bp region ensured the absence of contamination from shorter PCR products in the Minch PCR reactions. The SSF66/SSR69 primers target variable regions of the parasite’s SSU rRNA gene but encompass a conserved region. Amplification conditions were the same as for the Minch primers except the annealing temperature was raised to 62 °C. The specificity of the SSF66/SSR69 primers was assessed with H. nelsoni and H. costale DNA.

Table 5.1 Primer sequences employed in Chapter 5. Primer Sequence (5’ -3’) Position* Reference Minch F1B ctc gcg ggc tca gct t 1295 Chapter 3 Minch R2B ggc gct ttg cag att ccc ca 1439 Chapter 3 SSF66 ccg ccg atg ccc agc cgt at 551 Chapter 4 SSR69 agc cca aaa cca aca aaa cgt cca ca 754 Chapter 3 FSSUF ctc aaa gat taa gcc atg cat gtc caa gta ta # Chapter 3 SSRDb# gtt agc ctt gcg cgc agc cga tac g 567 This Chapter *Position on the entire Minchinia sp. SSU rRNA gene sequence Genbank accession: EF 165631. SSRDb was used as an ISH probe only. SSR69 was used as both a PCR primer and an ISH probe. # FSSUF primer targets a region before EF165631.

Each PCR was performed using the method outlined in Chapter 3. In order to ensure no contamination with genomic Minchinia DNA had occurred primers which target a 754 bp section of the Minchinia sp. rRNA gene were employed. These reactions were performed in addition to the usual negative controls employed in all PCR reactions. These primers

FRDC Project 2006/064 Chapter 5: Co-infection (FSSUF and SSR69; Table 5.1) were used to amplify a section of the Minchinia sp. in Chapter 3. A positive amplification from these primers would indicate contamination since formalin fixation results in the cross linking of histones and fragmentation of sample DNA making amplification of sequences larger than 300 to 500 bp difficult (Paabo, 1990). Potential contamination by shorter rRNA gene fragments, such as those from PCR reactions were assessed by using the primers designated SSF66 and SSR69 (Table 5.1). The SSF66/SSR69 primers target variable regions of the parasite’s SSU rRNA gene but encompass a conserved region. These primers were assessed in Chapter 4 and were found not to react to closely related haplosporidian species H. nelsoni and H. costale. The SSF66/SSR69 primers target a 220 bp sequence so that amplification from formalin fixed tissues could be reliably performed. The successful amplification of a 220 bp region ensured the absence of contamination from shorter PCR products in the Minch F1B/R2B PCR reactions. Amplification conditions were the same as for the Minch primers except the annealing temperature was raised to 62 oC.

Polymerase chain reaction was also used to attempt to amplify Haplosporidium sp. DNA from the histologically positive pearl oyster samples. These reactions were performed using all combinations of the HAP primers (Renault et al., 2000) and at least 10 other primer combinations of novel design utilising 16 s, and protozoan (Carnegie et al., 2003) primers with proximate target regions suitable for amplification from formalin fixed material (Appendix 2).

5.2.3 DNA sequencing DNA cloning and sequencing was performed using the method outlined in Chapter 3. Three cloned DNA inserts were each sequenced for each positive PCR. Primer sequences were removed from each end of the resulting consensus sequence and the identity, position and direction of the PCR products were verified by directly comparing to the Minchinia sp. SSU rRNA sequence from S. cuccullata. Additional comparisons were also made using BLAST searches of GenBank database: (http://www.ncbi.nlm.nih.gov/blast/).

5.2.4 In-situ hybridisation In addition to the precautions taken to ensure the absence of contamination in the PCR reactions, ISH was also performed. In situ hybridisation was performed on formalin-fixed, paraffin-embedded tissue collected at the Carnarvon, Cascade Bay and Willie Creek infection sites. In situ hybridization was performed using the 30 bp oligonucleotide probe 87

FRDC Project 2006/064 Chapter 5: Co-infection (SSR69) developed in Chapter 3 and assessed in Chapter 4. Positive controls included sections of rock oyster infected with Minchinia sp. collected from the Montebello Islands in July 2005. Negative controls used sections containing no DNA in the hybridisation mix as well as uninfected pearl oyster spat obtained from the Broome hatchery. The in situ hybridisation procedure was performed using the method outlined in Chapter 3. The specificity of the probe was monitored using Haplosporidium costale and Minchinia teredinis sections included in all of the assays (Figure 5.6). These parasites were chosen for specificity tests since they possess the closest known sequences to the SSR69 probe. In order to confirm the results of the SSR69 probe another oligonucleotide probe was designed. The new probe was designated SSRDb and its sequence was 5’ GTT AGC CTT GCG CGC AGC CGA TAC G 3’. The SSRDb probe targets a highly variable region on the Minchinia’s SSU rDNA sequence (positions 567-588; Appendix 1). The new probe was commercially synthesized and labelled with dioxigenin at the 3’ end (Operon Technologies, Germany). Specificity of the SSRDb probe was assessed and monitored using Haplosporidium costale, Haplosporidium nelsoni and Minchinia teredinis sections. The procedure used for the SSRDb ISH assay was identical to that used for the SSR69 ISH assay and is described in Chapter 4. However, the procedure was varied for the pearl oyster samples since many of the heavily infected the digestive glands of these samples would disintegrate during the ISH procedure resulting in the loss of a considerable number of samples. This problem was overcome by reducing the Proteinase K digestion time to 15 minutes.

5.2.5 Genealogical comparisons of the SSU rRNA sequences The phylogenetic relationships between SSU rRNA sequences of Minchinia sp. were compared to other Minchinia spp. using distance based trees and an multidimensional scaling (MDS) analysis of pairwise comparisons of genetic distances performed using the software SPSS 13.0.

5.2.5.1 Interspecific relationships. The SSU region of the rRNA gene sequences used in the distance comparison were obtained from Genbank. The sequences used belonged to Haplosporidium nelsoni (U19538), Minchinia teredines (U20319), Minchinia tapetis (AY449710), Minchina chitonis (AY449711), Minchinia sp. from Cyrenoida floridana (AY449712), Bonamia ostreae (AF262995), Bonamia exitiosa (AF337563). Sequences were aligned using CLUSTALW (Thompson et al., 1994) in MEGA 3.1 software (Kumar et al., 2004). 88

FRDC Project 2006/064 Chapter 5: Co-infection

Distance based trees were constructed using the MEGA 3.1 computer program (Kumar et al., 2004) with a neighbour-joining algorithm (Saitou & Nei, 1987). The tree was constructed in order to highlight the relationships between the sequences obtained in this study and those of closely related parasites in the Bonamia and Minchinia genera. The neighbour-joining method of tree construction is well suited to the situation where one does not know whether rates of substitution are constant across all clades of the tree as was the case in this study (Saitou & Nei, 1987). An alternative method of tree construction is the maximum parsimony approach. However, the lack of a meaningful outgroup in this chapter of the study invalidates this procedure. Nodal support was determined by 1000 replicate bootstrap analyses.

The bootstrap analysis method to assess confidence in a tree. A bootstrap test was used to assess confidence in the nodes of the neighbour joining tree. This method uses a subset of the original data and, from this new data set, a new tree is constructed (Felsenstein, 1985). Each node in the original tree is compared to the new tree to determine whether the tree has the same cluster of sequences. This whole procedure of resampling the data, drawing a tree, and tallying up nodes that are in the original tree is repeated perhaps a 1000 times (Felsenstein, 1985). The final result is shown graphically as a number next to each node which indicates the percentage of times that the cluster is present among the resampled trees. If that percentage is high, then it is more likely that the cluster actually does belong together.

5.2.5.2 Intraspecific variation: The Minimum Spanning Network. Relationships amongst the SSU rRNA sequences were explored using a minimum spanning network (MSN). An MSN, describing the nucleotide substitutions amongst the SSU rRNA alleles was constructed by statistical parsimony, as applied in the software TCS 1.18 (Clement et al., 2000). A network can more clearly and precisely reproduce the evolutionary relationships of closely related, intra-specific alleles, particularly as ancestral alleles can continue into existing populations (Templeton, 2001). Networks can also include both indels and missing alleles such as extinct or unsampled alleles in the substitution pathways between alleles. In addition, networks can include information about the existence of alleles through evolutionary time that can be inferred from inter-alleles

FRDC Project 2006/064 Chapter 5: Co-infection relationships (Templeton, 1998) and can be used to compare genetic and geographic distances.

Once the necessary input file was constructed for the TCS 1.18 software, a parsimony connection limit of P = 0.05 was used in the construction of the network. The output was untangled so that no SSU rRNA alleles crossed base substitutions. Nucleotide substitutions were displayed on the network along with the base change, type and location. The network was then applied to a map indicating the location from which the sequences were obtained.

FRDC Project 2006/064 Chapter 5: Co-infection

5.3 Results

5.3.1 Polymerase Chain Reaction The reactions with the Minch F1B/R2B primers produced consistently positive results with no indication of contamination (Figures 5.1 and 5.2). Of the twelve histologically positive pearl oysters samples tested, five were positive by PCR (Table 5.2). Of the six histologically positive samples from Carnarvon three produced positive PCR results while both of the Willie Creek samples produced positive PCRs (Table 5.2). No Minchinia sp. sequences could be obtained from the four histologically positive Cascade Bay samples. While these samples were negative by ISH, samples from Cascade Bay did produce positive ISH results with the SSRDb and SSR69 probes at low levels of intensity (SSRDb 8/30; 26.7%; SSR69 30/94 36%). Overall, three clones were obtained from each of the positive PCR samples to produce fifteen sequences.

Table 5.2 Summary of number of samples tested and a comparison of results from PCR

Location n Positive PCR ISH-SSR69 ISH-SSRDb Cascade Bay 4 0 4 0 Cascade Bay 2 30* N/A N/A 8 Carnarvon 6 3 6 3 Willie Creek 2 2 2 2 and ISH assays. * Second batch of archived Cascade Bay oysters were histologically negative although retrospective examination of the ISH (SSRDb) positive sections revealed haplosporidian parasites in the affected tissues.

Attempts detect contamination with genomic Minchinia sp. DNA by amplifying a 754 bp section of the Minchinia sp. rRNA gene using the FSSUF and SSR69 primers failed (Figure 5.2). This result is consistent with observations that amplification of formalin fixed tissues above 200-500 bp is difficult. In addition, the SSF66/SSR69 primers that target a different 220 bp region were successful in obtaining a positive reaction from the Willie Creek and Carnarvon samples ensuring the absence of contamination from shorter PCR products in the Minch PCR reactions.

When the 144 bp sequences were compared to the sequences of Minchinia sp. from S. cuccullata, the genetic distances between the sequences were considerably less than the distance between known species for this region (Figures 5.3 and 5.4). The region targeted by the Minch primers is a variable section of the parasite’s SSU rRNA gene. Four sites 91

FRDC Project 2006/064 Chapter 5: Co-infection within the 144 bp SSU rRNA sequence produced by the pearl and the archived rock oyster parasites described by Hine and Thorne (2002) were different to that produced by the

Minchinia sp. (GenBank accession number: EF 165631). Base 1389 on EF165631 were different in all parasite SSU rRNA sequences from Carnarvon which had a T at this site rather than the C present in the other samples (Appendix 1). Both the Carnarvon and the sequence obtained from the rock oyster samples described by Hine and Thorne (2002) had a G substituted for an A at base 1359 on EF 165631. One of the Carnarvon sequences had a T at base 1311 rather than the C present in all other samples. Both Willie Creek samples were identical to the 2005 rock oyster samples except base 1315 had an A substituted for a G.

The sequences produced by the SSF66/SSR69 primers from the Willie Creek and Carnarvon samples were identical to that obtained from the Minchinia sp. infecting rock oysters from the Montebello Islands. Consequently, the sequences obtained from the Willie Creek samples had a known sequence of 364 bp with only a single base pair difference with the Minchinia parasite.

FRDC Project 2006/064 Chapter 5: Co-infection

Figure 5.1 Agarose gel electrophoresis of formalin pearl oyster tissue from each of the infection sites. Samples were electrophoresed in a 2% agarose gel for 20 minutes at 90V. Lane 1 contains HindIII/Phi markers, size of markers are indicated on the left. Lane 2 is the negative control (no DNA), Lane 3 contains haplosporidian DNA from the Carnarvon site, Lane 4 contains haplosporidian DNA also from the Carnarvon site, Lane 5 contains haplosporidian DNA from the Willie creek site. Lane 6 contains haplosporidian DNA also from the Willie Creek site. DNA was stained with ethidium bromide and visualised using UV light.

Attempts to obtain Haplosporidium sp. DNA from the histologically positive samples utilising the HAP (Renault et al., 2000), 16 s (Medlin et al., 1988), Protozoan (Carnegie et al., 2003) and novel primers (Appendix 2) were unsuccessful in producing any Haplosporidium sp. sequences.

FRDC Project 2006/064 Chapter 5: Co-infection

Figure 5.2 Agarose gel electrophoresis of the FSSUF and SSR69 primers and formalin fixed pearl oyster tissue from the Willie Creek infection site. Samples were electrophoresed in a 2% agarose gel for 20 minutes at 90V. Lane 1 contains HindIII/Phi markers, size of markers are indicated on the left. Lane 2 is the negative control (no DNA). Lanes 3 and 4 contains haplosporidian infected pearl oyster DNA from the Willie Creek site. Lane 5 contains Minchinia sp. infected genomic oyster DNA from the Montebello Islands (positive control). DNA was stained with ethidium bromide and visualised using UV light.

Interspecific comparison with other Minchinia species. Overall, the genetic distance between the pearl oyster parasite PCR products was of the same magnitude as the genetic distance between the pearl oyster PCR products compared to the rock oyster PCR products (Figures 5.3 and 5.4). No sequences could be obtained from the Cascade Bay samples.

FRDC Project 2006/064 Chapter 5: Co-infection

67 Carnarvon pearl oyster allele 1 63 Carnarvon pearl oyster allele 2 50 Rock oyster parasite 1990s 100 Willie creek pearl parasite 2000 72 Rock oyster parasite 2005 89 Minchinia tapetis Minchinia parasite of Cyrenoida floridana

97 Minchinia chitonis 62 Minchinia teredinis Bonamia ostreae

100 Bonamia exitiosa 75 Bonamia perspora Haplosporidium nelsoni

0.02

Figure 5.3 Neighbour Joining tree illustrating the relationships among the 144 bp SSU rRNA gene sequences from phylum Haplosporidia. Tree was constructed with a Kimura 2- parameter algorithm. The scale bar represents the equivalent of 0.02% nucleotide sequence divergence. Nodes are supported by a 1000 replicate bootstrap analysis.

In order to compare the spatial patterns of the SSU rRNA gene sequence differentiation among the samples, the multi-dimensional scaling (MDS) method (Hair et al., 1992) was used to map the genetic distance between each pair of samples in two-dimensional space.

FRDC Project 2006/064 Chapter 5: Co-infection

CarnarvonB Rock.oyster.parasite.2002 CarnarvonA Willie.Creek.pearl.parasite Minchinia sp.

M. tapetis

Genetic M. chinonis Distance B.ostreae B.exitiosa B.perspora Minchinia sp from C.floridana

M. teredinis

H.nelsoni

Genetic Distance

Figure 5.4 A two-dimensional ordination of the pairwise genetic distances obtained from the rock and pearl oyster samples. Carnarvon represents the haplosporidian sequence obtained from Carnarvon pearl oyster spat. Rock oyster parasite 2002 represents the sequence obtained from the samples described by Hine and Thorne (2002). Willie Creek represents the sequence obtained from the Willie Creek haplosporidian sample. Minchinia sp. represents the original sequence obtained in chapter 3. Stress level = 0.08.

The MDS clearly shows the pearl oyster sequences grouping closely together with the rock oyster samples and are distinct from the rest of the Minchinia and are even more distant from the Bonamia and the Haplosporidium (Figure 5.4).

5.3.2 In situ Hybridisation In situ hybridisation was performed in order to validate the sequences obtained by PCR from the infected pearl oyster tissues and confirm the positive PCRs were not the result of contamination. Parasite identity and location in tissue sections was confirmed in hematoxylin-eosin sections cut adjacent to those tested with in situ hybridisation (Figures 5.5 and 5.6). The SSR69 in situ hybridisation assay yielded positive reactions from all of the parasite-infected pearl and rock oysters (Figures 5.5 and 5.6). As in Chapter 4 the assay 96

FRDC Project 2006/064 Chapter 5: Co-infection did not hybridise to Haplosporidium costale, H. nelsoni or Minchinia teredinis infected oyster tissues.

Since it is impossible to rule out a chance cross reaction with an undescribed haplosporidian species such as the pearl oyster parasite, a second oligonucleotide ISH probe was designed. The new probe was designated SSRDb. The SSRDb ISH assay yielded positive reactions from the haplosporidian infected rock oysters but only some of the haplosporidian parasites in infected pearl oysters produced a positive reaction (Figure 5.7). The SSRDb probe did not react to closely related haplosporidian species Haplosporidium costale, Haplosporidium nelsoni or Minchinia teredinis (Figure 5.8). The cells reacting to the SSRDb probe were detected in the connective (Leydig) tissue surrounding the digestive gland and less commonly in the mantle and gills of infected oysters. The cells consisted predominately of single; bi- and tri- nucleate life stages and were approximately 7 μm in diameter. No phagocytosis of parasite cells or necrotic debris was observed despite the presence of granulocytes among the parasites. The intensity of infection of the SSRDb positive cells was considerably lower when compared to the cells detected by the SSR69 probe (Figure 5.6 and 5.7).

FRDC Project 2006/064 Chapter 5: Co-infection

Figure 5.5 Pearl oyster tissue containing haplosporidian parasites in a hematoxylin-eosin stained section. (A): Entire oyster with a heavily infected digestive gland (arrow). Scale bar = 100 μm. (B): Higher magnification view of the same pearl oyster. Several life stages of the haplosporidian parasite are present. Scale bar = 30 μm.

FRDC Project 2006/064 Chapter 5: Co-infection

Figure 5.6 Haplosporidian parasites (arrows) identified in an in situ hybridisation of pearl oyster digestive gland. (A): In situ hybridisation containing the SSR69 probe. Parasites are identified by a darker colouration. Scale bar = 0.5 mm. (B): higher magnification view of the same section. Scale bar = 30 μm. (C): Negative control (no probe) serial section from the same in situ hybridisation. Sections are counterstained in a brazilin hematoxylin. Scale bar = 30 μm.

FRDC Project 2006/064 Chapter 5: Co-infection

Figure 5.7 Haplosporidian parasites (arrows) identified in an in situ hybridisation of pearl oyster digestive gland. (A): H&E stained section of an infected pearl oyster digestive gland. Scale bar = 75 μm (B) Higher magnification view of the same section. Example haplosporidians are indicated with an arrow. M denotes a Minchinia, while H denotes a Haplosporidium. Scale bar = 30 μm (C) Serial in situ hybridisation containing the SSRDb probe. Scale bar = 75 μm (D): Higher magnification view of the same section. Arrow with an M denotes a Minchinia while H denotes a Haplosporidium. Scale bar = 30 μm (E): Negative control serial section containing an irrelevant probe. Scale bar = 75 μm. (F): H&E stained section of an infected rock oyster gill section. Arrow indicates example parasite. Scale bar = 40 μm. (G) Serial in situ hybridisation containing the SSRDb probe of the rock oyster gill section. Scale bar = 40 μm. (I): Negative control serial section containing an irrelevant probe. Scale bar = 40 μm. Sections are counterstained in a brazilin haematoxylin. .

100

FRDC Project 2006/064 Chapter 5: Co-infection

Figure 5.8 Bi-valve sections used to assess the specificity of the SSRDb ISH assay. Arrows indicate example parasites. (A) Haplosporidium nelsoni infected Eastern oyster (Crassostrea virginica) digestive gland. Scale bar = 35 μm, Minchinia teredinis in Teredo sp. gill. Scale bar = 40 μm. (B) and Haplosporidium costale infected Eastern oyster digestive gland. Scale Bar = 20 μm.

101

FRDC Project 2006/064 Chapter 5: Co-infection Intraspecific variation among the Minchinia sp. alleles Enough polymorphic sites were found within the Minch SSU rRNA sequences to allow some preliminary assessment of intraspecific genetic variation. Overall, a 144 bp portion of the SSU rRNA gene was sequenced for 17 individuals from five sampling locations (including archived rock oyster samples). The five polymorphic sites were identified in the SSU rRNA sequences which led to the identification of five different alleles among the 17 individuals sampled from various hosts. The evolutionary relationships among the haplosporidian SSU rRNA alleles were estimated by constructing a network using the parsimony method of Templeton (1998). The network was imposed onto a map of the region where the infections and the resulting sequences were detected and is displayed in Figure 5.9.

Slightly different groups were recognisable in the MSN when compared to both the neighbour-joining tree (Figure 5.3) and MDS analysis (Figure 5.9). The network more clearly illustrates the nature of the relationships among the alleles (Figure 5.9). Unlike the distance based tree, the MSN also showed a tendency for the SSU rRNA sequences from the same geographic region to cluster together rather than sequences from each host to group together. The main findings of the MSN were: • Sequences grouped on the basis of geographic region rather than by host species. • Sequences were also grouped according to the year of sampling. • The rock oyster parasite SSU rRNA sequences were between the pearl oyster SSU rDNA sequences from the two different regions.

102

FRDC Project 2006/064 Chapter 5: Co-infection

Figure 5.9 Minimum spanning network of the SSU rRNA gene sequences obtained from the rock and pearl oyster parasites. The blue rectangles represent extant parasite SSU rRNA alleles. Site indicates position on the Minch F1B/R2B sequence (Appendix 1).

103

FRDC Project 2006/064 Chapter 5: Co-infection 5.4 Discussion The results of this study indicate that some Haplosporidium sp. infected pearl oysters were also infected with a Minchinia sp. recently identified in rock oysters from the same coastline (Hine & Thorne, 2002). The results of DNA-based diagnostic assays supported each other. The 144 bp PCR products obtained from the Willie Creek samples encompass a variable region of the Minchinia SSU rRNA gene yet it differs from the rock oyster parasite by only one base pair. The results of the same assay from the Carnarvon sample differed by only two base pairs. Positive PCRs were obtained using the SSF66/SSR69 primers which target two other variable SSU rDNA regions. The SSF66/SSR69 PCR assay produced negative results when tested with H. nelsoni and H. costale infected oyster DNA. When the sequence obtained from the SSF66/SSR69 regions is added to the 144 bp sequence obtained from the F1B/R2B reactions, the Willie Creek sample has a total of 364 bp of known sequence with only a single base pair different from the rock oyster parasite. The PCR produced consistent results with no indication of contamination. Attempts to target a larger region with the primers FSSUF and SSR69 failed. This is consistent with observations that formalin fixation makes amplification of regions larger than 200-500 bp difficult due to fragmentation of DNA and crosslinking of histones to DNA (Paabo, 1990). The genetic distances obtained from comparing the Minchinia sequences obtained from rock and pearl oyster samples were considerably less than the distance between known species for this region. In addition, the sequences obtained from the pearl oysters were not grouped together but were distributed between the rock oyster Minchinia sp. sequences.

The PCR results were further validated by in situ hybridisation with a 25 base oligonucleotide probe (SSRDb). The probe did not detect closely related haplosporidians: Haplosporidium costale, H. nelsoni or Minchinia teredinis but did produce a positive reaction from some of the haplosporidian parasites in Haplosporidium sp.-infected pearl oyster spat. Overall, three separate variable sections of the SSU region of the parasite’s rRNA gene were tested by two different molecular methods and found to be consistent with the Minchinia sp. detected in rock oysters.

It is possible that the two haplosporidian species detected in Haplosporidium sp. infected pearl oyster spat are actually the same species. Some evidence is provided for this hypothesis by the SSR69 probe reacting to all haplosporidian parasite cells in the infected pearl oysters. Inconsistences observed between the number of histologically positive and

104

FRDC Project 2006/064 Chapter 5: Co-infection PCR positive may be the result of fixation since the length of time samples are fixed is known to affect the efficiency of molecular assays (Diggles et al., 2003). However, this hypothesis appears unlikely. The SSRDb ISH assay did not hybridise to all haplosporidian cells present in the infected sections. In addition, Hine and Thorne (2002) compared the rock and pearl oyster parasites using TEM and noted a number of morphological differences. These differences are summarised in Table 5.3 and also make it unlikely that the two parasites are actually the same species. The most likely explanation for the positive PCR results and partial positives from in-situ hybridisation with the SSRDb probe is Minchinia sp. earlier detected in rock oysters is present in the Haplosporidium sp. infected pearl oyster spat. This would mean the SSR69 probe cross reacts to the Haplosporidium sp. in pearl oysters despite not reacting to any other haplosporidian species tested. An SEM and TEM comparison of the pearl oyster and rock oyster parasite’s spores is required for a conclusive comparison of spore ornamentation. This would also allow a taxonomic assessment of each parasite to determine if it belongs in Haplosporidium or Minchinia.

There has been a considerable amount of debate about the characters that separate the genera Haplosporidium and Bonamia from Minchinia. Haplosporidium spp. (and Bonamia spp. in which spores have been detected i.e. Bonamia perspora (Carnegie et al., 2006) are now largely defined as species whose spores possess tails or filaments attached to the spore wall, which are formed by the same material as the spore wall (Azevedo, 2001; Azevedo et al., 2006; Azevedo et al., 2003; Burreson, 2001; Hine & Thorne, 1998). On the other hand, the genus Minchinia is described as without tails (Azevedo, 2001) or possessing epispore cytoplasmic extensions (Azevedo et al., 2006; Azevedo et al., 2003; Burreson, 2001; Hine & Thorne, 1998) that disappear during the maturation process (Azevedo et al., 2006; Azevedo et al., 2003; Azevedo et al., 1999). Currently, phylogenetic analysis supports the morphological characters used to define Minchinia with the genus being monophyletic with a bootstrap support of 58% (Chapter 3). Based on the comparison of the SSU rRNA sequences obtained in this study with the SSU rRNA gene obtained from the putative Minchinia sp. in rock oysters one would expect the spores of this parasite to be without spore wall tails or possessing epispore cytoplasmic extensions (ECEs) which may disappear during the maturation process. Since Haplosporidium sp. has filaments composed of spore wall material, the most likely explanation for the positive PCR results and partial positives from in-situ hybridisation is the Minchinia species earlier detected in rock oysters, is present in the Haplosporidium sp. infected pearl oyster spat. An SEM analysis of the rock

105

FRDC Project 2006/064 Chapter 5: Co-infection oyster parasite’s spores is required for a conclusive comparison of spore ornamentation between the two species.

The presence of co-infections of haplosporidian parasites is not unprecedented. Co- infections of Haplosporidium nelsoni and Haplosporidium costale have been previously observed in Crassostrea virginica on the eastern sea board of the United States (Stokes & Burreson, 2001). Both Haplosporidium sp. and Minchinia sp. parasites appear to be opportunistically parasitising weakened pearl oyster spat. Both parasites have only been detected in juvenile pearl oysters less than 12 mm in size. It appears likely that as the pearl oyster increases beyond this size it may be able to respond effectively to the parasites. Another haplosporidian parasite has been documented infecting pearl oysters in a similar fashion as the Minchinia sp. and Haplosporidium sp. There have been sporadic reports of Bonamia roughleyi like infections of pearl oysters (Humphrey et al., 1998; SCFH, 1993). In the mid 1990s a Bonamia roughleyi like organism was found infecting pearl oyster spat in Carnarvon, Western Australia (Norris, 1996).

The uni-nucleated naked cells identified as the origin of the Minchinia sequence in Chapter 3 appear similar to a Bonamia species. The Minchinia are a sister taxon to the Bonamia and consequently the possible dominance of a uni-nucleated cell stage in the Minchinia sp. infected rock oysters described in Chapter 3 may be a result of an evolutionary relationship between these two genera. Also, there appears to be little information in the literature on the non-spore life stages of most Minchinia species; rather most authors report only spore morphology (Azevedo, 2001; Ball, 1980; McGovern & Burreson, 1990). If the cryptic uni- nucleated stages detected in Chapter 3 are a dominant part of the life-cycle of the Minchinia then this may explain this lack of information. In addition, it is possible the previously described Bonamia infections in pearl oyster spat are actually Minchinia sp. infections. Bonamia infected pearl oyster spat are required for further analysis.

Mass mortalities of juvenile pearl oysters are well recognised (Humphrey et al., 1998). It is possible that pearl oysters below certain sizes are susceptible to infection by parasites that would otherwise be considered too host specific to be a threat. Indeed, there is a range of potentially serious pathogens in wild bivalves that juvenile pearl oysters are exposed to upon deployment (Hine & Thorne, 2000). Sequential examination of batches of juvenile oysters up to 23 weeks from deployment in the Northern Territory of Australia demonstrated progressive colonisation by a range of unidentified protozoan and metazoan 106

FRDC Project 2006/064 Chapter 5: Co-infection organisms (Humphrey et al., 1998). This may explain some of the mortalities experienced by the pearling industry on deployment of spat to grow-out leases.

Attempts to amplify Haplosporidium sp. DNA using a variety of degenerate primers have so far been unsuccessful. The primers used included all combinations of the HAP primers (Renault et al., 2000), protozoan (Carnegie et al., 2003) and others of novel design (unpublished observations;Appendix 2) so as to target smaller DNA from formalin fixed tissues. Specificity was lowered in some of these reactions but no Haplosporidium sp. amplifications could be obtained. It is likely problems with poor fixation combined with non-specific and degenerate primers prevented amplification. The F1B/R2B and SSF66/SSR69 primers were specifically designed to target Minchinia sp. DNA and perhaps for this reason were successful. Further research into the molecular characterisation of Haplosporidium sp. will require either frozen or ethanol stored samples. These samples should be obtained the next time the parasite is detected using the replicate sampling method outlined in Chapter 2.

The molecular evidence provided in this chapter gave some evidence to suggest the Minchinia sp. detected in rock oyster is the same species as the Haplosporidium sp. infecting pearl oysters. The primary evidence for his hypothesis is the SSR69 probe reacting to all haplosporidian parasites in the infected pearl oyster spat. Also, all attempts to obtain a Haplosporidium sp. sequence from the infected pearl oysters were unsuccessful. Only Minchinia sp. sequences were amplified. However, there is also evidence to suggest positive PCRs are the result of a co-infection. The principle evidence for this hypothesis is the selective hybridisations obtained from the ISH assays using the SSRDb probe and the morphological differences between the two parasites highlighted by Hine and Thorne (2002) in a TEM analysis of the rock oyster parasites spores. Since attempts to obtain sequence data from the Haplosporidium sp. were unsuccessful, further analysis of the morphological characteristics of the rock and pearl oyster parasite spores are required to conclusively resolve this conflict.

107

FRDC Project 2006/064 Chapter 5: Co-infection Table 5.3 Summary of the major differences in the spores of the pearl oyster parasite and the rock oyster parasite.

Pearl oyster parasite (Hine and Thorne Rock oyster parasite (Hine and Thorne 1998) 2002) Elongated to ovoid 6.7 – 7.7 x 3.8-4.3 5.6 – 6.7 x 3.3 – 4.0 Wall 160 nm Wall 250 nm Surface filaments 62 nm Not seen Sporoplasm nucleus usually basal but Nucleus equatorial sometimes equatorial Haplosporosomes 230 nm Haplosporosomes 50-67 x 330nm Sometimes elongated to 410 nm Ovoid to spherical 100 – 150 nm Or small spherical and dense 60-70nm Not seen Rod like structures developed posteriorly in maturing spores Not seen Lipid droplets

108

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei Chapter 6 : Spore ornamentation of Haplosporidium hinei n.sp. in pearl oysters Pinctada maxima.

This chapter formally describes and names one of the haplosporidian parasites detected in the infected pearl oysters. The spore ornamentation of the parasite is compared to other haplosporidian parasites including those notiafiable under OIE guidelines. These results were also compared to the results of the molecular assays used in Chapters 4 and 5.

109

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei 6.1 Introduction The morphology and origin of spore ornamentation, variously termed wrappings, extensions, filaments or tails, is the principle taxonomic feature used to distinguish species and genera within phylum Haplosporidia. However, the spore ornamentation is not known for many haplosporidian species and this makes species differentiation and genus assignment difficult (Burreson & Reece, 2006). It is likely that the taxonomy of the Haplosporidia will remain confused until spore ornamentation is characterised for a large number of species.

Currently, the most common method to separate the genera Haplosporidium and Bonamia from the Minchinia is based on the origin of the spore ornamentation, from either the spore wall in the case of Haplosporidium and Bonamia, or from the epispore cytoplasm in the Minchinia (Azevedo et al., 1999; Burreson, 2001; Hine & Thorne, 1998; Hine & Thorne, 2002; Ormieres, 1980). The spore ornamentation from only one species of the Bonamia has been characterised. That species Bonamia perspora, has been found to possess strap like projections derived from the spore wall (Carnegie et al., 2006). The emphasis on spore ornamentation in the taxonomy of the Haplosporidia means it is an important characteristic to be described.

The objective of this chapter is to formally describe the spore ornamentation of the haplosporidian in pearl oysters using both scanning and transmission electron microscopy and compare the results to other described haplosporidians and to the molecular data obtained in the previous chapters. The pearl oyster parasite is named in this chapter as Haplosporidium hinei n. sp.

110

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei

6.2 Methods and materials Archived formalin fixed, paraffin embedded pearl oyster tissues infected with Haplosporidium hinei n. sp. were obtained from the Western Australian Department of Fisheries and were fixed whole in 10% formalin made up with seawater. This material had been collected from Carnarvon, Western Australia as part of a routine disease clearance prior to transport (Hine & Thorne, 1998). Material specifically fixed for electron microscopy was not available. Sections were processed and stained for histological examination with hematoxylin and eosin. Briefly, unstained sections were cut 4 μm thick and placed on slides. Sections were dewaxed with xylene and rehydrated in an ethanol series (2 changes for 2 min each). The sections were placed in haematoxylin for 5 min, rinsed in water and then placed in Scott’s tap water substitute until blue. The slides were again rinsed in water followed by 95% ethanol (1 change for 30 s). The sections were stained with 1% eosin for 30 seconds and finally dehydrated in 95% ethanol (2 changes 30 s each), absolute ethanol (2 changes 30 s each) and xylene ( 3 changes 30 s each). Ornamentation on the spores of H. hinei n. sp. was assessed through light microscopy, transmission electron microscopy (TEM) and scanning electron microscopy (SEM).

Paraffin embedded tissue was prepared for TEM by dewaxing in xylene overnight, hydrating through three changes of 100, 90 and 70% ethanol. A 1 mm3 cube of digestive gland tissue was dissected in a puddle of 5% Sorensen’s phosphate buffered gluteraldehyde. The sections were then placed in 5% glutaraldehyde overnight. The samples were then washed in 0.07 M Sorensen’s phosphate buffer. The tissues were immersed in Dalton’s Chrome Osmic Acid for 60-90 mins at 4° C. The samples were then dehydrated through an ethanol series. Following this, the tissue was immersed in Propylene Oxide, a 60: 40 Propylene oxide/Epon mixture and finally pure ‘Epon’ overnight. Embedded tissues were sectioned with an mU3/C (Reichert, Austria) ultramicrotome and stained with uranyl acetate. Analysis was performed with a Philips CM100 Bio TEM.

For SEM, infected oyster tissue was removed from the paraffin block and deparaffinised in xylene for three days. The tissue was rehydrated through a graded series of ethanol (100%, 90%, 70%, 50% and 30%). The tissue was then sonicated in pure water. A puddle of the resulting suspension was placed onto six 12 mm diameter coverglasses coated with poly-L- lysine; spores were allowed to settle for 1 h in a moist chamber. The coverglasses were then dipped in water to remove the excess material and dehydrated through an ethanol

111

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei series. The affixed spores were then subjected to critical point drying in liquid CO2 and coating with gold:palladium. Characterisation of the spore ornamentation was based on observations of 26 spores with a Zeiss Leo 435vp.

112

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei

6.3 Results

6.3.1 Light microscopy

Light microscopy of the sections revealed large numbers of presporulation and sporulation stages of the parasite in the connective tissue surrounding the digestive gland and within the digestive diverticulae (Figure 6.1). Mature spores with a yellow refractile wall enclosing an eosinophilic sporoplasm were observed. Spore ornamentation was not apparent with light microscopy and parasites were not observed in the epithelia.

6.3.2 Electron microscopy Although the fixative used for the study was suboptimal for electron microscopy, it was sufficient to permit observation of the spore wall and its ornamentation. The fixed spores of H. hinei n. sp. were pleomorphic, or elongated 3.5 μm – 4 μm x 2.5 μm – 3.0 μm in size (Figure 6.2). The sporoplasm nucleus was usually basal, but sometimes equatorial and measured 0.8 μm – 1.3 μm in diameter (mean= 1.03 μm). The operculum was situated in the apical zone of the wall and consisted of a circular lid of 1.9 μm to 2.6 μm (mean= 2.24 μm) diameter (Figure 6.2). The lid of the operculum was about 7.2 nm thick and was connected to the spore wall by a hinge. Microfilaments 45 nm – 75 nm (mean= 60.72 nm) long and 28.5 – 34.3 nm (mean= 31.25 nm) wide were also observed on the surface of the spore wall (Figure 6.2). The microfilaments were composed of spore wall material and had focal distribution but were not confined to any particular section of spore wall. They were observed in both immature and mature spore stages.

Round or elongated haplosporosomes were present that varied in diameter from 90 nm to 500 nm (mean= 256 nm; Figure 6.2). Many of the haplosporosomes contained an internal membrane that was either circular or shaped as an axe head (Fig 6.2). In the apical zone of the endosporoplasm, a spherule was formed by several vesicles approximately 0.1 μm in diameter (Figure 6.2). Bundles of microfilaments were also occasionally observed in the spore endosporoplasm (data not shown).

Obvious by both TEM and SEM were two filaments that were wound around the spore which appeared to originate from two posterior spore wall thickenings that resembled “knobs” (Figures 6.2 & 6.3). The thickenings seemed to appear late in the development of the spore and were approximately 700 nm long. Both filaments passed up one side of the 113

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei spore together until just below the operculum where upon the filaments split and passed obliquely under each side of the lip of the opercula lid (Figure 6.3). There was one filament on each side of the spore (Figure 6.3). Both filaments wrapped around the spore four or five times and decreased in diameter toward the distal end (Figure 6.2). The number and arrangement of the filaments was confirmed by TEM. Each filament was approximately 27 µm in length. The filaments were derived from the spore wall and were not projections of the epispore cytoplasm. A second set of branching tubular filaments composed of a different material was observed on the spore body although not on mature spores possessing a “knob-like” posterior thickening (Figure 6.2)

114

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei

Figure 6.1 Pearl oyster digestive gland containing large numbers of the presporulation and sporulation stages of Haplosporidium hinei n. sp. (A) Low magnification view of the digestive gland. Scale bar = 30 μm. (B) Higher magnification view of the same section including the mature spores. Arrow indicates the yellow refractile mature spores. Scale bar = 15 μm.

115

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei

Figure 6.2 Transmission electron micrographs (TEM) of mature spores of Haplosporidium hinei n.sp. infecting the pearl oyster Pinctada maxima. Haplosporosomes (hap) with internal membranes are also present in each photograph. n refers to the basal nucleus, w refers to spore wall, sp refers to the spherule, op refers to the operculum. (A) Indicates the tubular filaments (tf). Tubular filaments are not present in mature spores possessing a posterior thickening (see 2-3 below). Scale bar = 1.5 µm. (B) Shows the posterior thickening and attached spore wall filaments (f) in cross section. Scale bar = 1.5 μm. (C) Indicates the spore wall filaments (f) and posterior knob in longitudinal section. Scale bar = 1.5 µm. (D) A higher magnification view of the microfilaments (arrow). Scale bar = 240 nm. (E) A higher magnification view of the haplosporosomes containing the axe shaped internal membrane structures. Scale bar = 200 nm.

116

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei

Figure 6.3 Scanning electron micrographs indicating the spore ornamentation of Haplosporidium hinei n. sp. infecting Pinctada maxima in supposed order of development. (1) Spore showing a filament (f) wrapping each side of the spore to the operculum (op). Scale bar = 1.5 μm (2). Spore showing the tubular filaments (tf) and spore wall filaments (f). Scale bar = 1.5 μm. (3) Spore showing the origin of the filaments (f) at the posterior knob-like thickening (large arrow). Scale bar = 1.5 μm. (4) Higher magnification view of the basal section of the spore with the posterior knob-like thickening (large arrow). Scale bar = 0.8 μm.

117

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei

6.3.3 Taxonomic summary Haplosporidium hinei Bearham, Spiers, Raidal, Jones, Burreson and Nicholls n. sp.

Description and identifying characteristics Two spore wall derived filaments that are wound around the spore and originate from a posterior spore wall thickening. Both filaments pass up one side of the spore together until just below the operculum where upon the filaments split and pass obliquely under each side of the lip of the opercula lid. There is one filament on each side of the spore. Both filaments are wrapped around the spore four or five times and decrease in diameter toward the distal end. Each filament is approximately 27 µm in length.

Type Host Pinctada maxima (Mollusca, Bivalva, Pteriidae).

Site of infection Digestive gland epithelium, gills and mantle.

Type locality Carnarvon (latitude: 24° 53' S, longitude: 113° 40' E), Western Australia.

Material deposited: H&E slides at the Western Australian Museum.

Etymology The epithet refers to Dr Mike Hine who has contributed a significant amount to our understanding of the haplosporidians and who originally described this parasite.

118

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei

6.4 Discussion The parasite described in this study shows the typical morphology, spore structure and spore ornamentation of a haplosporidian species. The internal organisation of the spore endosporoplasm shows a similar arrangement to other haplosporidian species. This was characterised by the presence of a basal or equatorial nucleus, an apical spherule and several electron dense membrane bound haplosporosomes. The presence of an orifice which is covered with an operculum suggests the parasite belongs to either Minchinia, Haplosporidium or Bonamia.

If the criteria proposed by Ormieres (1980) for distinguishing the genera Haplosporidium and Minchinia are followed then Haplosporidium hinei n.sp was correctly assigned to Haplosporidium by Hine and Thorne (1998) because the filaments are derived from the spore wall and not from epispore cytoplasm. The similarity of H .hinei to H. lusitanicum, H. pickfordi, H. montiforti, H. parisi and H. comatulae in the origin of the ornamentation from the basal position on the spore justifies its placement within Haplosporidium. The alternative genus with ornamentation originating from the spore wall is Bonamia. The sole member of the Bonamia that has been found to possess spores, Bonamia perspora has strap like projections which do not originate from a basal position on the spore (Carnegie et al., 2006).

When compared to Hine and Thorne (1998), the fixed spores in the current study, at 3.5 μm – 4 μm x 2.5 μm – 3.0 μm (Figure 6.2) are smaller than those described previously and Hine and Thorne (1998) also did not observe posterior knobs or surface filaments in their TEM study. Otherwise, the microfilaments and haplosporosomes observed here are consistent with those described previously.

The ornamentation on the spores of the pearl oyster parasite described by the number of filaments, their length, insertion points on the wall and organisation of the filaments is unique among described haplosporidian species where spore ornamentation is known. Haplosporidium armoricanum from Ostrea edulis in Europe has paired filaments arising from each end of the spore (Azevedo et al., 1999). Haplosporidium nelsoni and H. costale from Crassostrea virginica along the east coast of the United States do not have paired filaments arising from the posterior end of the spore; rather they have wrappings around the

119

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei spore (Burreson & Reece, 2006). Haplosporidium edule from cockles in Europe has many knobbed extensions of the spore wall, not long filaments (Azevedo et al., 2003).

The basal origin of the filaments described in this study is similar to that of the spores occurring in the gastropod haplosporidians of Haplosporidium montforti, H. pickfordi and H. lusitanicum. These species have long, spore wall derived filaments that originate at the basal end of the spore. However, these parasites lacked the distinctive axe shaped internal membranes observed within the haplosporosomes of the pearl oyster parasite. In addition, Haplosporidium montforti described infecting the abalone Haliotis tuberculata in Spain, has four filaments, 20-28 μm long, with two attached opposite each other at the basal end and two other opposing filaments attached at the apical end of the spore (Azevedo et al., 2006). Also, the filaments of the pearl oyster parasite are round in transverse section rather than the L,T or X-like sections of H. montfordi (Azevedo et al., 2006). Haplosporidium pickfordi from fresh water snails in the great lakes region of the United States, has two posterior knob-like thickenings like the pearl oyster parasite but has approximately nine filaments wound around the spore rather than the two filaments observed here (Burreson, 2001). While H. lusitanicum described from the European gastropod Helcion pellucidus, has two basal opposing filaments ~112 μm long, and coiled around the spore 10-13 times which are elliptical in transverse section (Azevedo, 1984).

The basal origin, arrangement of the spore wall filaments and the surface microfilaments is most reminiscent of Haplosporidium parisi among known species. In H. parisi filaments are also wound around the spore and pass obliquely under the operculum. The filaments in H. parisi are also circular in transverse section (unlike H. lusitanicum). Ormieres (1980) also described the presence of small bumps on the spore wall of H. parisi which appear to be similar to the microfilaments described in this study except the “bumps” in H. hinei are closer together and are more focally distributed compared to H. parisi (Figure 6.2). Haplosporidium hinei n. sp. differs from H. parisi in the length of filaments and the presence of branching tubular filaments on the surface of the spores (Ormieres, 1980). Filaments in H. parisi were up to 300 μm long and were wrapped around the spore approximately 18 times while in the pearl oyster parasite the filaments were wrapped around the spore only four or five times and are considerably shorter at approximately 27 µm.

120

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei A similar situation occurs with Haplosporidium comatulae an endoparasite of the crinoid echinoderm Oligometra serripinna in north eastern Australia which also possesses spore wall filaments with a similar arrangement to H. parisi and H. hinei. Filaments in H. comatulae are round in cross section but may be longer than H. parisi since they wrap the spore approximately 32 times (La Haye et al., 1984). La Haye et al (1984) did not observe any internal structures within the haplosporosomes of H. comatulae or microfilaments on the spore wall.

The definition of Haplosporidium has been confounded by a lack of knowledge of the spore ornamentation of the type species Haplosporidium scolopli Caullery and Mesnil. Like H. scolopli, H. parisi is a parasite of serpulid polychaetes of the French Atlantic coast. Ormieres (1980) concluded H. parisi to be very close to H. scolopli and consequently, the pearl oyster parasite may also be morphologically similar to H. scolopli.

Speculatively, the function of the spore wall filaments may be to aid in floatation. The filaments may be extended once the spore is released to the environment. Characterisation of spore ornamentation requires both TEM and SEM examination. This has not been achieved for many haplosporidian species and it will probably require DNA sequence analyses of a large number of species in the phylum to elucidate the relationships among the different morphological types. Further study is required to clarify the relationship between the parasite described here and the haplosporidian species infecting rock oysters on the same coast. The rock oyster parasite described by Hine and Thorne (2002) also possessed a posterior thickening with filaments attached in < 2% of spores.

Chapter 5 provided evidence that the pearl oyster and rock oyster parasite were the same species and Chapter 3 suggested the parasite was a Minchinia species. The results obtained in this chapter clearly show the pearl oyster parasite is a Haplosporidium spp. It is possible the SSR69 probe developed in this study might cross-react to the Haplosporidium hinei n. sp despite assessment of its specificity against six closely related haplosporidians in Chapter 2. It is impossible to rule out a cross reaction with an as yet undescribed parasite. An alternative explanation is the presence of a Minchinia spp. with Haplosporidium spore morphology. This would suggest Minchinia is paraphyletic. To date only three Minchinia spp. have been described both morphologically and by sequence analysis. Indeed, it appears the Bonamia which group with the Minchinia in phylogenetic analyses (Figure 3.5) possess a Haplosporidium spore morphology with the presence of spore wall ornamentation 121

FRDC Project 2006/064 Chapter 6: Haplosporidium hinei in the spores of Bonamia perspora (Carnegie et al., 2006). Both the rock oyster and pearl oyster parasites were originally described as Haplosporidium species. In addition, the rock oyster parasite described by Hine and Thorne (2002) also possessed a posterior thickening with filaments attached in < 2% of spores. An SEM and TEM analysis of the spores of the rock oyster parasite is required so that its ornamentation can be compared to the spores of Haplosporidium hinei n. sp. described here.

122

FRDC Project 2006/064 Chapter 7: Minchinia occulta Chapter 7 : Spore ornamentation of Minchinia occulta n. sp. in rock oysters Saccostrea cuccullata (Born, 1778).

This chapter formally describes and names the other haplosporidian parasite detected in both pearl oysters and rock oysters. It confirms both parasites are separate species and therefore allows better interpretation of the results obtained from the molecular assays developed in previous chapters.

123 FRDC Project 2006/064 Chapter 7: Minchinia occulta 7.1 Introduction

Mortalities (up to 80%) among rock oysters Saccostrea cuccullata were first recognised by energy companies operating on the North West Gas Shelf of Western Australia in the early 1990s (Hine & Thorne, 2002). The companies submitted samples for diagnosis and a Minchinia species (Haplosporidia: Haplosporidiidae) parasitising rock oysters was subsequently morphologically described by Hine and Thorne (2002) using light and transmission electron microscopy.

The parasite was not able to be diagnosed following the development of a specific probe for Haplosporidium nelsoni despite several attempts (Hine & Thorne, 2002). However, a section of the organism’s rRNA gene was sequenced and an in situ hybridisation assay was developed in Chapter 3. The parasite fell within the Minchinia in a phylogenetic analysis of the parasite’s SSU rRNA gene and is a sister taxon to a clade composed of M. chitonis, M. teredinis and Minchinia sp.

The primary taxonomic feature used to differentiate species and genera within Haplosporidia is the morphology and origin of spore ornamentation, usually described as filaments, tails, wrappings or extensions. Currently, the species within the genera Haplosporidium and Bonamia are separated from those of Minchinia on the basis of the origin of the spore ornamentation. For the members of Haplosporidium and Bonamia in which spores have been detected (i.e Bonamia perspora), ornamentation originates from the spore wall while in species of Minchinia it originates from the epispore cytoplasm (Azevedo et al., 1999; Burreson, 2001; Carnegie et al., 2006; Hine & Thorne, 1998; Ormieres, 1980). Thus, for new species descriptions it is important to describe the spore ornamentation.

This study has provided some molecular evidence suggesting the pearl oyster and rock oyster haplosporidians may be the same species. However, the selective hybridisations observed in the SSRDb ISH assay suggest the pearl oysters are infected with two parasite species. This explanation also explains the positive PCR results and appartent morphological differences between the spores of the rock and pearl oyster parasites.

The spores of both parasites as described by Hine and Thorne (1998) and Hine and Thorne (2002) do share some similarities. Both species were originally described as Haplosporidium spp (Hine & Thorne, 1998; Hine & Thorne, 2002) and Hine and Thorne

124 FRDC Project 2006/064 Chapter 7: Minchinia occulta (2002) Figure 14 indicates the rock oyster parasite has a posterior thickening with associated filaments. In the previous chapter, an analysis of the spore morphology of the pearl oyster parasite was undertaken and indicated a Haplosporidium species with a posterior thickening with two associated filaments.

This aim of this chapter is to describe the spore ornamentation of the haplosporidian parasite of rock oysters (Saccostrea cuccullata) using both scanning and transmission electron microscopy to assess whether the parasite possesses any of the characteristics of a Minchinia parasite and to compare it to Haplosporidium hinei.

125 FRDC Project 2006/064 Chapter 7: Minchinia occulta

7.2 Materials and Methods

Archived formalin fixed, paraffin embedded rock oyster tissues infected with Minchinia occulta n. sp. were obtained from the Western Australian Department of Fisheries. All of the material was collected from the same sample of infected oysters from Varanus Island on the north coast of Western Australia (co-ordinates 20°39′3″ S 115°34′27″ E) and were fixed whole in 10% formalin made up with seawater. Material specifically fixed for electron microscopy was not available. Tissue sections were processed for histological examination and stained with haematoxylin and eosin using conventional techniques. The unstained sections were cut at a thickness of 4 μm and placed on slides. The sections were dewaxed in xylene and rehydrated in an ethanol series (2 changes for 2 min each). The slides were then placed in haematoxylin for 5 min, rinsed in water and then placed in Scott’s tap water substitute until blue. Each section was again rinsed in water followed by 95% ethanol (1 change for 30 sec). The sections were stained with 1% eosin for 30 sec and finally dehydrated in 95% ethanol (2 changes 30 sec each), absolute ethanol (2 changes 30 sec each) and xylene (3 changes 30 sec each). Ornamentation on the spores of M. occulta n. sp. was assessed through light microscopy, transmission electron microscopy (TEM) and scanning electron microscopy (SEM).

7.2.1 In-situ hybridisation In-situ hybridisation (ISH) was performed to confirm the identity of the parasite as the same species sequenced in Chapter 3. An oligonucleotide probe was used for this purpose. The assay was performed using the SSRDb probe using the methods outlined in Chapters 3 and 4. The presence and location of Minchinia occulta n.sp was confirmed using hematoxylin – eosin (H/E) stained serial sections (Figure 7.1).

7.2.2 Electron microscopy

Since material specifically fixed for electron microscopy was not available formalin fixed paraffin embedded samples observed as possessing spores in histological sections were processed for electron microscopy. These oysters were obtained from the same sample of oysters that underwent in-situ hybridisation. Rock oyster tissue samples containing M. occulta spores were removed from the paraffin block and prepared for TEM by dewaxing

126 FRDC Project 2006/064 Chapter 7: Minchinia occulta in xylene overnight. The tissue samples were then hydrated through 3 changes of 100, 90

and 70% ethanol. A 1 mm3 cube of digestive gland tissue was dissected in a puddle of 5%

Sorensen’s phosphate-buffered glutaraldehyde and stored in 5% glutaraldehyde overnight.

The samples were then washed in 0.07 M Sorensen’s phosphate buffer and immersed in

Dalton’s Chrome Osmic Acid for 60–90 minutes at 4°C. Following this, the samples were

then

dehydrated through an ethanol series and immersed in Propylene Oxide, a 60 : 40

Propylene oxide/Epon mixture. The samples were finally embedded in pure ‘Epon’

overnight. The tissues were sectioned with an mU3/C (Reichert, Austria) ultramicrotome

and stained with uranyl acetate. Analysis was performed with a Philips CM100 Bio TEM.

For SEM, infected oyster tissue was removed from the paraffin block and deparaffinised in

xylene for 3 days. The samples were rehydrated through a graded series of ethanol (100%,

90%, 70%, 50% and 30%) and then sonicated in pure water. A puddle of the resulting

suspension was placed onto six 12 mm diameter cover-glasses coated with poly- L-lysine.

M. occulta spores in the suspension were allowed to settle for 1 h in a moist chamber.

Following this, the cover-glasses were dipped in water to remove the excess material and

then dehydrated through an ethanol series. The affixed spores were subjected to critical-

point drying in liquid CO2 and coating with gold : palladium. Observations of the spore

ornamentation were made on a Zeiss Leo 435vp SEM. The measurements of 16 parasites

are given in micrometers with the range in parentheses.

7.3 Results

7.3.1 Light microscopy

Histopathological examination of 16 positive oysters from Varanus Island, Western Australia revealed large numbers of parasites present usually as focal lesions in the connective tissue of the gills or disseminated around the connective tissue between the digestive diverticulae in the digestive gland, and in the mantle (Figure 7.1 and 7.2).

127 FRDC Project 2006/064 Chapter 7: Minchinia occulta Parasites were also observed between the epithelial cells of the gut but not in the epithelium of the digestive diverticulae. Large numbers of parasites were also present in the reproductive follicles of the host of some samples (Figure 7.1). All parasite stages including uni-nucleate and bi-nucleate naked cells were extra cellular. Uni-nucleate cells were 4.5 to 5.8 μm (mean = 5 μm) in diameter with a generally central nucleus. Multi- nucleate plasmodia with between 2 to 24 nuclei were also present in infected oysters. Sporulation was confined to the connective tissue between the digestive diverticulae in the digestive gland. Mature spores with a yellow refractile wall enclosing an eosinophilic sporoplasm were also observed (Figure 7.2). Spore ornamentation was not apparent with light microscopy and parasites were not observed in the epithelium of the digestive diverticulae. Phagocytosis of parasites was not observed.

7.3.2 In-situ Hybridisation

Parasite identity was confirmed using in-situ hybridisation. The SSRDb probe produced strong hybridisation signals with little background staining (Figure 7.1). The signal was not reproduced in tissues produced from uninfected oysters or in negative control material (Figure 7.1). Sections of Minchinia teredinis, Haplosporidium nelsoni and H. costale included in the assay did not produce a positive signal (Figure 7.3).

128 FRDC Project 2006/064 Chapter 7: Minchinia occulta

Figure 7.1 Rock oyster connective tissue and reproductive tissue containing single, bi and tri nucleate haplosporidian parasites. (A) Haematoxylin-eosin stained section containing the parasites (arrows). (B) Serial section containing the parasites in an in-situ hybridisation. Parasites are identified by a darker colouration. Examples are indicated with an arrow. (C) Negative control serial section from the same hybridisation. (D) Haematoxylin-eosin stained section containing the parasites in reproductive tissue of the host. Scale bars= 15 μm. All samples were taken from the same batch of infected oysters.

The fixative used for the samples was suboptimal for electron microscopy, nonetheless, it was adequate to permit observation of the spore wall and its ornamentation.

129 FRDC Project 2006/064 Chapter 7: Minchinia occulta

Figure 7.2 Rock oyster digestive gland containing large numbers of the presporulation and sporulation stages of Minchinia occulta n. sp. in a hematoxylin-eosin stained section. Arrow indicates an example of the refractile mature spores. Scale bar = 20 μm.

130 FRDC Project 2006/064 Chapter 7: Minchinia occulta

Figure 7.3 Haplosporidian parasites used to assess the specificity of the SSRDb ISH assay. Example parasites are indicated with an arrow. (A) Minchinia teredinis in the gills of the shipworm Teredo sp. Scale Bar = 10 μm. (B) Haplosporidium costale in an Eastern Oyster. Scale Bar= 30 μm (C) Haplosporidium nelsoni in an Eastern Oyster. Scale bar= 20 μm. Sections are counterstained in a brazilin haematoxylin.

131 FRDC Project 2006/064 Chapter 7: Minchinia occulta

Figure 7.4 Scanning electron micrographs indicating the spore ornamentation of Minchinia occulta n. sp. infecting Saccostrea cuccullata. (A) Minchinia occulta spore with a branching network of microtubules-like structures and opercula lid (op). Scale bar = 1.5 μm (B) Spore with a ridge running along the front of the spore (arrow). Scale bar = 2.5 μm (C) Spore with network of branching microtubule–like structures that has been partially removed or degenerated revealing a smooth spore wall (sw) beneath. Some artifact also appears on the spore wall. Scale bar = 3.0 μm. (D) Higher magnification view of the degraded microtubule like structures with exposed spore wall beneath. Scale bar = 1 μm.

132 FRDC Project 2006/064 Chapter 7: Minchinia occulta

Figure 7.5 Transmission electron micrographs (TEM) of spores from Minchinia occulta n. sp. infecting the rock oyster (Saccostrea cuccullata). (A) Group of spores at a variety of different spore stages none of which possess any spore wall material. Scale bar = 2 μm. (B-D) Minchinia occulta spores with operculum (Op), haplosporosomes containing a membrane bound body (H), Microtubular-like structures (TS) and Spore wall (SW) and spherule (Sp). Scale bars = 1 μm. (E) Higher magnification view of the membrane bound body within the haplosporosomes (H), the spore wall (SW) and the Microtubular-like structures (TS). Scale bar = 500 nm.

133 FRDC Project 2006/064 Chapter 7: Minchinia occulta 7.3.3 Electron microscopy

The fixative used for the samples was suboptimal for electron microscopy; nonetheless, it was adequate to permit some observation of the spore wall and its ornamentation. The spores of the rock oyster parasite appeared to have a network of branching microtubule-like structures (Figure 7.4) covering the entire spore including the opercula lid. The microtubule-like structures varied in size but were approximately 15-30 nm (mean = 20 nm) in diameter (Figure 7.4). In some of the spores this network appeared to degrade as the spore aged revealing a smooth spore wall (Figure 7.4). A ridge was also present on one side of the spore. It began just below the operculum and ended approximately 2 μm from the aboral end of the spore (Figure7.4). The ridge did not consist of spore wall material but appeared to be composed of the same material as the microtubule-like structures. Indeed, no spore wall derived ornamentation was observed on any spores.

The fixed spores of M. occulta n. sp were elongated 4.5 – 5.0 x 3.5 – 4.1 μm in size (Figure 7.4 and 7.5). The spore wall appeared to be 225 nm in thickness and consisted of 3 layers; an inner dense layer of approximately 90 nm, a middle layer of 30 nm and an outer dense layer of 130 nm (Figure 7.5). The sporoplasm nucleus was positioned equatorially and usually round in shape and measured 1.5 – 2.3 μm in diameter (mean = 1.9 μm). The operculum was situated in the apical zone of the wall and consisted of a circular lid of 2.5 – 3.0 μm (mean = 2.8 μm) diameter (Figure 7.5). The lid of the operculum was about 150 nm thick and was connected to the spore wall by a hinge (Figure 7.5).

Round electron dense haplosporosomes were present that were 150 nm - 180 nm (mean = 160 nm) in diameter. A membrane bound body was also often observed within the haplosporosomes (Figure 7.5E). In the apical zone of the endosporoplasm a spherule approximately 700 nm in diameter was formed by several vesicles (Figure 7.5). Dense vesicles (DVs) (Diameter = 159 nm to 228 nm (mean = 200 nm)) were numerous throughout the episporoplasm (Figure 7.5). Bundles of microfilaments were also occasionally observed in the episporoplasm as were lipid droplets. A lipid body was often observed adjacent to the middle of the spore (Figure 7.5). No spore wall ornamentation or any attached cytoskeletal structures were observed on any spore maturation stages including mature spores (Figure 7.5).

134 FRDC Project 2006/064 Chapter 7: Minchinia occulta 7.3.4 Taxonomic summary. Minchinia occulta Bearham, Spiers, Raidal, Jones, Nicholls n. sp.

Description and identifying characteristics

All parasite stages including uni-nucleate and bi-nucleate nakes cells are extra cellular with

uni-nucleate cells approximately 4.5 to 5.8 μm in diameter with a central nucleus. Multi-

nucleate plasmodia, possibly associated with sporogenesis, may also be present with

between 2 to 24 nuclei. Spore ornamentation consisting of a network of branching

microtubule-like structures covering the entire spore including the opercula lid. A ridge is also present on one side of the spore beginning just below the operculum and ending

approximately 2 μm from the aboral end of the spore (Fig 3). The sporoplasm nucleus is

positioned equatorially and is usually round.

Type Host

Saccostrea cuccullata Born, 1778 (Mollusca, Bivalva, Ostreidae).

Sites of infection

Minchinia occulta was observed as focal infections in the connective tissue of the gills and

as disseminated infections in the mantle, reproductive follicles, and around the digestive

diverticulae. Minchinia occulta was also observed in the epithelial cells of the gut but not

in the epithelium of the digestive diverticulae with sporulation confined to the connective

tissue of the digestive gland.

Type locality

Varanus Island (co-ordinates 20°39′3″ S 115°34′27″ E), Western Australia.

135 FRDC Project 2006/064 Chapter 7: Minchinia occulta Material deposited:

H&E slides in the Marine Invertebrate Zoology Type Collections, Department of Aquatic

Zoology, Western Australian Museum, registration number WAM Z27551.

Etymology

Occulta means hidden or concealed and refers to the cryptic nature of the parasite in some H&E sections.

136 FRDC Project 2006/064 Chapter 7: Minchinia occulta 7.4 Discussion

The parasite described in this study shows the usual spore morphology, structure and ornamentation of a haplosporidian species. The internal organisation of the spore endosporoplasm is similar to other haplosporidian species. This was characterised by the presence of an equatorial nucleus, several electron dense membrane bound haplosporosomes and an apical spherule. The existence of an orifice that was covered with an operculum indicates the parasite belongs to Minchinia, Haplosporidium or Bonamia.

The parasite’s identity was confirmed as the same parasite species characterised in Bearham et al. (2007) with an in-situ hybridisation assay utilising an oligonucleotide ISH probe (SSRDb) on an oyster from the same sample the M. occulta n. sp spores were obtained. The ISH assay was designed to target the SSU rRNA gene of the Minchinia sp. characterised in Bearham et al. (2007). The assay did not react with any of the other haplosporidian parasites in the assay (Minchinia teredinis, H. costale and H. nelsoni). Individual parasites were also observed within the reproductive tissue of the host and were from the same host species and within the same range as the parasite described by Bearham et al. (2007).

The only previous mention of spore ornamentation in M. occulta n. sp was by Hine and Thorne (2002) in a TEM ultrastructural study of spores. Hine and Thorne (2002) noted the presence of surface microtubules present on the wall of mature spores. The spores observed in the current study, utilising both SEM and TEM, suggested these microtubules formed a covering of branching microtubules. The size and arrangement of the internal organisation of the spores observed here were consistent with those described previously by Hine and Thorne (2002).

The ornamentation on the spores of the rock oyster parasite was unique among described haplosporidian species. The spores of the rock oyster parasite did not have spore wall derived ornamentation and are therefore different from most described Haplosporidium species.

The branching network of microtubules on the spores of M. occulta resembles, at least superficially, the spore ornamentation of Haplosporidium nelsoni and H. costale in Crassostrea virginica (Burreson & Reece, 2006). These species have ornamentation consisting of a network of branching fibres. However, the composition of the

137 FRDC Project 2006/064 Chapter 7: Minchinia occulta ornamentation differs considerably from the parasite described here. Spore ornamentation in H. nelsoni consists of fibres that are derived from the epispore cytoplasm and are tubular but with considerable internal complexity (Burreson & Reece, 2006). In addition, the covering on H. nelsoni consists of individual ribbons tightly bound together that separate at the aboral end of the spore and do not cover the opercula lid unlike M. occulta n. sp (Burreson & Reece, 2006). The fibres from H. costale while derived from the epispore cytoplasm, are not tubular and have a fine braided structure unlike M. occulta (Burreson & Reece, 2006; Perkins, 1969). Ornamentation on spores of Haplosporidium louisiana consist of very thin filaments composed of spore wall material that wrap around the spore (Perkins, 1969). No spore wall derived ornamentation was observed on the spores of M. occulta n. sp.

Hine and Thorne (2002) suggested the microtubule-like structures derived from the episporoplasm in M. occulta appeared similar to microtubules in the epispore cytoplasmic vacuoles of Minchinia species in crabs (Hine & Thorne, 2002; Perkins, 1975) and similar structures may be seen aligned under the epispore plasma membrane in M. chitonis (Ball, 1980; Hine & Thorne, 2002). Bundles of similar microtubule-like structures also enter the ECE of M. teredinis (Hine & Thorne, 2002; McGovern & Burreson, 1990). Comps and Tige (1997) also reported conspicuous microtubule-like fibrils of 20 nm in diameter in the cytoplasmic tails of Minchinia sp. infecting the mussel Mytilus galloprovincialis on the Mediterranean coast of France. The microtubule-like structures were also visible in the episporoplasm surrounding the spore wall similar to M. occulta n. sp. except the structures were focally distributed and were aligned (Comps & Tige, 1997). Similar unaligned microtubules have also been reported from Haplosporidium ascidiarum and H. ascidiarum also appears to lack spore wall filaments (Hine & Thorne, 2002; Ormieres & de Puytorac, 1968). Therefore, H. ascidiarum may also be a species of Minchinia.

However, M. occulta n. sp. differs from other Minchinia species since M. tapetis infecting Ruditapes decussatus in Europe has a single posterior epispore cytoplasmic extension (ECE; Azevedo, (2001)) while M. teredinis infecting shipworms (Teredo sp.) in the west Atlantic has four ECEs (McGovern & Burreson, 1990). Minchinia chitonis, infecting the chiton Lepidochitona cinereus has two opposing ECEs (Ball, 1980). While the ornamentation of each of these Minchinia species is composed of epispore cytoplasm, the parasite observed here differs from each of these parasites since it does not appear to possess an ECE(s). Instead, it is entirely covered in branching microtubule-like structures derived from the epispore cytoplasm and possesses a ridge on one side of the spore (Fig 4). 138 FRDC Project 2006/064 Chapter 7: Minchinia occulta The ridge appears to be composed of a similar material as the microtubules and therefore may be a similar ephemeral structure. No evidence of any epispore cytoplasmic extensions (ECEs) or tails were observed on spores of M. occulta n. sp. Because deparaffinised tissue was used for SEM, the presence of epispore cytoplasm-derived projections typical of other Minchinia species cannot be ruled out. Further analysis needs to be conducted with samples of infected oyster tissue specifically fixed for electron microscopy.

The results presented here suggest the rock oyster parasite should be assigned to Minchinia and not Haplosporidium or Bonamia. The parasite possesses microtubule-like structures similar to other Minchinia species and there was a lack of any spore wall derived ornamentation that would suggest the parasite should be assigned to Haplosporidium or Bonamia. This is consistent with the results described from Bearham et al. (2007) where parasite fell within the Minchinia clade in a phylogenetic analysis of the parasite’s SSU rRNA gene and is a sister taxon to a clade composed of M. chitonis, M. teredinis and Minchinia sp. of Cyrenoida floridana (Bearham et al., 2007).

Hine and Thorne (2002) described the development of M. occulta n. sp. including multinucleate and spore forming stages. However, it is possible multi-nucleate stages are relatively rare in the life cycle of M. occulta n. sp. At least four subsequent trips to the sites of the original infections failed to detect the parasite. It is possible M. occulta n. sp. was present at the sites but as a uni-nucleate stage not easily recognised in histology. The samples obtained by Hine and Thorne (2002) were unusual for the parasite since they were obtained when mortalities were occurring and because subsequent sampling trips failed to detect the parasite (when no mortalities were occurring). Carnegie et al. (2006) also described spore forming multi nucleate stages in Bonamia perspora. It may be the uni- nucleate stage of the life cycle becomes more dominant in species within the Haplosporidia as those species become more closely related to species of Bonamia.

The definition of Haplosporidium has been confounded by a lack of knowledge of the spore ornamentation of the type species H. scolopi Caullery and Mesnil 1899. Characterisation of spore ornamentation requires both TEM and SEM examination. This has not been achieved for many haplosporidian species and it will probably require DNA sequence analysis of a large number of species in the phylum to elucidate the relationships among the different morphological types. The TEM and SEM analysis presented here confirms the molecular characterisation in Chapter 3 of a Minchinia parasite infecting rock oysters (Saccostrea cuccullata) on the same coastline. 139 FRDC Project 2006/064 Chapter 7: Minchinia occulta

No spore wall derived ornamentation was observed on the spores from the rock oyster parasite unlike the posterior thickening and spore wall derived filaments observed on Haplosporidium hinei. Consequently, the results presented in this Chapter confirm the pearl oyster and rock oyster haplosporidians are separate species and therefore the SSR69 probe must cross react to the pearl oyster parasite. The SSR69 probe underwent an assessment of its specificity with six other described haplosporidian species however, it is impossible to rule a cross reaction with an undescribed parasite species such as the pearl oyster parasite. These results suggest there is some sequence similarity between the two haplosporidians at the SSU rRNA gene site targeted by the SSR69 probe. The sequences obtained from two other separate regions of the SSU rRNA gene and the results obtained from the SSRDb ISH assay (Chapter 5) combined with the comparison of spore ornamentation presented in Chapters 6 and 7 suggest at least some of the Haplosporidium hinei pearl oyster infections were co-infections with Minchinia occulta n sp.

The susceptibility of juvenile pearl oysters to infection suggests the immune competence of the host may be an important factor in preventing infection in pearl oysters and therefore preventing spat mortalities. Further research is required to document the susceptibility of juvenile pearl oysters to infection and to characterise the age or size at which an effective immune response commences, along with the influence of environmental conditions. It is likely that this research would have significant implications for industry attempting to deploy hatchery bred pearl oyster spat to the wild.

140 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts Chapter 8 : Surveys of the previous outbreak locations, the search for intermediate and alternative hosts and infection experiments.

This chapter describes the survey for both haplosporidian parasites in spats and adult pearl oysters obtained from previous outbreak locations. It also describes the development of a means to assess the infectivity and pathogenicity of Minchinia occulta and Haplosporidium hinei and attempts to identify intermediate and alternative hosts of the haplosporidian parasites. It also suggests further refinements in methods that may aid these objectives and provide fresh samples of the parasites. This chapter relates to objectives 2, 3 and 4.

141 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts 8.1 Introduction

Cascade Bay in King Sound in northern Australia last recorded a Haplosporidium hinei infection in 1995 while Willie Creek recorded an outbreak in 2000. In both of these cases, pearl oysters were never again deployed to the sites of the original infection. The site of the third infection, the Carnarvon pearl oyster hatchery, implemented management measures to prevent further infections. These measures appear to have been successful since no further infections were recorded. In all three outbreaks the entire batch of infected pearl oysters were culled. As a result, little is known about the pathogencity of the pearl oyster parasite. In addition, the sporadic nature of the outbreaks has limited research into the epidemiology of the infection but this feature alone indicates that an alternative host may be more important as a reservoir for maintaining the parasite.

An intermediate host is suspected in the life cycle of haplosporidian parasites since direct transmission has not been demonstrated in any Minchinia or Haplosporidium spp. parasite (Burreson & Ford, 2004) . The widespread distribution of the pearl oyster outbreaks suggest that if an intermediate host(s) is required then it too is widely distributed.

The results obtained in Chapter 5 suggested a haplosporidian parasite (Minchinia occulta) detected in rock oysters may be co-infecting Haplosporidium hinei infected pearl oysters. A method of directly transmitting the parasite between rock oysters and juvenile pearl oysters would not only confirm the parasite is capable of infecting juvenile pearl oysters but would also allow a closer assessment of the threat the parasite poses to the pearling industry, and allow changes in the morphology of the parasite between hosts to be examined. By being able to demonstrate transmission of the rock oyster parasite then the sample technique may be applied to attempt infection of pearl oysters with Haplosporidium hinei once a new infection is detected. In this way Minchinia occulta may be used as a model for the transmission and assessment of Haplosporidium hinei.

The development of sensitive molecular tools for the detection of haplosporidian parasites has a number of practical uses. These include attempting to determine the geographic range of the parasite, whether the parasite can be detected in alternative hosts and its mode of transmission from infected to uninfected oysters.

This study attempts the experimental transmission of Minchinia occulta from infected rock oysters to uninfected adult rock oysters and pearl oyster spat. The oysters were also co-

142 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts housed with or without potential intermediate hosts. Pearl oysters were also bathed in homogenised digestive gland from infected rock oysters.

This chapter also describes the deployment of spat to a site where Haplosporidium hinei has been detected in the past; Cascade Bay (-16.59’S and 123.54’E). Detection of Haplosporidium hinei in this trial would allow monitoring of the clinical effects of the parasite on the oyster and provide fresh samples for sequencing of parasite DNA. Attempts were also made to locate the Minchinia and Haplosporidium parasite(s) from rock oyster and tropical oysters obtained from the sites where pearl oysters became infected with Haplosporidium hinei.

143 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts

8.2 Materials and Methods

8.2.1 Infection trials

In this study, numerous trials were performed on the transmission of Minchinia occulta from rock oysters to rock oysters or pearl oyster spat. Possible horizontal transmission was tested firstly, by cohabitation secondly, with direct injection of infected tissues and thirdly, by cohabitation with a variety of invertebrate fauna from Cascade Bay and Northam in Western Australia. Live infected rock oysters were obtained from the Montebello Islands as in Chapter two. Uninfected pearl oyster spats (5 – 10mm) were obtained from the pearl oyster hatchery located in Broome, Western Australia. Hatchery spat were confirmed uninfected by PCR (SSF66/SSR69), ISH and histology. A variety of live invertebrate zooplankton species including copepods were obtained from a saline pond in Northam near Perth and Cascade Bay using a standard plankton net with a 20 μm mesh size. These samples were tested for the parasite by PCR and ISH using the methodology outlined in Chapters 3 and 4.

8.2.2 The inoculation experiments:

Oysters were maintained and fed in closed aquaria (40 L) containing full-strength salt water (35 g / L; Figure 8.1). The water temperature of the tanks was maintained at 23 °C. A sub- sample of rock oysters was used to confirm infection before the trial. Infection was confirmed using PCR with the primers SSF66/SSR69 and in situ hybridisation with the SSR69 and SSRDb oligonucleotide probes.

144 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts

Figure 8.1 The 40 L aquaria used during the cross infection trial.

During the experiments, oysters were fed daily on 1 L of micro-algae mixture of the genera Chaetocero, Isochrysis and Pavlova. Starter cultures were obtained from Challenger TAFE College (Fremantle, Western Australia) and were maintained in 4 L glass bottles using F2 media and gro lux tm flourescent tubes (Figure 8.2). Glass bottles were covered in foil to prevent contamination. An air tube was inserted into each culture to allow circulation. A second tube was inserted to allow air to escape. A 4 ml syringe was inserted to this tube and stuffed with cotton wool to prevent contamination (Figure 8.2). Culture media was autoclaved at 120°C at 20 atmosheres (ata) for one hour before use. Algae cultures were lit for 12 h per day.

Figure 8.2 The algal cultures used in the project. Three different species (Chaetocero, Isochrysis and Pavlova) were used to maintain live pearl and rock oysters at Murdoch University.

Oyster mortality was checked daily. Reproductive tissue and digestive glands from 15 rock oysters were homogenized in sterile salt water (35 g/ L) and used to inoculate the pearl oysters. For each trial, 30 oysters of the same origin were held as a negative control.

145 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts Infection was assessed by histological examination and in-situ hybridisation. The experiments to artificially reproduce infection are listed in Table 8.1.

Trial 1 Thirty Minchinia occulta infected oysters were cohabitated with 120 pearl oysters (5 mm shell width) for three weeks in a 40 L aquarium. In a second aquarium, 30 infected rock oysters were cohabitated with 30 uninfected rock oysters from Broome in Western Australia (Table 8.1).

Trial 2 Minchinia occulta infected tissues were inoculated by forced injection with 0.05 ml of infected digestive gland tissue through the byssal notch of uninfected pearl oyster spat. A total of 120 pearl oyster spat 5 mm to 10 mm in shell width were injected (Table 8.1).

Trials 3 to 5 Transfer of Minchinia occulta from infected rock oysters was also attempted using an assortment of invertebrates from various sources. In these trials each aquarium was stocked with live infected oysters or faeces (pseudo and true) from infected oysters, a variety of plankton species including copepods and uninfected rock or pearl oysters (Table 8.1).

For the most part, the experimental conditions described above for the inoculation experiments were the same for the cohabitation experiments. The trials performed to reproduce the infection by cohabitation in experimental conditions are listed in Table 8.2.

146 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts Table 8.1 Experiments performed to transmit Minchinia occulta by cohabitation of infected rock oysters, uninfected rock oysters and uninfected pearl oysters.

Trial n of infected Target Species (non Mode of transmission n Duration rock oysters infected) 1 30 Pearl oyster spat 5- Direct- cohabitation 100 12 weeks 10mm 1 30 Adult rock oysters Direct- cohabitation 30 12 weeks 1 nil Pearl oysters and rock None-negative control 60 12 weeks oysters and 30

2* nil Pearl oyster spat 5 mm Injection of infected DG 120 3 weeks 2 nil Pearl oyster spat 5mm None- negative control 120 3 weeks

3 30 Pearl oyster spat 5 mm Cohabitation with 60 12 weeks (and zooplankton) zooplankton (Saline pond- Northam) 3 30 Adult rock oysters Cohabitation with 30 12 weeks zooplankton (Saline pond- Northam) 3 30 Adult rock oysters and None- negative control 30 12 weeks pearl oyster spat and 60

4 Nil pseudo- Zooplankton (Cascade By cohabitation with rock 60 12 weeks faeces only Bay) oyster pseudo faeces. 4 nil Zooplankton (Cascade None-negative control - Bay)

5 30 Pearl oyster spat 5 mm Cohabitation with 60 12 weeks (and zooplankton) zooplankton (Cascade Bay King Sound) 5 30 Adult rock oysters Cohabitation with 60 12 weeks (and zooplankton) zooplankton (Cascade Bay King Sound) 5 30 Adult rock oysters and None- negative control 30 12 weeks pearl oyster spat and 60

8.2.3 Infection by deployment of spat to a previous infection site and the sampling of rock oysters from the previous infection sites.

Six thousand pearl oyster spat were deployed to Cascade Bay (see Chapter 2) by long line in a manner similar to those of the original infection. These oysters were deployed on the 22/1/2006 and sampled approximately every six months up until 12/4/2007. Rock oysters

147 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts and pearl oysters (where possible) from each of the other previous infection sites (Willie Creek and Carnarvon) as well as Koolan Island were sampled as outlined in Chapter 2. All of the bivalves collected in the study were subjected to histological examination and the molecular methods including PCR (HAP; (Renault et al., 2000), protozoan (Carnegie et al., 2003) and SSR69/SSF66 primers) and in-situ hybridisation (polynucleotide, SSR69 and SSRDb probes). These assays were performed as described in Chapter 4.

Plankton samples were obtained from the Montebello Islands and Cascade Bay using a standard plankton net with a 20 μm mesh size. The samples were fixed in 10% seawater buffered formalin. An alternative sample from each location was also obtained and stored in 100% ethanol.

8.2.4 Diagnosis of Minchinia occulta and Haplosporidium hinei. Diagnosis of a haplosporidian infection for the aquaria infection trails, Cascade Bay spat deployment and the samples obtained from the previous infection sites was performed using techniques with varying levels of specificity so as to maximize the chances of obtaining positive results. The techniques used were histology, PCR (SSR69/SSF66 primer) and in-situ hybridisation (with the SSR69 and SSRDb probe) since these tests had already been shown to detect Minchinia occulta in rock oysters (Chapter 4). Each of these techniques was performed using the methods outlined in Chapters 3 and 4.

148 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts

8.3 Results

8.3.0 Aquaria Infection Trials Minchinia occulta transmission was not detected in either the cohabitation or forced injection experiments (Trials 1 and 2) by in situ hybridisation or histology (Table 8.3). Since these trials failed to produce an infection it was hypothesised that an intermediate host may be responsible for transmitting the parasite. Consequently, a number of cohabitation experiments were performed using plankton samples from various sources in order to attempt to find the intermediate host.

Table 8.2 Results of trials of experimental transmission of Minchinia occulta from infected rock oysters.

Trial Source/route of Target species Result infection +/-* n 1 Direct Pearl oyster spat - 60 1 Direct Adult rock oysters - 30 1 Direct -

2 Injection Pearl oyster spat - 100 2 n/a Pearl oyster spat - 100 - 3 Zooplankton Pearl oyster spat - 45 (Northam) 3 Zooplankton Adult Rock oysters - 30 (Northam) 3 n/a Pearl oysters and rock oysters - 30 and 30 - 4 Pseudo-faeces Zooplankton (Cascade Bay) - 2 4 n/a Zooplankton (Cascade Bay) - 2 - 5 Zooplankton Pearl oyster spat - 60 (Cascade Bay) 5 Zooplankton Adult Rock oysters - 30 (Cascade Bay) 5 n/a Pearl and Rock oysters - 30 and 60 * Infection status assessed by Histology, PCR (SSR69 and SSF66 primers) and in – situ hybridisation with the SSR69 labeled probe.

149 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts

8.3.1 Infection by cohabitation

The experiment was successful in co-housing pearl oysters and rock oysters in closed aquaria for the duration of 12 weeks. Direct transmission of the parasite by cohabitation (without plankton) failed to produce an infection (Table 8.3). The forced injection of homogenized infected digestive gland into pearl oysters also did not produce an infection. As a result, live plankton samples containing a variety of invertebrate fauna including copepods were placed in the aquaria with the infected rock oysters or their faeces (true or pseudo). The zooplankton and oyster samples were then assessed for the parasite by PCR and ISH. In each of the different experiments transmission of the parasite failed to be detected (Table 8.3).

8.3.2 Pearl oyster samples from Cascade Bay and Willie Creek.

Adult wild pearl oysters from Willie Creek and spat from Cascade Bay produced negative results by histological examination, PCR and the oligonucleotide ISH (Table 8.4). PCR assays utilised the SSF66/SSR69, all HAP primers (Renault et al., 2000) and protozoan primers (Carnegie et al., 2003). Using the assessments of diagnostic sensitivity and specificity from chapter 4 these assays would have detected a haplosporidian infection with a minimum prevalence of 2.20% for the first sample followed by 3.20%, 3.00% and 3.05% for each of the following samples using histology (Table 8.3). The spat did produce positive results by the non-specific polynucleotide ISH (Figure 8.2). The unidentified parasite was widely distributed through-out the digestive gland of the host and was present in each of the sampled batches at a prevalence of approximately 60% (Table 8.4). Of the seventy one oysters processed from the first sample forty one were positive (57 %) after only 6 six weeks deployment.

150 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts Table 8.3 Results of assays for pearl oyster samples from Cascade Bay and Willie Creek. Diagnostic Method Location Date PCR* ISH poly- ISH oligo- Lower 95% Upper 95% Histology Lower 95% Upper 95% nucleotide nucleotide CI of CI of CI of CI of probe probe apparent apparent apparent apparent prevalence prevalence prevalence prevalence Cascade 14/3/06 0/45 41/71 0/71 0 5.13% 0/171 0% 2.2% Bay# 30/5/06 0/45 21/30 0/50 0 7.13% 0/120 0% 3.1% 22/9/06 0/45 23/34 0/50 0 7.13% 0/124 0% 3.0% 15/4/07 0/45 24/36 0/50 0 7.13% 0/122 0% 3.05% Willie 8/5/06 0/20 11/20 0/20 0 16.11% 0/20 0% 16.11% Creek * PCR with protozoan, HAP, and SSF66/SSR69 primers. # ISH with polynucleotide and oligonucleotide (SSR69) probes. # Longline was deployed 22/1/2006

The non-specific ISH probe used to target the parasite produced strong hybridisation signals with little background staining (Figure 8.3). This signal was not reproduced in tissues processed from uninfected oysters or in negative control material.

The unidentified parasites location in tissue sections were confirmed in H&E sections cut adjacent to those tested with in situ hybridisation (Figure 8.3). The parasites were primarily located in the connective tissue (Leydig) and digestive diverticula of the digestive gland with some individuals located in mantle connective tissue (Figure 8.3).

151 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts

Figure 8.3 A section from a pearl oyster spat from Cascade Bay, King Sound assayed with a non-specific polynucleotide ISH. Digestive gland is indicated by a DG. The gills are indicated with a G while mantle tissue is indicated with a M. Parasites are indicated by a darker colouration. Sections are counterstained in a brazilian hematoxylin. Scale bar = 50 μm. (B) Higher magnification view of the hybridisation of the polynucleotide probe to the Cascade Bay parasite in tissue sections of the digestive gland. Not all parasites are present in the neighbouring section. Scale bar = 10 μm. (C) Adjacent section stained in H&E. Scale bar = 15um. (D) Infected section enlarged to show what appears to be a bi-nucleate life stage. Scale bar= 8 um.

152 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts The only parasite stages observed appeared to be single nucleate or bi nucleate stages (Figure 8.3). Oyster granulocytes were common among the unidentified parasites but phagocytosis or necrotic debris was not observed. Overall, the infected pearl oyster spat were growing strongly and appeared healthy with fully extended mantles (unpublished observations).

Figure 8.4 Transmission electron microscopy of the parasite detected in Pearl Oyster samples from Cascade Bay. CW denotes cell wall. N denotes a nucleus. Scale bar = 750 nm.

In order to attempt to identify these organisms TEM was performed. The parasite measured 3 μm in diameter and appeared to be a “microcell” parasite (Figure 8.4). However, no further diagnostic features could be obtained.

153 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts 8.3.3 Rock oyster samples

The rock oyster samples from each of previous locations of the infection were tested by histological examination, PCR and ISH. None of the rock oyster samples from the previous infection sites tested positive (Table 8.4).

Table 8.4 Rock oyster (Saccostrea cuccullata) and tropical oysters (Saccostrea echinata) sampled from the previous infection sites of Haplosporidium hinei in pearl oysters and Koolan Island.

Location Species Date PCR ISH– ISH- Lower 95% Upper 95% Histology CI for CI for collected * polynucleotid oligonucleo apparent apparent e probe tide probes prevalence prevalence (SSR69/SS using ISH using ISH RDb) Cascade Rock 14/3/06 0/25 0/72 0/72 0% 5.07% 0/72 Bay oysters and 30/5/06 Quondong Rock 10/5/06 0/25 0/65 0/65 0% 5.55% 0/65 Point (nr oysters Willie Creek) Carnarvon Rock 1994 0/25 0/36 0/36 0% 9.64% 0/36 oysters Koolan Tropical 1994 N/A 4/27 4/27 5.92% 32.48% 4/27 Island oysters * With protozoan, HAP, and SSF66/SSR69 primers.

8.3.4 Koolan Island Tropical Oyster sample

Four of the 27 tropical oysters from the Koolan Island sample tested positive with both of the specific oligonucleotide ISH probes giving a minimum prevalence of 5.92% with 95% confidence (Table 8.4%). Histological examination indicated a multinucleated haplosporidian parasite was present in the samples (Figure 8.5).

The parasite was identified in hematoxylin-eosin stained sections using in-situ hybridisation with the SSR69 oligonucleotide probe. The probe produced strong hybridisation signals with little background staining (Figure 8.6). This signal was not reproduced in tissues processed from uninfected oysters or in negative control material (Figure 8.6)

154 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts The parasite measured 4 μm in diameter and was disseminated in the mantle and gill tissue of the host. The only parasite life stages observed were multinucleated plasmodia.

There appeared to be little in the way of a defensive response from the oyster to the parasite. Indeed, there appeared to be few haemocytes in the vicinity of the parasites. No phagocytosis of parasite cells was observed. Spores were not detected in this study so the parasite was not able to be identified using the established morphological criteria (Burreson, 2001) and only formalin fixed material was available making molecular analysis difficult.

155 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts

Figure 8.5 Serial sections of tropical oyster mantle tissue containing a haplosporidian parasite. (A) a hematoxylin-eosin stained section. Parasites are indicated with an arrow. (B) an in situ hybridisation assay containing the SSRDb probe. (C) an in situ hybridisation assay with no probe in the hybridisation solution (negative control). Sections are counterstained in a brazilian hematoxylin. Scale bars = 10 μm.

156 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts 8.4 Discussion

8.4.1 The inoculation experiments Transmission of Minchinia occulta could not be achieved by the methods used in this study. Since no transmission occurred it is probable Minchinia occulta uses an intermediate host in its lifecycle. This finding is similar to findings for haplosporidian parasites overseas (Burreson & Ford, 2004).

Transmission of the haplosporidian Bonamia ostrea was recently performed by cohabitation with the brittle star, Ophiothrix fragilis (Lynch et al., 2007). Bonamia ostreae, in which spores have not been detected, has been shown to be directly transmissible by cohabitation with infected oysters (Elston et al., 1986) or by inoculation (Hervio et al., 1985). Direct transmission of other spore forming haplosporidian parasites has not yet been demonstrated leading to speculation of an intermediate host. Direct transmission of another “microcell” parasite Marteilia refringens has also been unsuccessful (Berthe et al., 1998). However, the parasite was detected in the copepod Paracartia grani (Audemard et al., 2001) suggesting this species acts as an intermediate host. It has also been suggested that the infective stage of Haplosporidium nelsoni is capable of passing through a 1000 μm filter (Sunila et al., 2000) and a 150 μm filter (Ford et al., 2001) but not a 1 μm filter with UV irradiation. The widespread distribution of Haplosporidium nelsoni suggests either the parasite can infect a variety of intermediate hosts and/or the intermediate host is also widely distributed. It is also possible the intermediate host of Minchinia occulta is a similar resident(s) of the zooplankton such as a copepod and is widely distributed on the Western Australian coastline or more than one intermediate host exists for the parasite. The plankton samples obtained during this study tested negative to the parasite by PCR and ISH.

Transmission under laboratory conditions could fail because either the environment or the oysters are not providing the right stimuli. The local environment may play a role in the virulence of the pathogen (Berthe et al., 1998). It is possible that Minchinia occulta is a very fastidious parasite that requires very specific conditions to infect rock oysters or pearl oysters. These conditions may not have been met in the course of these experiments. It is also possible the spores may need a period of maturation in the environment although the trials including oyster faeces also failed to transmit the parasite. Further surveys of wild stocks of rock oysters and other bivalves would be desirable to examine the natural distribution of the parasite and examine possible sources of infection.

157 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts Direct injection of the parasite should have overcome many of the environmental variables or stimuli that may have prevented transmission. The failure of the direct injection experiments suggests some form of parasite maturation in an intermediate host is required. The preferred method to examine this hypothesis would be to identify the parasite stages of maturation and requirements directly in the intermediate host. Obviously, this would require identification of the intermediate host.

Identification of the intermediate host may be achieved by exposing hatchery raised oyster spat in aquaria to filtered sea water at the infection sites where the parasite is known to exist. The levels of filtration could be varied across a number of replicate aquaria. Once an infection was detected then an assessment of the potential intermediate hosts that occur in the aquarium could be carried out. This would drastically reduce the number of potential intermediate hosts and the size of the intermediate host could be estimated. This method would be more effective than co-housing affected and unaffected oysters however; it relies on the intermediate host being present in reasonable numbers in the affected aquaria to facilitate its detection and identification.

The Cascade deployment of pearl oyster spat was the first time pearl oysters have been deployed to the site of a previous haplosporidian infection. The trial produced positive results with the non-specific polynucleotide probe. The same samples were negative with the more specific SSR69 and SSRDb oligonucleotide probes and PCR. Therefore, the parasite detected is unlikely to be Haplosporidium hinei or Minchinia occulta but another unidentified “microcell” parasite of pearl oysters. The prevalence of infection did not change during the trial and the parasite was also detected in adult pearl oysters from Willie Creek.

The distribution of the parasite in rock oysters does not match the locations of the parasite has been detected in pearl oysters. Thus far the parasite has not been detected in rock oysters from Willie Creek near Broome or at Cascade Bay in King Sound and further sampling may be required from these areas. It is possible the number of samples obtained from the sites was not adequate to detect a low prevalence of parasite (depending on the sensitivity of the tests employed; (OIE, 2006)). Alternatively, samples may need to be obtained at different times of the year. However, four of 27 tropical oysters were positive by the SSRDb oligonucleotide ISH probe. These oysters were obtained from Koolan Island north of King Sound. It therefore appears likely that the original reservoir host of the

158 FRDC Project 2006/064 Chapter 8: Intermediate and Alternative hosts Minchinia occulta infections in pearl oysters was tropical oysters. Further sampling and research is required to obtain ethanol stored infected tropical oysters for molecular analysis.

159 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development Chapter 9 Conclusions and Further Development.

160 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development The primary objectives of this study were to describe the haplosporidian parasites of northern Western Australia. Appropriate molecular, pathological and electron microscopy techniques were used. The specific aims were to use these methods to: 1. Complete DNA isolation and PCR amplification of material from previous WA outbreaks, with molecular identification of species. 2. Complete survey with DNA isolation and PCR amplification of material from spats deployed in, and/or collection of wild shell from various sites, including previous outbreak locations. 3. To determine whether the parasite is still present in the original outbreak sites and in other sites not historically affected, by the deployment and assessment of spat in these locations. 4. To develop a means for the assessment of infectivity and pathogenicity using rock oysters and their endemic haplosporidians as a model. 5. Complete of a PhD thesis.

9.1 Objective one: Complete DNA isolation and PCR amplification of material from previous WA outbreaks, with molecular identification of species. Previous to this study two undescribed Haplosporidium sp. parasites were identified as occurring on the Western Australian coastline. The sporadic nature of the outbreaks in pearl oysters suggested an alternative host acted as a reservoir for the parasite. The most likely candidate was the Haplosporidium sp. occurring in rock oysters.

9.1.1 Molecular characterisation of a haplosporidian parasite infecting rock oysters Saccostrea cuccullata in north Western Australia. The results obtained here demonstrated through PCR and in situ hybridisation the presence of a cryptic haplosporidian parasite in rock oysters. The parasite was originally described as belonging to Haplosporidium however; a phylogenetic analysis indicated a Minchinia species between Minchinia tapetis and Minchinia chitonis (Figure 3.5). The parasites were generally present at low levels of infection making them difficult to detect by histological examination alone. The results of the PCR and in-situ hybridisation assays supported one another. These molecular techniques arrived at the same conclusion by independent means and therefore gave more confidence to these findings. Parasites were detected in the reproductive follicles, digestive gland and gills of the host. The Minchinia parasite detected in this study was at a relatively high rate of prevalence at 43% although parasite stages were restricted primarily to a single nucleate stage resembling a Bonamia species (Table 3.2). 161 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development

The samples obtained in Hine and Thorne (2002) were unusual in that they were associated with mortalities (up to 80%) detected by energy companies operating on the north-west gas shelf of Western Australia. At least four subsequent attempts to detect the parasite failed to detect parasite suggesting the widespread mortalities described by energy companies were unusual. Oysters obtained in this study were subjected to considerably lower parasite loads than those described in Hine and Thorne (2002) and there was also a difference in the oyster tissues infected. In Hine and Thorne (2002) the parasite consisted of a variety of life stages including multi-nucleated plasmodia, sporoblasts and spores. It is possible the process of sporogenesis in Minchinia occulta is linked to the documented mortalities in rock oysters described by energy companies. Hine and Thorne (2002) found Minchinia occulta in a variety of anatomic locations including the digestive gland, gills, mantle and to a much lesser extent the reproductive tissue of the host. In this study the parasite occupied primarily the reproductive tissues although some parasites were detected in the gills and digestive glands.

The current samples suggest the parasite is not causing mortalities in the infected oysters however; the parasite has been linked to mortalities of up to 80% in a previous study (Hine & Thorne, 2002). The pathogenicity of the parasite in rock oysters and in the secondary host may be dependent on seasonal factors that are probably linked to sporogenesis in Minchinia occulta. It is not unusual for the pathogenicity of haplosporidian parasites to vary markedly according to external factors. Bonamia roughleyi, the aetiological agent of winter mortality in Sydney Rock Oysters within New South Wales, is known to cause mortality, rather predictably, in the winter months. The pathogenicity of Haplosporidium nelsoni (MSX) and Perkinsus marinus (dermo disease) in the Eastern oyster in the United States are known to intensify during periods of higher temperatures and salinity. Indeed, aquaculturists attempting to prevent infection or treat affected eastern oysters often translocate their oysters to an alternative site of lower salinity (Burreson & Ford, 2004). It is possible sporogenesis in Minchinia occulta results in the mortality of the rock oyster. Consequently, the onset of mortalities in the rock oyster would be determined by the disease and factors that cause Minchinia occulta to sporulate. This hypothesis explains why Hine and Thorne (2002) found spores when the oysters were undergoing mortalities and why this study and other sampling trips that occurred when few mortalities where occurring did not detect Minchinia occulta spores.

162 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development 9.1.2 Suggesting a potential molecular assay for the rock oyster parasite and commencing an assessment of their sensitivity and specificity. Infection by Minchinia occulta in S. cuccullata was detected by histological examination (an initial examination and a retrospective examination) PCR and in-situ hybridisation with the oligonucleotide probe. The initial histological examination detected 14 infected oysters among the 56 oysters examined while PCR amplification detected 26 infected oysters (Table 4.3). In-situ hybridisation detected a total of 29 infected oysters (Table 4.3). These results indicate that both the PCR assay developed in this study and the in-situ hybridisation assay developed in Chapter 3 were capable of detecting Minchinia occulta in S. cuccullata. The comparison of diagnostic techniques suggested the ISH assay was the most sensitive followed by PCR (Tables 4.3 and 4.4). These results indicate a minimum prevalence of Minchinia occulta at the Montebello Islands of 39.01% with 95% confidence at the sites sampled. The oligonucleotide SSR69 ISH assay did not cross react with any of the six other haplosporidian species tested. However, results obtained in chapters 5, 6 and 7 suggest the SSR69 probe cross reacts with H. hinei. Consequently, a new probe was designed (SSRDb) for use in ISH assays.

The molecular tools described here provide a method to explore the pathogenicity of the parasite. The ISH assay could be used to pin point life cycle and pathological and anatomical relationships in either experimental (if successfully performed) or natural disease. The PCR assay developed in this study could be used to address questions about parasite presence while if a quantitative PCR such as real time PCR (rtPCR) was developed then this assay could be used to address questions of parasite load. Thus, these molecular tools could be used to address the requirements of parasite and disease association as in Evan’s postulates (Evans, 1976).

It’s possible the life cycle of the parasite is altered by seasonal factors such as the host life- cycle or external factors such as temperature. Presumably these factors could be used to “treat” affected oysters. The molecular tools described in this study may be used to assess the prevalence and load of the parasite in these attempted treatments. Any fall in the occurrence of the disease and the prevalence of the parasite would also provide evidence of the link between the parasite and associated mortalities and therefore help to fulfill Evan’s postulates.

163 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development 9.1.3 Determining whether the detected parasite is present in past haplosporidian outbreaks in pearl oysters. The haplosporidian infection of pearl oysters tested positive by two different PCR assays for the Minchinia parasite with no evidence of contamination. The PCR assays suggest the infections were either a co-infection of two different parasites or that the pearl oyster and rock oyster parasites were the same species. The best way to resolve these differing hypotheses was to directly assess parasite spore morphology by both scanning and transmission electron microscopy (see 9.4 and 9.5 below).

In-situ hybridisation was employed to allow visualization of the parasites. Two oligonucleotide ISH assays were utilised; one utilised the SSR69 probe and reacted to all haplosporidian parasites in the infected pearl oysters while the other utilised the SSRDb probe and only reacted to some. Neither probe reacted to closely related haplosporidians Haplosporidium nelsoni, Haplosporidium costale or Minchinia teredinis.

Molecular methods such as in situ hybridization could be used to provide evidence for a co- infection or for same species identification. However, these methods were not as effective as electron microscopy in this study since samples suitable for molecular analysis of the pearl oyster parasite were not available or at least no sequence could be obtained from the samples that were available. This limited the sequence information that could be developed for the parasite making the interpretation of in-situ hybridisation assays difficult. If an in- situ hybridisation probe failed to react it was difficult to determine if the detected underlying sequence variation was the result of intra or inter specific differences. The results of this study suggest there were four intra-specific polymorphic sites within the SSU rRNA gene sequence obtained in this study (Chapter 4). Alternatively, if the ISH probe annealed then it was difficult to rule out a chance cross reaction with an undescribed species since they may possess some sequence similarities at the site targeted. It may mean a more variable region such as the ITS region utilized for the detection and identification of Perkinsus and Marteilia species would need to be targeted (Audemard et al., 2004; Kleeman & Adlard, 2000; Kleeman et al., 2002) . In these circumstances species boundaries should be clearly defined before molecular analysis.

9.1.4 Describing the spore ornamentation of the haplosporidian in pearl oysters using both scanning and transmission electron microscopy. The parasite described in this study showed the typical morphology, spore structure and spore ornamentation of a haplosporidian species. The internal organisation of the spore 164 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development endosporoplasm shows a similar arrangement to other haplosporidian species. This was characterised by the presence of a basal or equatorial nucleus, an apical spherule and several electron dense membrane bound haplosporosomes. The presence of an orifice which is covered with an operculum suggests the parasite belongs to either Minchinia or Haplosporidium (or Bonamia).

If the criteria proposed by Ormieres (1980) for distinguishing the genera Haplosporidium and Minchinia are followed then Haplosporidium hinei n.sp was correctly assigned to Haplosporidium by Hine and Thorne (1998) because the filaments are derived from the spore wall and not from epispore cytoplasm. The ornamentation on the spores of the pearl oyster parasite described by the number of filaments, their length, insertion points on the wall and organisation of the filaments was unique among described haplosporidian species where spore ornamentation is known. The spores of the parasite have two spore wall filaments wound around the spore which appeared to originate from two posterior wall thickening. The parasite was named Haplosporidium hinei.

Molecular characterisation of the pearl oyster parasite will require samples suitable for molecular analysis. This would be best achieved using the replicate ethanol and formalin fixed sampling regime described in Chapter 2 the next time Haplosporidium hinei is detected. This type of sampling regime facilitates the collection of molecular data in samples where low levels of parasite prevalence have been detected. Molecular tools could then be developed and a phylogenetic analysis performed. In addition, the outbreak should be quarantined so that the pathogenicity of the parasite can be determined using the techniques discussed for the rock oyster parasite in section 9.1 above. In this way, the disease risk posed by Haplosporidium hinei can be properly assessed.

9.1.5 Describing the spore ornamentation of the haplosporidian in rock oysters using both scanning and transmission electron microscopy. The parasite spores showed the typical morphology and structure of a haplosporidian species with the presence of an orifice that was covered with an operculum. The spore ornamentation consisted of a network of branching microtubule-like structures covering the entire spore including the opercula lid. A ridge was also present on one side of the spore beginning just below the operculum and ending approximately 2 um from the aboral end of the spore. No evidence of any spore wall derived ornamentation could be detected. These results confirm the Minchinia sequence obtained from the rock oyster samples in Chapter 3 and confirm the pearl oyster and rock oyster parasites are different species. 165 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development

Hine and Thorne (2002) described the development of Minchinia occulta including multinucleate and spore forming stages. However, it is possible multi-nucleate stages are relatively rare in the life-cycle of Minchinia occulta. At least four subsequent trips to the sites of the original infections failed to detect the parasite. It is likely Minchinia occulta was present during these subsequent sampling trips but the single nucleate stage was not easily recognised in histology. The single nucleate stage of the parasite was only recognised during this study by utilising in-situ hybridisation to explain positive PCR assays with degenerate HAP primers. Once described the single nucleate stage was easily detected in histology. The samples obtained by Hine and Thorne (2002) were unusual since they were obtained when mortalities were occurring and because subsequent sampling trips failed to detect the parasite (when no mortalities were occurring). Carnegie et al (2006) also described spore forming multi-nucleate stages in Bonamia perspora. Speculatively, the single nucleate stage of the life cycle may become more dominant in the life cycle of the haplosporidians the more closely related the parasite is to Bonamia. These results confirm phylogenetic analyses indicating Minchinia is a sister taxon to Bonamia.

The presence of co-infected pearl oysters made species determination and assessment of the results from the molecular assays difficult. Consequently, a considerable amount of effort went into objective one. However, once the haplosporidian parasites were formally described and species boundaries determined the other project objectives could be persued.

9.2 Objectives 2 and 3: Determining whether the parasite is still present at the previous infection sites by completing a survey with DNA isolation and PCR amplification of material from spats deployed in, and/or collection of wild shell from various sites, including previous outbreak locations. Rock oysters and pearl oysters were collected from the sites of the previous outbreak locations at various times of the year. However, the survey did not find any evidence of either parasite. Also, the Cascade Bay deployment failed to produce a Haplosporidium hinei or Minchinia occulta infection and suggests the parasites were either not present at the site or the conditions required for the infection of pearl oysters were not met. Using the assessments of diagnostic sensitivity and specificity from Chapter 4 these assays would have detected a haplosporidian infection with a minimum prevalence of 2.20% for the first sample followed by 3.20%, 3.00% and 3.05% with 95% confidence for each of the samples

166 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development using histology (Table 8.3) at the Cascade Bay site. The current lease holder of the Willie Creek site has now deployed spat to the site for 20 months. Haplosporidium hinei has not been detected to date. The lack of any detection of the parasite at Cascade Bay and Willie Creek suggests the original outbreaks of Haplosporidium hinei were unusual events. The widespread geographic distribution but sporadic frequency of the outbreaks confirms this finding.

The study did find what appeared to be a Minchinia occulta infection in tropical oysters further north at Koolan Island. The parasite was identified with both the SSRDb and SSR69 assays and diagnosis was confirmed on H/E stained sections (Figure 5.8). The minimum prevalence of the parasite was 5.92% with a 95% confidence. This result indicates the M. occulta was widespread on the Western Australian coastline although not necessarily in rock oysters (S. cuccullata). The parasite was not detected in plankton samples from Cascade Bay and the Montebello Islands by PCR or ISH.

9.3. Objective 4: To develop a means for the assessment of infectivity and pathogenicity using rock oysters and their endemic haplosporidians as a model. Transmission of Minchinia occulta in S. cuccullata could not be achieved by the methods used in this study. The infectivity trials indicated the parasite was not directly transferable between pearl oysters and rock oysters or between rock oysters and rock oysters. These results indicate an intermediate host may be required to transfer the parasite.

The inability of obtain Haplosporidium hinei infected oysters from Cascade Bay restricted samples available for molecular analysis to formalin fixed archived samples. Attempts to transmit Minchinia occulta were unsuccessful using the methods employed in this study. It is probable only a small number of potential intermediate hosts were tested relative to the large number of species that may act as an intermediate hosts for haplosporidian parasites. This variety is the most likely reason no intermediate host has been detected for any of Haplosporidium or Minchinia.

One method that might produce an intermediate host would be to expose hatchery raised oyster spat in aquaria to filtered sea water at the infection sites where the parasite is known to exist. The grade of filtration could be varied across a number of replicates. Once an

167 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development infection was detected then an assessment of the potential intermediate hosts that exist in the aquarium could be made in the aquarium where smallest grade of filtration was carried out. In this way the number of potential intermediate hosts would be drastically reduced and the size of the intermediate host could be estimated. This method would be more effective than co-housing affected and unaffected oysters. The presence of the Minchinia in the intermediate host could be assessed through the PCR and in-situ hybridisation assays developed in this study.

9.4 Overall Evidence presented in Chapter 5 suggested the possibility the rock oyster and pearl oyster parasites were the same species. This evidence included sequences generated from multiple amplifications of the SSU rRNA gene with no evidence of contamination (Figure 5.2). An oligonucleotide ISH assay using the SSR69 probe also confirmed these results (Figures 5.7 and 5.8). The SSR69 probe did not react to any of the six haplosporidian species tested. However, the assay utilising the SSRDb probe reacted to only some of the haplosporidian parasites present and did not react to the three haplosporidian species tested (Figures 4.7, 4.8 and 5.9).

The morphological evidence presented in Chapters 7 and 8 confirms the two parasites are different species. The principal evidence for this difference is the presence of a wrapping of branching microtubule like structures present on the surface of the spores and the lack of any spore wall derived ornamentation on the spores of Minchinia occulta.

Before this study, a single preliminary TEM description of the rock oyster and pearl oyster parasites had been carried out. Both parasites were described simply as Haplosporidium sp. It was not clear whether either parasite was one of those notifable under the OIE guidelines such as H. nelsoni. The results of this study confirm both parasite species are unique. The research presented here obtained samples of Minchinia occulta for both molecular and histological assessment. The SSU rRNA gene of the rock oyster parasite was sequenced allowing phylogenetic assessment and the development of molecular tools for its detection and description. The parasite was present at all four sampling locations at the Montebello Islands. In-situ hybridisation combined with histological analysis allowed the description of a cryptic uni-nucleate stage residing in the reproductive tissue of the host. The uni- nucleate stage resembles a Bonamia parasite which is a sister taxon to the Minchinia. The non-spore stages of the Minchinia remain under described in the literature perhaps because 168 FRDC Project 2006/064 Chapter 9 Conclusions and Further Development of the presence of cryptic uni-nucleate stages in their lifecycle. This study has provided the tools for the easy detection of the Minchinia parasite of rock oysters in the future and described the spore morphology of both the pearl oyster and rock oyster parasites using TEM and SEM, in the process naming both species. As a consequence of this research, there are now several areas of future research into these parasites that need to be pursued. Formost amongst them is obtaining an SSU rRNA gene sequence for Haplosporidium hinei. The replicate sampling method outlined in Chapter 2 will facilitate this objective once the parasite is again detected. Future research should also attempt to determine the pathogenicity of both parasites using Evans postulates (Evans, 1976) or a similar scheme combined with year round sampling.

The susceptibility of juvenile pearl oysters to infection suggests the immune competence of the host may be an important factor in preventing infection in pearl oysters and therefore preventing spat mortalities. Further research is required to document the susceptibility of juvenile pearl oysters to infection and to characterise the age or size at which an effective immune response commences along with the influence of environmental conditions on its operation. It is likely that this research would have significant implications for industry attempting to deploy hatchery bred pearl oyster spat to the wild.

169 FRDC Project 2006/064 Literature Cited

Literature Cited

. ABARE (2007). Australian Fisheries Statistics 2006. Australian Bureau of Agricultural

and Resource Economics, Canberra, Australia.

ABOLLO, E., RAMILO, A., CASAS, S., COMESANA, P., CAO, A., CARBALLAI, M.

and VILLALBA, A. (2008). First detection of the protozoan parasite Bonamia

exitiosa (Haplosporidia) infecting flat oyster Ostrea edulis grown in European

waters. Aquaculture, 274, 201-207.

ANON (1992). Investigation into incidence of decreased Saccostrea cucullata abundance at

Airlie Island. pp. 16. Sinclair Knight Pty Ltd.

ANON (1998). Preparation of paraffin-embedded tissues for PCR for Mycobacterium

paratuberculosis. In Johne's Disease Laboratory Manual, Vol. 1 Sydney University

(EMAI).

ANON (2002). Import risk analysis (IRA) of Non-Viable Bivalve Molluscs. Technical

issues paper. Australian Government. Agriculture, Fisheries and Forestry.

ANON (2004). The health status of Western Australian aquaculture. Department of

Fisheries WA.

AUDEMARD, C., LE ROUX, F., BARNARD, A., COLLINS, C., SAUTOUR, B.,

SAURIAU, P. G., DE MONTAUDOUIN, X., COUSTAU, C., COMBES, C. and

BERTHE, F. (2001). Needle in a haystack: involvement of the copepod Paracartia

grani in the life-cycle of the oyster pathogen Marteilia refringens.

AUDEMARD, C., REECE, K. S. and BURRESON, E. M. (2004). Real time PCR for

detection and quantification of the protististan parasite Perkinsus marinus in

environmental waters. Applied and environmental microbiology, 70, 6611-6618.

AZEVEDO, C. (1984). Ultrastructure of the spore of Haplosporidium lusitanicum sp. n.

(Haplosporida, Haplosporidiidae), parasite of a marine mollusc. Journal of

Parasitology, 70, 358-371. 170 FRDC Project 2006/064 Literature Cited AZEVEDO, C. (2001). Ultrastructural description of the spore maturation stages of the

clam parasite Minchinia tapetis (Vilela, 1951) (Haplosporida: Haplosporidiidae).

Syst Parasitol, 49, 189-194.

AZEVEDO, C., BALSEIRO, P., CASAL, G., GESTAL, C., ARANGUREN, R., STOKES,

N. A., CARNEGIE, R. B., NOVOA, B., BURRESON, E. M. and FIGUERAS, A. J.

(2006). Ultrastructural and molecular characterization of Haplosporidium montforti

n.sp., parasite of the European abalone Haliotis tuberculata. Journal of Invertebrate

Pathology., 92, 23-32.

AZEVEDO, C., CONCHAS, R. F. and MONTES, J. (2003). Description of

Haplosporidium edule n. sp. (Phylum Haplosporidia), a parasite of Cerastoderma

edule (Mollusca, Bivalvia) with complex spore ornamentation. European Journal of

Protistology, 39, 161.

AZEVEDO, C., MONTES, J. and CORRAL, L. (1999). A revised description of

Haplosporidium armoricanum, parasite of Ostrea edulis L. from Galicia,

northwestern Spain, with special reference to the spore-wall filaments.

Parasitological Research

85, 977-983.

BALL, S. J. (1980). Fine structure of the spores of Minchinia chitonis (Lankester, 1885)

Labbe 1896 (Sporozoa: Haplosporidia), a parasite of the chiton, Lepidochitona

cinereus. Parasitology, 81, 169-176.

BALSEIRO, P., ARANGUREN, R., GESTAL, C., NOVOA, B. and FIGUERAS, A. J.

(2006). Candidatus Xenohaliotis californiensis and Haplosporidium montforti

associated with mortalities of abalone Haliotis tuberculata cultured in Europe.

Aquaculture, 258, 63-72.

BEARHAM, D., SPIERS, Z., RAIDAL, S., JONES, J. B. and NICHOLLS, P. K. (2007).

Molecular characterisation of a Haplosporidian parasite infecting rock oysters

Saccostrea cuccullata in north Western Australia. J Invertebr Pathol, 95, 33-40. 171 FRDC Project 2006/064 Literature Cited BERTHE, F., PERNAS, M., ZERABIB, M., HAFFNER, P., THEBAULT, A. and

FIGUERAS, A. J. (1998). Experimental transmission of Marteilia refringens with

special consideration of its life cycle. Diseases of aquatic organisms, 34, 135-144.

BRAYFORD, H. G. and PAUST, G. (2000). The nature of "rights" in the Western

Australian pearling industry. FAO. Fish Tech Paper

404/2, 338-342.

BROWN, W. (2006). Operations Manager, Deep Water Point pearl farm.

BURRESON, E. M. (2000). Disease diagnosis by PCR: foolproof or foolhardy? Journal of

shellfish research, 19, 642.

BURRESON, E. M. (2001). Spore ornamentation of Haplosporidium pickfordi Barrow,

1961 (Haplosporidia), a parasite of freshwater snails in Michigan, USA. Journal of

Eukaryote Microbiology, 48, 622-626.

BURRESON, E. M. and FORD, S. E. (2004). A review of recent information on the

Haplosporidia, with special reference to Haplosporidium nelsoni (MSX disease).

Aquat Living Resour, 17, 499-517.

BURRESON, E. M. and REECE, K. S. (2006). Spore ornamentation of Haplosporidium

nelsoni and Haplosporidium costale (Haplosporidia), and incongruence of

molecular phylogeny and spore ornamentation in the Haplosporidia. Journal of

Parasitology, 92, 1295-1301.

BURRESON, E. M., STOKES, N. A. and FREIDMAN, C. S. (2000a). Increased virulence

in an introduced pathogen: Haplosporidium nelsoni (MSX) in the eastern oyster

Crassostrea virginica. Journal of Aquatic Animal Health, 12, 1-8.

BURRESON, E. M., STOKES, N. A. and FRIEDMAN, C. S. (2000b). Increased virulence

in an introduced pathogen: Haplosporidium nelsoni (MSX) in the eastern oyster

Crassostrea virginica. J Aquat Anim Health, 1-8.

CARNEGIE, R. B., BURRESON, E. M., HINE, P. M., STOKES, N. A., AUDEMARD, C.,

BISHOP, M. J. and PETERSON, C. H. (2006). Bonamia perspora n.sp 172 FRDC Project 2006/064 Literature Cited (Haplosporidia), a parasite of the oyster Ostreola equestris is the first Bonamia

species known to produce spores. Journal of Eukaryotic Microbiology, 53, 232-245.

CARNEGIE, R. B., MEYER, G. R., BLACKBOURN, J., COCHENNEC-LAUREAU, N.,

BERTHE, F. and BOWER, S. M. (2003). Molecular detection of the oyster parasite

Mikrocytos mackini, and a preliminary phylogenetic analysis. Dis Aquat Org, 54,

219-227.

CAVALIER-SMITH, T. and CHAO, E. E. Y. (2003). Phylogeny of Coanozoa, Apusozoa,

and Protozoa and early eukaryote megaevolution. Journal of Molecular Evolution,

56, 540-563.

CHASE, M. R., ETTER, R. J., REX, M. A. and QUATTRO, J. M. (1998). Extraction and

amplification of mitochondrial DNA from formalin fixed deep sea molluscs.

Biotechniques, 24, 243-247.

CLEMENT, M., POSADA, D. and CRANDALL, K. A. (2000). TCS: a computer program

to estimate gene genealogies. Mol Ecol, 9, 1657-1660

COCHENNEC, N., LE ROUX, F., BERTHE, F. and GERARD, A. (2000). Detection of

Bonamia ostreae based on small subunit ribosomal probe. Journal of Invertebrate

pathology, 76, 26-32.

COMPS, M. and TIGE, G. (1997). Fine structure of Minchinia sp., A haplosporidian

infecting the mussel Mytilus galloprovincialis L. Systematic Parasitology, 38, 45-

50.

DIGGLES, B. K., COCHENNEC, N. and HINE, P. M. (2003). Comparison of diagnostic

techniques for Bonamia exitiosus from flat oysters Ostrea chilensis in New Zealand.

Aquaculture, 220, 145-156.

DIGGLES, B. K., NICHOL, J., HOINE, P. M., WAKEFIELD, S., COCHENNEC-

LAUREAU, N., ROBERTS, R. D. and FRIEDMAN, C. S. (2002). Pathology of the

173 FRDC Project 2006/064 Literature Cited cultured paua Haliotis iris infected with a novel haplosporidian, with some

observations on the course of disease. Diseases of aquatic organisms, 50, 219-231.

DYBDAHL, R. E. and PASS, D. A. (1985). An investigation of mortality of the pearl

oyster Pinctada maxima, in Western Australia. Report No 71. Fisheries

Department, Western Australia.

ELSTON, R. A., FARLEY, C. A. and KENT, M. L. (1986). Occurrence and significance of

bonamiasis in European flat oysters Ostrea edulis in North America. Dis Aquat Org,

EVANS (1976). Causation and disease: The Henle-Koch postulates revisited. Y J Biol

Medicine, 49, 175-195.

FELSENSTEIN, J. (1985). How we can infer geography and histroy from gene

frequencies? Journal of Theoretical Biology, 96, 9-20.

FLETCHER, W., FRIEDMAN, K., WEIR, V., MCCREA, J. and CLARK, R. (2006). Pearl

Oyster Fishery. Department of Fisheries Western Australia.

FORD, S. E. and HASKIN, H. H. (1982). History and epizootiology of Haplosporidium

nelsoni (MSX), an oyster pathogen in Delaware Bay. J Invertebr Pathol, 40, 118-

141.

FORD, S. E., XU, Z. and DEBROSSE, G. (2001). Use of particle filtration and UV

irradiation to prevent infection by Haplosporidium nelsoni (MSX) and Perkinsus

marinus (Dermo) in hatchery reared larval and juvenile oysters. . Aquaculture, 194,

37-49.

FRIEDMAN, C. S. and PERKINS, F. O. (1994). Range extension of Bonamia ostrea to

Maine, USA. Journal of Invertebrate pathology, 64, 179-181.

GRIZEL, H. (Ed.) (2003). An atlas of histology and cytology of marine bivalve molluscs,

Ifremer, Plouzane France.

174 FRDC Project 2006/064 Literature Cited HAIR, J. F., ANDERSON, R. E., TATHAM, R. L. and BLACK, W. C. (1992).

Multivariate Data Analysis with Readings, Macmillan Publishing Company, New

York, USA.

HERVIO, D., BACHERE, E., BOULO, V., COCHENNEC, N., VUILLEMIN, V., LE

COGUIC, Y., CAILLETAUX, G., MAZURI, J. and MIALHE, E. (1985).

Establishment of an experimental infection protocol for the flat oyster, Ostrea

edulis, with the intrahaemocytic protozoan parasite, Bonamia ostreae: application in

the selection of parasite-resistant oysters. Aquaculture, 132, 183-194.

HINE, P. M. (1996). Southern hemisphere mollusc diseases and an overview of associated

risk assessment problems. REVUE SCIENTIFIQUE ET TECHNIQUE DE L

OFFICE INTERNATIONAL DES EPIZOOTIES, 15, 563-577.

HINE, P. M. (2000). The need for molecular tools in the study of mollusc pathogens. In

FAO Fisheries Technical Paper 395. DNA-based molecular diagnostic techniques.

Research needs for standardization and validation of the Detection of Aquatic

Animal Pathogens and Diseases., Vol. 1 (eds. Walker, P. & Subasinghe, R.), pp. 60-

63. FAO, Rome.

HINE, P. M., COCHENNEC-LAUREAU, N. and BERTHE, F. C. (2001). Bonamia

exitiosus n. sp. (Haplosporidia) infecting flat oysters Ostrea chilensis in New

Zealand. Dis Aquat Org, 47, 63-72.

HINE, P. M. and THORNE, T. (1998). Haplosporidium sp (Haplosporidia) in hatchery-

reared pearl oysters, Pinctada maxima (Jameson, 1901), in north Western Australia.

Journal of Invertebrate pathology, 71, 48-52.

HINE, P. M. and THORNE, T. (2000). A survey of some parasites and diseases of several

species of bivalve mollusc in northern Western Australia. Dis Aquat Org, 40, 67-78.

HINE, P. M. and THORNE, T. (2002). Haplosporidium sp. (Alveolata: Haplosporidia)

associated with mortalities among rock oysters Saccostrea cuccullata in north

Western Australia. Dis Aquat Org, 51, 123-133. 175 FRDC Project 2006/064 Literature Cited HUMPHREY, J. D. and NORTON, J. H. (2005). The pearl oyster Pinctada maxima. An

atlas of the functional anatomy, pathology and histopathology., Northern Territory

Department of Industry, Fisheries and Mines. Queensland Department of Primary

Industries and Fisheries. Fisheries Research and Development Corporation.

HUMPHREY, J. D., NORTON, J. H., JONES, J. B., BARTON, M. A., CONNELL, M. T.,

SHELLEY, C. C. and CREEPER, J. H. (1998). Pearl oyster (Pinctada maxima)

Aquaculture: Health survey of Northern Territory, Western Australia and

Queensland pearl oyster beds and farms. pp. 108. Fisheries Western Australia.

Northern Territory Department of Primary industry and Fisheries.

Queensland Department of Primary Industries.

Fisheries Research and Development Corporation.

JONES, J. B. (2006). Pers comm.

JONES, J. B. and CREEPER, J. H. (2006). Diseases of pearl oysters and other molluscs: A

Western Australian perspective. Journal of shellfish research, 25, 233-238.

KLEEMAN, S. N. and ADLARD, R. D. (2000). Molecular detection of Marteilia sydneyi,

pathogen of Sydney rock oysters. Diseases of aquatic organisms, 40, 137-146.

KLEEMAN, S. N., ROUX, F. L., BERTHE, F. and ADLARD, R. D. (2002). Specificity of

PCR and in situ hybridization assays designed for detection of Marteilia sydneyi

and M. refringens. Parasitology, 125, 131-141.

KUMAR, S., TAMURA, K. and NEI, M. (2004). MEGA3: integrated software for

molecular evolutionary genetic analysis and sequence alignment. Brief

Bioinformatics, 5.

LA HAYE, C. A., HOLLAND, N. D. and MCLEAN, N. (1984). Electron microscopic

study of Haplosporidium comatulae n. sp. (Phylum Ascetospora: class

Stellatosporea), A haplosporidian endoparasite of an Australian crinoid Oligometra

serripinna (Phylum Echinodermata). Protistologica, 20, 507-515.

176 FRDC Project 2006/064 Literature Cited LYNCH, S. A., ARMITAGE, D. V., COUGHLAN, J., MULCAHY, M. F. and CULLOTY,

S. C. (2007). Investigating the possilbe role of benthic macroinvertebrates and

zooplankton in the life cycle of the haplosporidian Bonamia ostreae. Experimental

parasitology, 115, 359-368.

MCGOVERN, E. R. and BURRESON, E. M. (1990). Ultrastructure of Minchinia sp.

spores from shipworms (Teredo sp.) in western North Atlantic, with a discussion of

taxonomy of the Haplosporidiidae. J Protozool, 37, 212-218.

MEDLIN, L., ELWOOD, H. J. and SOGIN, M. L. (1988). The characterization of

enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene, 71, 491-

499.

MIALHE, E., BACHERE, E., BOULO, V., CADORET, J. P., SARAIVA, J., CARRERA,

L., ROUSSEAU, C., CEDENO, V., CALDERON, J. and COLWELL, R. R. (1995).

Future of biotechnology-based control of disease in marine invertebrates. Molecular

Marine Biology and Biotechnology, 4, 275-283.

NORRIS, R. (1996). Western Australia: Shellfish Diseases. Anim Health Surveil Q, 1, 6.

OIE (2006). Manual of diagnostic tests for aquatic animals.

ORMIERES, R. (1980). Haplosporidium parisi n. sp Haplosporidie parasite de Serpula

vermicularis L. etude ultrastructure de la spore. Protistologica, 16.

ORMIERES, R. and DE PUYTORAC, P. (1968). Ultrastructure des spores de

l’haplosporidie Haplosporidium ascidiarium endoparasite du Tunicier Sydnium

elegans Giard. Academy of Sciences Paris (Ser D)

266, 1134-1136.

PAABO, S. (1990). Amplifying ancient DNA. In PCR protocols: a guide to methods and

applications (eds. Innis, M., Gelfand, D. & White, T.), pp. 159-166. Academic

press, San Diego, CA.

PERKINS, F. O. (1969). Electron microscope studies of sporulation in the oyster pathogen

Minchinia costalis (Sporozoa: Haplosporida). Journal of Parasitology, 55, 897-920. 177 FRDC Project 2006/064 Literature Cited PERKINS, F. O. (1975). Fine structure of Minchinia sp. (Haplosporida) sporulation in the

mud crab, Panopeus herbstii. Marine Fish Review, 37, 46-60.

REECE, K. S., SIDDALL, M. E., STOKES, N. A. and BURRESON, E. M. (2004).

Molecular phylogeny of the Haplosporidia based on two independent gene

sequences. Journal of Parasitology, 90, 1111-1122.

RENAULT, T., STOKES, N. A., CHOLLET, B., COCHENNEC, N., BERTHE, F.,

GERARD, A. and BURRESON, E. M. (2000). Haplosporidiosis in the Pacific

oyster Crassostrea gigas from the French Atlantic coast. Dis Aquat Org, 42, 207-

214.

SAITOU, N. and NEI, M. (1987). The Neighbour-joining Method: A new method for

reconstructing phylogenetic trees. Mol Biol Evol, 4, 406-425.

SCFH (1993). Report of AHC Sub-Committee on Fish Health. . pp. 267. Standing

Committee on Agriculture, Queenscliff, Victoria.

STOKES, N. A. and BURRESON, E. M. (2001). Differential diagnosis of mixed infections

of Haplosporidium nelsoni (MSX) and Haplosporidium costale (SSO) using DNA

probes. J Shellfish Res, 20, 207-213.

SUNILA, I., KAROLUS, J., LANG, E. P., MROCZKA, M. E. and VOLK, J. (2000).

Transmission of the haplosporidian parasite MSX Haplosporidium nelsoni to the

eastern oyster Crassostrea virginia in an upweller system. Diseases of aquatic

organisms, 42, 153-155.

TEMPLETON, A. R. (1998). Nested clade analysis of phylogeograqphic data: testing

hypothesis about gene flow and population histroy. Molecular Ecology, 7, 381-397.

TEMPLETON, A. R. (2001). Using phylogenetic analyses of gene trees to test species

status and processes. Molecular Ecology, 10, 779-791.

THOMPSON, J. D., HIGGINS, D. G. and GIBSON, T. J. (1994). CLUSTAL W:

improving the sensitivity of progressive multiple sequence alignment through

178 FRDC Project 2006/064 Literature Cited sequence weighting, position-specific gap penalties and weight matrix choice.

Nucleic Acids Res, 22.

WALIS (2006). The Western Australian Atlas. Vol. 2006 Government of Western

Australia.

ZIMMERMANN, K., PISCHINGER, K. and MANNHALTER, J. W. (1994). Nested

primer PCR detection limits of HIV-1 in the background of increasing numbers of

lysed cells. Biotechniques, 17, 18-20.

179 FRDC Project 2006/064 Appendix

Chapter 10 Appendix

10.1 Appendix 1:Intellectual Property. There is no intellectual property to report.

10.2 Appendix 2: Staff engaged on the project. The staff engaged in the project were as follows:

Principal Investigator: Philip K Nicholls Associate Professor Murdoch University Phone Email: [email protected]

Co-Investigators: Douglas Bearham PhD candidate Organisation: Murdoch University Phone: 0403 798 984 [email protected]

Brian Jones Senior Fish Pathologist Organisation: Department of Fisheries Western Australia, Fish Health Section Phone: 08 9368 3649 Email: [email protected]

Shane R Raidal Associate Professor Charles Sturt University Phone: Email: [email protected]

John Creeper Fish Pathologist Organisation: Department of Fisheries Western Australia, Fish Health Section Phone: 08 9368 3649 Email: [email protected]

Frances Stephens Fish Pathologist Organisation: Department of Fisheries Western Australia, Fish Health Section Phone: 08 9368 3649 Email: [email protected]

180 FRDC Project 2006/064 Appendix

10.3 Appendix 3:Minchinia occulta SSU rRNA sequence and position of the primers and probes used in the study.

1 aacacgtttg tactgttaaa ctgcagatgg ctcattaaaa cagttacagt ttatttgaca 61 tttgaagtaa tgcagataac cgtggtaact tagggctaat acgtgacgaa aatcctgctt 121 gcaggaggtg cttattagct taaaaccaat tgtggttgaa aaataataaa taacggatcg 181 cgttggcttt gccggcgact tgtcattaaa atttctgact tatcagctag acggtaaggt 241 attggcttac cgtggctatg acgagtaacg gggaattttg gttcgattcc ggagaggcag 301 cctgagaaac ggctaccaca tccacggaag gcagcaggtg cgcaaattgc tcaatgttga 361 ctaaacgaag cagtgaccag gcataacgag agcagctgca aagttgcgat ttggaatgag 421 aacaatgtaa aagccttatc gattaacaag cggagggcaa gtctggtgcc agcagccgcg 481 gtaataccag ctccgctagc gtatattaaa gttgttgctg ttaaaaagct cgtagttgga 541 tatcagggcg ccgcgcgatg cccagccgta tcggctgcgc gcaaggctaa cgccgccgcg 601 cggcgccctt acttcaggag catctatctg gccattgaat tggctgggtc tttggtcctg 661 atcttttact ttgagaaaat taaagtgctc aaagcaggca gccgcctgga tgcattagca 721 tggaataata agacgagact ttggcgccac gcatgtggac gttttgttgg ttttgggctg 781 aagtaatggt tgataggaac aattgggggt gctagtatcg ccgggctaga ggtaaaattc 841 tttgattccg gtgagactga cttatgcgaa agcattcacc aagtttgttt tctttaatca 901 agaactaaag ttgggggatc gaagacgatc agataccgtc gtagtcccaa ctataaacca 961 tgtcgactaa gtgttgggca agttttgctt gctcagaact ttgcgagaaa tcaaagtttt 1021 cggactcagg gggaagtatg ctcgcaagag tgaaacttaa aggaattgac ggatgggcac 1081 cacaagttgt ggagcctgcg gcttaatttg attcaacacg ggaaaccttc ccaagtccag 1141 acatagcaag gattgacaga ttcaagttct ttcttgattc tatgcatggt ggtgcatggc 1201 cgttcttagt tggtggagtg atctgtctgg ttaattccga taacgaacga gacctcagcc 1261 atctaaatag ctgtcgctaa cgcgttagcg cccgctcgcg ggctcagctt cttagaggga 1321 ccgtctgtgt ctagcagaag gaggtttgag gcaataacag gtcagtgatg cccttagatg 1381 ctctgggctg cacgcgcgct acaatgaggc acgcagcgag ttcctggctc gcgagagctg 1441 gggaatctgc aaagcgcctc aaagtgggga taggtgattg caattattca tcatgaacaa 1501 ggaatatcta gtaaacgcaa gtcatcaact tgcattgatt acgtccctgc ccattgtaca 1561 caccgcccgt cgcttctacc gattgaattg caaggtgaat tggacggatc ggccggcccg 1621 ccggtcgaga agtctcgtga atcctgtaat ttagaggaag gaaaagtcgt aacaaggttt 1681 tm

Figure 10.1 Sequence for Minchinia occulta submitted to GenBank (EF165631) with the target sequences for the probes and primers designed in the project. Green indicates target sequence for SSR66 (5’ccgcgcgatgcccagccgtat3’) primer. Red letters indicate the target sequence for the SSRDb (5’gttagccttgcgcgcagccgatacg 3’) probe. Yellow indicates target sequence for SSR69 (5’agg ccc aaa acc aac aaa acg tcc aca 3’) primer. Grey highlight indicates target sequence for the Minch F1B (5’ctcgcg ggctcagctt3’) sequence. Blue Highlight indicates the Minch R2B (5’ggcgctttgcagattccc ca3’) target sequence. Bases in orange indicate the variable bases detected in the sequence generated by the Minch F1B and Minch R2B primers.

181 FRDC Project 2006/064 Appendix

10.4 Appendix 4: Primers used to attempt to obtain a sequence from the Haplosporidium hinei infected pearl oyster samples.

Table 10.1 Primers used in the PCR reactions to attempt to obtain a sequence from the archived formalin fixed Haplosporidium hinei infected pearl oyster samples. Primer name Sequence 5’-3’ Reference HAP F1 GTT CTT TCW TGA TTC TAT GMA (Renault et al., 2000) HAP F2 GCC RTC TAA CTA GCT (Renault et al., 2000) HAP R1 CTC AWK CTT CCA TCT GCT G (Renault et al., 2000) HAP R2 GAT GAA YAA TTG CAA TCA YCT (Renault et al., 2000) HAP R3 AKR HRT TCC TWGTTC AAG AYG (Renault et al., 2000) A 18S-EUK581-F GTG CCA GCA GCC GCG (Carnegie et al., 2003) 18S-EUK1134-R TTT AAG TTT CAG CCT TGC G (Carnegie et al., 2003) 16 S AAC CTG GTT GAT CCT GCC AGT (Medlin et al., 1988) 16 S TGA TCC TTC TGC AGG TTC ACC (Medlin et al., 1988) TAC SSUF1 AAA GAT TAA GCC ATG CAA GTC This study SSUF2 GCA AGT CTA WGT ATA AAC This study ACG SSUR1 TGT TCC TAT CAA TCA TTA CTT This study SSUR2 TCC AAC TAC GAG CTT TTT AAC This study MR1 GTC TCA ATC TTC CTT CTG CTG This study MF1 CGT TAG CGC CCG CTC GCG GGC This study MR2 GAT GAA TAA TTG CAA TCA CCT This study SSUBR1 TCA CCT ACG GAA ACC TTG This study SSUBR2 CCT TGT TAC GAC TTT TCC This study SSUBF1 CCT GAT CCT TTA CTT TGA This study SSUBF2 AAG CAT TCA CCA AGT TTG This study SSUF1 AAA GAT TAA GCC ATG CAA GTC This study SSUF2 GCA AGT CTA WGT ATA AAC This study ACG SSUR1 TGT TCC TAT CAA TCA TTA CTT This study

SSUR2 TCC AAC TAC GAG CTT TTT AAC This study

182