DOCSLIB.ORG

<I>Nephroma Helveticum

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889 MYCOTAXON http://dx.doi.org/10.5248/125.263 Volume 125, pp. 263–275 July–September 2013 Study on the phylogeny of Nephroma helveticum and allied species Hai-Ying Wang1*, Dai-Feng Jiang1, Yan-Hong Huang2, Pan-Meng Wang1 & Tao Li1 1Key Laboratory of Plant Stress Research, College of Life Science, Shandong Normal University, Jinan, 250014, P. R. China 2 Food and Fermentation Engineering Key Lab of Shandong Province, Jinan 250013, P. R. China * Correspondence to: [email protected] Abstract — Nephroma subhelveticum sp. nov. is described, supported by both morphological and molecular data as a species new to science. The nrDNA ITS sequence analysis indicates that N. subhelveticum and N. flavorhizinatum are allied species of N. helveticum, and that N. isidiosum derives from N. helveticum. Key words — Asia, China, evolution, lichen, taxonomy Introduction The species of Nephroma Ach. (Nephromataceae) have middle-sized foliose thalli, cyanobacteria (sometimes green algae) as their photobionts, apothecia produced on the lower surface, 8-spored asci, commonly 3-septate ascospores, and often abundant terpenoids (James & White 1987, Burgaz & Martínez 1999, Brodo et al. 2001, Wetmore & Nash 2002, Louwhoff 2009). This genus includes 37 species worldwide (Tian et al. 2011). Both Nephroma helveticum and N. isidiosum are cosmopolitan species with terpenoids, and only these two species in the genus have isidia (Brodo et al. 2001). Nephroma helveticum has lobules and flat isidia, while N. isidiosum has true cylindrical or branched isidia (Brodo et al. 2001). Nephroma flavorhizinatum also has lobules and terpenoids (Tian et al. 2011). The similar morphological and chemical characters indicate that these three species may be closely related. Recently some morphologically similar specimens that also have terpenoids, lobules, and very crisp thalli, were found from China. The nrDNA ITS sequences generated from these Nephroma representatives have been analysed so as to establish their phylogenetic relationships. 264 ... Wang & al. Table 1. GenBank sequences of Nephroma and Lobaria included in the molecular analyses. Species Origin GenBank no. N. helveticum China, Yunnan DQ001292 Macaronesia HQ455071 USA, southwest AY124119 China, Tibet AY124120 USA, northwest AY124124 N. subhelveticum South Korea DQ066705 (recorded as N. helveticum) South Korea DQ066706 China, central AY124118 China, central AY124122 China, northeast AY124127 Russia, northwest AY124128 N. parile Canada, east AY124148 N. resupinatum South Korea DQ066710 L. macaronesica Outgroup GU072745 L. pulmonaria GU072753 L. retigera EU626996 Materials & methods Morphology & chemistry The specimens studied are preserved in SDNU (Lichen Section of Botanical Herbarium, Shandong Normal University). The morphology and anatomy of the specimens were examined using an Olympus SZX16 stereomicroscope and Olympus BX61 compound microscope; morphological characters were photographed under Olympus with DP72. Lichen substances were identified using standardized thin layer chromatography techniques (TLC) with C system (Orange et al. 2010). Molecular analyses Taxon sampling — nrDNA ITS sequences were obtained from 41 Chinese Nephroma specimens; 13 additional Nephroma sequences and outgroup sequences from three Lobaria species were downloaded from GenBank (Table 1). PCR amplification and sequencing — Total DNA was extracted by the modified CTAB method (Rogers & Bendich 1988). E9 (ttgtacacaccgcccgt), NF1R (atccgaggtcaatcgtgt), NF2R (tgatccgaggtcaatcgt), and CL2R (tttcttttcctccgcttattga) were used for PCR amplification of the nrDNA ITS as primers. PCR reaction program: initial denaturation at 95°C for 3 min, followed by 35 cycles of 30 s denaturation at 94°C, 45 s annealing at 58°C, 1 min extension at 72°C, and completed with a final 8 min extension at 72°C. Products were purified with Gel Extraction Mini Kit (SABC). Shanghai Genecore Corp. carried out the sequencing reactions. Data analysis — The sequences were aligned using MAFFT version 7 (Katoh & Standley 2013). The aligned ITS matrix was edited manually and phylogenetic analyses were conducted using MEGA 5 (Tamura et al. 2011). The phylogenetic tree was inferred using the Minimum Evolution method (Rzhetsky & Nei 1992) and tested by 1000 bootstrap replications (Felsenstein 1985). The evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al. 2004). All positions containing Nephroma subhelveticum sp. nov. (China) ... 265 alignment gaps and missing data were eliminated in pairwise sequence comparisons (Pairwise deletion option). A total of 606 positions comprised the final dataset. Morphology & chemistry Nephroma helveticum Ach., Lich. univ.: 523 (1810) Figs 1, 2 Thallus foliose, leathery. Lobes with stout lobules (0.5 × 1 mm) at margin. Upper surface brown; isidia and soredia absent; tomentum and pruina often present; lobules marginal and laminal, often branched. Upper cortex pale Figure 1. Nephroma helveticum (20080653). A: Thallus; B: Lobe with marginal lobules; C: Laminal lobules; D: Rough and tomentose dorsal surface of apothecium; E: Tomentum on lower surface; F: Apothecium immersed on lower surface. 266 ... Wang & al. brown, ca. 35 µm thick; photobiont Nostoc, ca. 65 µm thick; medulla white, with abundant crystals soluble in water, ca. 80 µm thick; lower cortex pale, ca. 30 µm thick. Lower surface brown, tomentose, paler and smooth at the margins; rhizines stubby, sparse. Apothecia common, immersed on lower surface at tips of lobes, kidney-shaped; disc dark brown, ≤7 mm in diameter; dorsal surface rough, with abundant clustered tomentum; margin usually crenulate. Epihymenium pale brown, without crystals, ca. 15 µm tall; hymenium hyaline, without crystals, ca. 40 µm tall; hypothecium pale brown, without crystals, ca. 35 µm tall. Paraphyses simple. Asci clavate, I+ blue, 8-spored; ascospores pale brown, 3-septate, 15–20 × 3–4 µm. Pycnidia not seen. Spot tests — Thallus upper surface: K–, C–, KC–, PD–; medulla: K–, C–, KC–, PD–. Secondary metabolites — N1, N2, ± other lichen substances (Fig. 3). Ecology & distribution in China— on bark or moss in Guizhou, Jilin, Shanxi, Shaanxi, Sichuan, Tibet, and Yunnan. Specimens examined — CHINA. Guizhou, Kaili, Mt. Leigong, alt. 1027 m, on bark, 2 Nov 2009, H.Y. Wang 20102726. Jilin, Wangqing, Mt. Tulaopoding, alt. 1100 m, on moss, 22 Jul 2012, H.Y. Wang 20129292. Shanxi, Ningwu, Mt. Luya, alt. 2500 m, on bark, 26 Aug 2011, H.Y. Wang 20121819A. Shaanxi, Meixian, Mt. Taibai, alt. 2100 m, on bark, 2 Aug 2005, W. Fu 20083001; 17 Jun 2011, Z.L. Huang 20114881(GenBank JX867681); alt. 2150 m, on bark, 17 Jun 2011, Z.L. Huang 20114339 (GenBank JX867682); alt. 2200 m, on bark, 2 Aug 2005, W. Fu 20080332, 20100571; alt. 2700 m, on bark, 17 Jun 2011, Z.L Huang 20114639K; alt. 2950 m, on bark, 17 Jun 2011, Z.L. Huang 20114717 (GenBank JX867703). Sichuan, Litang, alt. 4200 m, on bark, 5 Nov 2008, H.Y. Wang 20080388; Litang, Mt. Kazila, alt. 4700 m, on bark, 7 Nov 2008, H.Y. Wang 20080323, 20080354. Tibet, Nyingchi, Dongjiuxiang, alt. 2550 m, on bark, 17 Jul 2011, Y.L. Cheng 20114928, 20117991 (GenBank JX867707), 20117991A (GenBank JX867710), 20117991C (GenBank JX867713), 20118005, 20118005A, 20118005D, 20118005E, 20118005F (GenBank JX867712), 20118006B (GenBank JX867704), 20118006C (GenBank JX867683), 20118011, 20118044, 20118255A (GenBank JX867709), 20118300 (GenBank JX867705), 20118545; Mt Sejila, alt. 4100 m, on bark, 20 Oct 2007, G.Y. Han 20072907; alt. 4500 m, on bark, 20 Jul 2011, Y.L. Cheng 20118118A, 20118461, 20118729A (GenBank JX867706), 20118729E; Lulangzhen, observation station, alt. 2550 m, on bark, 14 Jul 2011, D.F. Jiang 20119099. Yunnan, Shangri-La, Tianshengqiao, alt. 3500 m, on bark, 3 Nov 2008, H.Y. Wang 20080653 (GenBank JX867708), 20081370, 20081391, 20081515, 20081715, 20081885, 20082058, 20082065, 20082181, 20082185, 20082213, 20082264, 20082270, 20082291, 20082355, 20102930, 20083063, 20083097, 20083312, 20083385, 20083861, 20086001, 20086011; Mt. Shika, alt. 4300 m, on bark, 2 Nov 2008, H.Y. Wang 20081991, 20082033, 20082218, 20083336, 20086017; Yulong, Mt. Laojun, alt. 4000 m, on bark, 6 Nov 2009, H.Y. Wang 20100564 (GenBank JX867711); 7 Nov 2009, H.Y. Wang 20090001, 20100562; Jianchuan, Mt. Shibao, alt. 2600 m, on bark, 31 Oct 2008, H.Y. Wang 20083409; Lijiang, Mt. Yulong, alt. 3200 m, on bark, 7 Nov 2009, M. Li 20102729A. Comments — Nephroma helveticum is considered to produce flat isidia (Brodo et al. 2001). However, we did not find true isidia on our specimens. The lobules of N. helveticum from China are varied (Fig. 2 I–N), sometimes very narrow and Nephroma subhelveticum sp. nov. (China) ... 267 Figure 2. Nephroma helveticum (A–H, 20080653; I, 20080323; J, 20118011; K, 20118005D; L, 20118729E; M, 20080388; N, 20100564). A: Section of thallus; B: Crystals in thallus; C: Section of apothecium; D: Crystals in apothecium; E: Ascus and ascospores; F: Iodine reaction of ascus and paraphyses; G: Paraphyses; H: Ascospores; I–N: Various laminal lobules. isidium-like but always dorsiventral. Although N. helveticum and N. isidiosum have similar secondary substances (TLC, Fig. 3), N. isidiosum can be clearly separated by its typical cylindrical to coralloid isidia and lack of apothecia. 268 ... Wang & al. Figure 3. TLC results: A: UV254 nm before acid; B: Sunlight after acid and heating; C: UV365 nm after acid and heating. Nephroma helveticum (1, 20100564; 2, 20114717; 3, 20118255A; 4, 20117991C; 5, 20118300;
Recommended publications
  • Lichen Communities for Forest Health Monitoring in Colorado

    Lichen Communities for Forest Health Monitoring in Colorado

    Lichen Communities for Forest Health Monitoring in Colorado, USA A Report to the USDA Forest Service by Bruce McCune1, Paul Rogers2, Andrea Ruchty1, and Bruce Ryan3 29 June 1998 1Department of Botany and Plant Pathology, Cordley 2082, Oregon State University, Corvallis, OR 97331-2902. Phone: 541 737 1741, fax: 541 737 3573, email: [email protected] 2USDA Forest Service, Intermountain Research Station, 507 25th St., Ogden, UT 84401 3Department of Botany, Arizona State University, Tempe, AZ 85287-1601 CONTENTS Abstract ............................................................................................................... 1 Introduction........................................................................................................... 2 Lichens in the Forest Health Monitoring Program ................................................ 2 The Lichen Community Indicator ..................................................................... 2 Previous Work on Lichen Communities in Colorado............................................. 4 Methods ............................................................................................................... 4 Field Methods .............................................................................................. 4 Data Sources ............................................................................................... 5 Data Analysis............................................................................................... 6 The Analytical Data Set.......................................................................
  • Insights Into the Ecology and Genetics of Lichens with a Cyanobacterial Photobiont

    Insights Into the Ecology and Genetics of Lichens with a Cyanobacterial Photobiont

    Insights into the Ecology and Genetics of Lichens with a Cyanobacterial Photobiont Katja Fedrowitz Faculty of Natural Resources and Agricultural Sciences Department of Ecology Uppsala Doctoral Thesis Swedish University of Agricultural Sciences Uppsala 2011 Acta Universitatis agriculturae Sueciae 2011:96 Cover: Lobaria pulmonaria, Nephroma bellum, and fallen bark in an old-growth forest in Finland with Populus tremula. Part of the tRNALeu (UAA) sequence in an alignment. (photos: K. Fedrowitz) ISSN 1652-6880 ISBN 978-91-576-7640-5 © 2011 Katja Fedrowitz, Uppsala Print: SLU Service/Repro, Uppsala 2011 Insights into the Ecology and Genetics of Lichens with a Cyanobacterial Photobiont Abstract Nature conservation requires an in-depth understanding of the ecological processes that influence species persistence in the different phases of a species life. In lichens, these phases comprise dispersal, establishment, and growth. This thesis aimed at increasing the knowledge on epiphytic cyanolichens by studying different aspects linked to these life stages, including species colonization extinction dynamics, survival and vitality of lichen transplants, and the genetic symbiont diversity in the genus Nephroma. Paper I reveals that local colonizations, stochastic, and deterministic extinctions occur in several epiphytic macrolichens. Species habitat-tracking metapopulation dynamics could partly be explained by habitat quality and size, spatial connectivity, and possibly facilitation by photobiont sharing. Simulations of species future persistence suggest stand-level extinction risk for some infrequent sexually dispersed species, especially when assuming low tree numbers and observed tree fall rates. Forestry practices influence the natural occurrence of species, and retention of trees at logging is one measure to maintain biodiversity. However, their long-term benefit for biodiversity is still discussed.
  • An Evolving Phylogenetically Based Taxonomy of Lichens and Allied Fungi

    An Evolving Phylogenetically Based Taxonomy of Lichens and Allied Fungi

    Opuscula Philolichenum, 11: 4-10. 2012. *pdf available online 3January2012 via (http://sweetgum.nybg.org/philolichenum/) An evolving phylogenetically based taxonomy of lichens and allied fungi 1 BRENDAN P. HODKINSON ABSTRACT. – A taxonomic scheme for lichens and allied fungi that synthesizes scientific knowledge from a variety of sources is presented. The system put forth here is intended both (1) to provide a skeletal outline of the lichens and allied fungi that can be used as a provisional filing and databasing scheme by lichen herbarium/data managers and (2) to announce the online presence of an official taxonomy that will define the scope of the newly formed International Committee for the Nomenclature of Lichens and Allied Fungi (ICNLAF). The online version of the taxonomy presented here will continue to evolve along with our understanding of the organisms. Additionally, the subfamily Fissurinoideae Rivas Plata, Lücking and Lumbsch is elevated to the rank of family as Fissurinaceae. KEYWORDS. – higher-level taxonomy, lichen-forming fungi, lichenized fungi, phylogeny INTRODUCTION Traditionally, lichen herbaria have been arranged alphabetically, a scheme that stands in stark contrast to the phylogenetic scheme used by nearly all vascular plant herbaria. The justification typically given for this practice is that lichen taxonomy is too unstable to establish a reasonable system of classification. However, recent leaps forward in our understanding of the higher-level classification of fungi, driven primarily by the NSF-funded Assembling the Fungal Tree of Life (AFToL) project (Lutzoni et al. 2004), have caused the taxonomy of lichen-forming and allied fungi to increase significantly in stability. This is especially true within the class Lecanoromycetes, the main group of lichen-forming fungi (Miadlikowska et al.

  • Lichens of Alaska's South Coast

    United States Department of Agriculture Lichens of Alaska’s South Coast Forest Service R10-RG-190 Alaska Region Reprint April 2014 WHAT IS A LICHEN? Lichens are specialized fungi that “farm” algae as a food source. Unlike molds, mildews, and mushrooms that parasitize or scavenge food from other organisms, the fungus of a lichen cultivates tiny algae and / or blue-green bacteria (called cyanobacteria) within the fabric of interwoven fungal threads that form the body of the lichen (or thallus). The algae and cyanobacteria produce food for themselves and for the fungus by converting carbon dioxide and water into sugars using the sun’s energy (photosynthesis). Thus, a lichen is a combination of two or sometimes three organisms living together. Perhaps the most important contribution of the fungus is to provide a protective habitat for the algae or cyanobacteria. The green or blue-green photosynthetic layer is often visible between two white fungal layers if a piece of lichen thallus is torn off. Most lichen-forming fungi cannot exist without the photosynthetic partner because they have become dependent on them for survival. But in all cases, a fungus looks quite different in the lichenized form compared to its free-living form. HOW DO LICHENS REPRODUCE? Lichens sexually reproduce with fruiting bodies of various shapes and colors that can often look like miniature mushrooms. These are called apothecia (Fig. 1) and contain spores that germinate and Figure 1. Apothecia, fruiting grow into the fungus. Each bodies fungus must find the right photosynthetic partner in order to become a lichen. Lichens reproduce asexually in several ways.
  • The Phylogeny of Plant and Animal Pathogens in the Ascomycota

    The Phylogeny of Plant and Animal Pathogens in the Ascomycota

    Physiological and Molecular Plant Pathology (2001) 59, 165±187 doi:10.1006/pmpp.2001.0355, available online at http://www.idealibrary.com on MINI-REVIEW The phylogeny of plant and animal pathogens in the Ascomycota MARY L. BERBEE* Department of Botany, University of British Columbia, 6270 University Blvd, Vancouver, BC V6T 1Z4, Canada (Accepted for publication August 2001) What makes a fungus pathogenic? In this review, phylogenetic inference is used to speculate on the evolution of plant and animal pathogens in the fungal Phylum Ascomycota. A phylogeny is presented using 297 18S ribosomal DNA sequences from GenBank and it is shown that most known plant pathogens are concentrated in four classes in the Ascomycota. Animal pathogens are also concentrated, but in two ascomycete classes that contain few, if any, plant pathogens. Rather than appearing as a constant character of a class, the ability to cause disease in plants and animals was gained and lost repeatedly. The genes that code for some traits involved in pathogenicity or virulence have been cloned and characterized, and so the evolutionary relationships of a few of the genes for enzymes and toxins known to play roles in diseases were explored. In general, these genes are too narrowly distributed and too recent in origin to explain the broad patterns of origin of pathogens. Co-evolution could potentially be part of an explanation for phylogenetic patterns of pathogenesis. Robust phylogenies not only of the fungi, but also of host plants and animals are becoming available, allowing for critical analysis of the nature of co-evolutionary warfare. Host animals, particularly human hosts have had little obvious eect on fungal evolution and most cases of fungal disease in humans appear to represent an evolutionary dead end for the fungus.
  • Kenai National Wildlife Refuge Species List, Version 2018-07-24

    Kenai National Wildlife Refuge Species List, Version 2018-07-24

    Kenai National Wildlife Refuge Species List, version 2018-07-24 Kenai National Wildlife Refuge biology staff July 24, 2018 2 Cover image: map of 16,213 georeferenced occurrence records included in the checklist. Contents Contents 3 Introduction 5 Purpose............................................................ 5 About the list......................................................... 5 Acknowledgments....................................................... 5 Native species 7 Vertebrates .......................................................... 7 Invertebrates ......................................................... 55 Vascular Plants........................................................ 91 Bryophytes ..........................................................164 Other Plants .........................................................171 Chromista...........................................................171 Fungi .............................................................173 Protozoans ..........................................................186 Non-native species 187 Vertebrates ..........................................................187 Invertebrates .........................................................187 Vascular Plants........................................................190 Extirpated species 207 Vertebrates ..........................................................207 Vascular Plants........................................................207 Change log 211 References 213 Index 215 3 Introduction Purpose to avoid implying
  • Lichens of East Limestone Island

    Lichens of East Limestone Island

    Lichens of East Limestone Island Stu Crawford, May 2012 Platismatia Crumpled, messy-looking foliose lichens. This is a small genus, but the Pacific Northwest is a center of diversity for this genus. Out of the six species of Platismatia in North America, five are from the Pacific Northwest, and four are found in Haida Gwaii, all of which are on Limestone Island. Platismatia glauca (Ragbag lichen) This is the most common species of Platismatia, and is the only species that is widespread. In many areas, it is the most abundant lichen. Oddly, it is not the most abundant Platismatia on Limestone Island. It has soredia or isidia along the edges of its lobes, but not on the upper surface like P. norvegica. It also isn’t wrinkled like P. norvegica or P. lacunose. Platismatia norvegica It has large ridges or wrinkles on its surface. These ridges are covered in soredia or isidia, particularly close to the edges of the lobes. In the interior, it is restricted to old growth forests. It is less fussy in coastal rainforests, and really seems to like Limestone Island, where it is the most abundant Platismatia. Platismatia lacunosa (wrinkled rag lichen) This species also has large wrinkles on its surface, like P. norvegica. However, it doesn’t have soredia or isidia on top of these ridges. Instead, it has tiny black dots along the edges of its lobes which produce spores. It is also usually whiter than P. lacunosa. It is less common on Limestone Island. Platismatia herrei (tattered rag lichen) This species looks like P.
  • A Multigene Phylogenetic Synthesis for the Class Lecanoromycetes (Ascomycota): 1307 Fungi Representing 1139 Infrageneric Taxa, 317 Genera and 66 Families

    A Multigene Phylogenetic Synthesis for the Class Lecanoromycetes (Ascomycota): 1307 Fungi Representing 1139 Infrageneric Taxa, 317 Genera and 66 Families

    A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families Miadlikowska, J., Kauff, F., Högnabba, F., Oliver, J. C., Molnár, K., Fraker, E., ... & Stenroos, S. (2014). A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families. Molecular Phylogenetics and Evolution, 79, 132-168. doi:10.1016/j.ympev.2014.04.003 10.1016/j.ympev.2014.04.003 Elsevier Version of Record http://cdss.library.oregonstate.edu/sa-termsofuse Molecular Phylogenetics and Evolution 79 (2014) 132–168 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A multigene phylogenetic synthesis for the class Lecanoromycetes (Ascomycota): 1307 fungi representing 1139 infrageneric taxa, 317 genera and 66 families ⇑ Jolanta Miadlikowska a, , Frank Kauff b,1, Filip Högnabba c, Jeffrey C. Oliver d,2, Katalin Molnár a,3, Emily Fraker a,4, Ester Gaya a,5, Josef Hafellner e, Valérie Hofstetter a,6, Cécile Gueidan a,7, Mónica A.G. Otálora a,8, Brendan Hodkinson a,9, Martin Kukwa f, Robert Lücking g, Curtis Björk h, Harrie J.M. Sipman i, Ana Rosa Burgaz j, Arne Thell k, Alfredo Passo l, Leena Myllys c, Trevor Goward h, Samantha Fernández-Brime m, Geir Hestmark n, James Lendemer o, H. Thorsten Lumbsch g, Michaela Schmull p, Conrad L. Schoch q, Emmanuël Sérusiaux r, David R. Maddison s, A. Elizabeth Arnold t, François Lutzoni a,10,
  • Piedmont Lichen Inventory

    Piedmont Lichen Inventory

    PIEDMONT LICHEN INVENTORY: BUILDING A LICHEN BIODIVERSITY BASELINE FOR THE PIEDMONT ECOREGION OF NORTH CAROLINA, USA By Gary B. Perlmutter B.S. Zoology, Humboldt State University, Arcata, CA 1991 A Thesis Submitted to the Staff of The North Carolina Botanical Garden University of North Carolina at Chapel Hill Advisor: Dr. Johnny Randall As Partial Fulfilment of the Requirements For the Certificate in Native Plant Studies 15 May 2009 Perlmutter – Piedmont Lichen Inventory Page 2 This Final Project, whose results are reported herein with sections also published in the scientific literature, is dedicated to Daniel G. Perlmutter, who urged that I return to academia. And to Theresa, Nichole and Dakota, for putting up with my passion in lichenology, which brought them from southern California to the Traingle of North Carolina. TABLE OF CONTENTS Introduction……………………………………………………………………………………….4 Chapter I: The North Carolina Lichen Checklist…………………………………………………7 Chapter II: Herbarium Surveys and Initiation of a New Lichen Collection in the University of North Carolina Herbarium (NCU)………………………………………………………..9 Chapter III: Preparatory Field Surveys I: Battle Park and Rock Cliff Farm……………………13 Chapter IV: Preparatory Field Surveys II: State Park Forays…………………………………..17 Chapter V: Lichen Biota of Mason Farm Biological Reserve………………………………….19 Chapter VI: Additional Piedmont Lichen Surveys: Uwharrie Mountains…………………...…22 Chapter VII: A Revised Lichen Inventory of North Carolina Piedmont …..…………………...23 Acknowledgements……………………………………………………………………………..72 Appendices………………………………………………………………………………….…..73 Perlmutter – Piedmont Lichen Inventory Page 4 INTRODUCTION Lichens are composite organisms, consisting of a fungus (the mycobiont) and a photosynthesising alga and/or cyanobacterium (the photobiont), which together make a life form that is distinct from either partner in isolation (Brodo et al.
  • Me LBCHEN GENUS Nephromé EN NORTH and MIDDLE AMERICA

    Me LBCHEN GENUS Nephromé EN NORTH and MIDDLE AMERICA

    me LBCHEN GENUS NEPHROMé EN NORTH AND MIDDLE AMERICA Thom 50? NW Degree of M. S. MICHIGAI‘Q STATE UNIVERSITY Clifford Major Wetmore 1959 . , . ‘ 231:: A.“ 1. [B R .4 R Y I‘w‘likhiftin 9mm Unhxcrsity A A. THE LICHEN GENUS giggtggm IN NORTH AND MIDDLE AMERICA by Clifford Major Wetmore AN ABSTRACT Submitted to the College of Science and Arts of Michigan State University of Agriculture and Applied Science in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Department of Botany and Plant Pathology 1959 Approved zazz:;L ‘é"_cézv"¢:;;“:? ABSTRACT This revision is based on a morphological, anatomical, and chemical study of 1,918 Specimens from twenty—one herbaria, as well as field work in Isle Royals National Park (Michigan), Haiti, and the Dominican Republic. The morphological and anatomical features are discussed in detail and twenty—nine original figures are included. The protuberances on the lower surface of g, resupiggfigg (L.) Ach. are corticate and, therefore, not true pseudo-eyphellae as often recorded in the literature. Eight lichen substances have been found in the genus: usnic acid, nephromin, zeorin, nephrin, and four unidentified neutral substances. These substances have taxonomic importance, although other workers in related genera have ignored them. The genus is placed in the Nephromaceae instead of the Peltigeraceae, where usually classified, because of the differences in ascus structure and development, conidial pros duction and the presence of a lower cortex in Neohroma, Seven species and two subspecies are recognized and a key for their identification is included along with a diagnosis, nomenclatural notes, and a distribution map for each species, Gyelnik's four new species and two new infraspecific taxa from North America are reduced to synonymy.
  • Lichens of Alaska

    Lichens of Alaska

    A Genus Key To The LICHENS OF ALASKA By Linda Hasselbach and Peter Neitlich January 1998 National Park Service Gates of the Arctic National Park and Preserve 201 First Avenue Fairbanks, AK 99701 ACKNOWLEDGMENTS We would like to acknowledge the following Individuals for their kind assistance: Jim Riley generously provided lichen photographs, with the exception of three copyrighted photos, Alectoria sarmentosa, Peltigera neopolydactyla and P. membranaceae, which are courtesy of Steve and Sylvia Sharnoff, and Neph­ roma arctica by Shelli Swanson. The line drawing on the cover, as well as those for Psoroma hypnarum and the 'lung-like' illustration, are the work of Alexander Mikulin as found In Lichens of Southeastern Alaska by Gelser, Dillman, Derr, and Stensvold. 'Cyphellae' and 'pseudocyphellae' are also by Alexander Mikulin as appear In Macrolichens of the Pacific Northwest by McCune and Gelser. The Cladonia apothecia drawing is the work of Bruce McCune from Macrolichens of the Northern Rocky Mountains by McCune and Goward. Drawings of Brodoa oroarcttca, Physcia aipolia apothecia, and Peltigera veins are the work of Trevor Goward as found in The Lichens of British Columbia. Part I - Foliose and Squamulose Species by Goward, McCune and Meldlnger. And the drawings of Masonhalea and Cetraria ericitorum are the work of Bethia Brehmer as found In Thomson's American Arctic Macrolichens. All photographs and line drawings were used by permission. Chiska Derr, Walter Neitlich, Roger Rosentreter, Thetus Smith, and Shelli Swanson provided valuable editing and draft comments. Thanks to Patty Rost and the staff of Gates of the Arctic National Park and Preserve for making this project possible.
  • Cyanobacteria Produce a High Variety of Hepatotoxic Peptides in Lichen Symbiosis

    Cyanobacteria Produce a High Variety of Hepatotoxic Peptides in Lichen Symbiosis

    Cyanobacteria produce a high variety of hepatotoxic peptides in lichen symbiosis Ulla Kaasalainena,1, David P. Fewerb, Jouni Jokelab, Matti Wahlstenb, Kaarina Sivonenb, and Jouko Rikkinena aDepartment of Biosciences and bDepartment of Food and Environmental Sciences, Division of Microbiology, University of Helsinki, FIN-00014, Helsinki, Finland Edited by Robert Haselkorn, University of Chicago, Chicago, IL, and approved February 28, 2012 (received for review January 6, 2012) Lichens are symbiotic associations between fungi and photosyn- freshwater ecosystems. We have previously shown that the Nostoc thetic algae or cyanobacteria. Microcystins are potent toxins that symbionts of the tripartite cyanolichen species Peltigera leuco- are responsible for the poisoning of both humans and animals. phlebia can produce hepatotoxic microcystins in lichen symbiosis These toxins are mainly associated with aquatic cyanobacterial (11). However, it was unclear whether the production of these blooms, but here we show that the cyanobacterial symbionts of potent hepatotoxins in lichen symbiosis is a frequent phenome- terrestrial lichens from all over the world commonly produce non. Here we report that microcystins and nodularins are pro- microcystins. We screened 803 lichen specimens from five different duced in many different cyanolichen lineages and climatic regions continents for cyanobacterial toxins by amplifying a part of the all over the world. gene cluster encoding the enzyme complex responsible for micro- cystin production and detecting toxins directly from lichen thalli. We Results found either the biosynthetic genes for making microcystins or the A total of 803 lichen thalli representing 23 different cyanolichen toxin itself in 12% of all analyzed lichen specimens. A plethora of genera from different parts of the world were analyzed (Fig.