Association of Interleukin-10 Cluster Genes and Salmonella Response in the Chicken

Animal Science Publications Animal Science

1-1-2008

S. B. Ghebremicael Iowa State University

J. Hasenstein Iowa State University

Susan J. Lamont Iowa State University, [email protected]

Follow this and additional works at: https://lib.dr.iastate.edu/ans_pubs

Part of the Agriculture Commons, Genetics Commons, and the Poultry or Avian Science Commons

The complete bibliographic information for this item can be found at https://lib.dr.iastate.edu/ ans_pubs/607. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html.

This Article is brought to you for free and open access by the Animal Science at Iowa State University Digital Repository. It has been accepted for inclusion in Animal Science Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Association of Interleukin-10 Cluster Genes and Salmonella Response in the Chicken

Abstract Salmonella enteritidis lipopolysaccharide stimulates interleukin 10 (IL10) gene expression in chickens. Four genes in the IL10 cluster [polymeric immunoglobulin receptor (PIGR), interleukin 10 (IL10), map kinase-activated protein kinase 2 (MAPKAPK2), and ligatin (LGTN)] plus dual-specificity tyrosine-(Y)- phosphorylation regulated kinase1A (DYRK1A) were investigated using the F8 generation of 2 related advanced intercross lines (AIL). The AIL were generated by crossing outbred broilers with dams of 2 highly inbred lines (Leghorn and Fayoumi). Intercrossing continued within the 2 dam lines. The F8 chicks (n = 132) were intraesophageally inoculated at 1 d with S. enteritidis. At d 7 or 8, both spleen tissue and cecal contents were cultured to quantify S. enteritidis load. The F8 population was genotyped for one single nucleotide polymorphism (SNP) per gene by using a multiplexed SNaPshot assay. Association of gene SNP with S. enteritidis bacterial burden was analyzed by the GLM. The MAPKAPK2 and IL10 genes were highly (P < 0.001) associated with S. enteritidis burden in spleen tissue and cecal luminal content. Suggestive associations (P < 0.05) of PIGR with spleen tissue and cecal content were found. The results suggest that SNP in MAPKAPK2 and IL10 were strongly associated with Salmonella burden and may be valuable in generating resistant birds by marker-assisted selection.

Keywords lipopolysaccharide, interleukin-10 cluster genes, Salmonella, advanced intercross line, single nucleotide polymorphism

Disciplines Agriculture | Animal Sciences | Genetics | Poultry or Avian Science

Comments This article is published as Ghebremicael, S. B., J. R. Hasenstein, and S. J. Lamont. "Association of interleukin-10 cluster genes and Salmonella response in the chicken." Poultry Science 87, no. 1 (2008): 22-26. DOI: 10.3382/ps.2007-00259. Posted with permission.

This article is available at Iowa State University Digital Repository: https://lib.dr.iastate.edu/ans_pubs/607 GENETICS Research Note

Association of Interleukin-10 Cluster Genes and Salmonella Response in the Chicken

S. B. Ghebremicael, J. R. Hasenstein, and S. J. Lamont

Department of Animal Science, Iowa State University, Ames 50011

ABSTRACT Salmonella enteritidis lipopolysaccharide and cecal contents were cultured to quantify S. enteritidis stimulates interleukin 10 (IL10) gene expression in chick- load. The F8 population was genotyped for one single ens. Four genes in the IL10 cluster [polymeric immuno- nucleotide polymorphism (SNP) per gene by using a mul- globulin receptor (PIGR), interleukin 10 (IL10), map ki- tiplexed SNaPshot assay. Association of gene SNP with nase-activated protein kinase 2 (MAPKAPK2), and ligatin S. enteritidis bacterial burden was analyzed by the GLM. (LGTN)] plus dual-speciﬁcity tyrosine-(Y)-phosphoryla- The MAPKAPK2 and IL10 genes were highly (P < 0.001) tion regulated kinase1A (DYRK1A) were investigated us- associated with S. enteritidis burden in spleen tissue and < ing the F8 generation of 2 related advanced intercross cecal luminal content. Suggestive associations (P 0.05) lines (AIL). The AIL were generated by crossing outbred of PIGR with spleen tissue and cecal content were found. broilers with dams of 2 highly inbred lines (Leghorn and The results suggest that SNP in MAPKAPK2 and IL10 Fayoumi). Intercrossing continued within the 2 dam lines. were strongly associated with Salmonella burden and may The F8 chicks (n = 132) were intraesophageally inoculated be valuable in generating resistant birds by marker-as- at 1 d with S. enteritidis. At d 7 or 8, both spleen tissue sisted selection. Key words: lipopolysaccharide, interleukin-10 cluster genes, Salmonella, advanced intercross line, single nucleotide polymorphism 2008 Poultry Science 87:22–26 doi:10.3382/ps.2007-00259

INTRODUCTION competitive exclusion and vaccination. The use of antibiotics in domestic livestock has been questioned due to the Salmonella contamination of poultry meat and eggs con- possible creation of antibiotic-resistant bacteria and the tinues to be a global threat to public health (Barrow and possibility of antibiotic residues being consumed by hu- Duchet-Suchaux, 1997). Salmonella enteritidis is an enteric mans (White et al., 2001). bacterium that is a zoonotic intracellular pathogen of poul- Host genetic factors clearly influence the epidemiology try and humans as well as other species (McIlroy et al., of S. enteritidis infection in chickens. Newer strategies to 1989). Salmonella enteritidis is a major cause of human increase the overall level of resistance at flock and popula- foodborne illness and is the most frequent serovar detected tion levels that use selective breeding programs to enhance in outbreaks of human salmonellosis (Lu et al., 1999). In natural resistance are expected to contribute significantly the United States, an estimated 500,000 cases of human in this regard (van der Zjipp, 1983; Warner et al., 1987; illness are annually attributed to S. enteritidis due to con- Womack, 1988). In recent years, much progress on the taminated food products (Schlosser and Ebel, 1998). In the identification and characterization of candidate genes, mi- advent of S. enteritidis infection, some animals die, but crosatellite markers, and comparative gene mapping has others can host the bacteria for several weeks or months been made. Identification of individual candidate genes without presenting any particular symptoms. These that control natural resistance and the actions of these healthy carriers are therefore an obstacle to the eradication genes will greatly expand our knowledge of genetic resistance to bacterial diseases and the possibilities for practical of S. enteritidis and are responsible for the transmission application. A candidate gene is usually chosen, based to humans. Different prophylactic measures to control S. on its biological or physiological functions, to study the enteritidis infection in poultry have been studied, including association between its genetic polymorphisms and traits of interest (Rothschild and Soller, 1997). Once a candidate gene is identified and proven, causative mutations (func- © 2008 Poultry Science Association Inc. tional markers) or polymorphic markers (direct markers) Received June 21, 2007. Accepted September 27, 2007. near or within the gene sequence can be developed for 1Corresponding author: [email protected] marker-assisted selection to improve immunity.

22 RESEARCH NOTE 23

The ability to respond to S. enteritidis infections is age- lines (Leghorn and Fayoumi; Zhou and Lamont, 1999). dependent in poultry. In young chickens, salmonellosis is Further intercrossing of F1 birds within the 2 granddam a major disease characterized by severe clinical signs of lines yielded the F8 birds. The genetic distance between diarrhea and dehydration with high mortality rates. In the parental lines maximized the feasibility of finding mo- adult chickens, it does not cause significant disease or lecular genetic polymorphism, and the inbred nature of mortality, and birds can carry the bacteria for several the founder dams meant that they consistently contributed weeks without presenting any clinical signs, which consti- the same allele to all offspring. To ensure that the maternal tutes a risk for public health (Wigley et al., 2002). The immune status of all hens producing the chicks was equiv- heritability estimates of S. enteritidis range from 0.13 to alent and would not interfere with testing their chicks for 0.53 for frequency in internal organs of challenged adult Salmonella response, all hens were kept under the same layers (Beaumont et al., 1999), 0.20 in chickens inoculated biosecure management conditions. Chicks were tested for at 1 wk of age, 0.38 in hens inoculated at the peak of lay Salmonella before challenge. The chicks were equally di- (Berthelot et al., 1998; Beaumont et al., 1999), and 0.10 for vided with regard to genetic line and sex into 3 biosafety- spleen infection using 13-d-old chicks (Girard-Santosuosso level-2 animal rooms. et al., 2002). These estimated heritabilities suggest that resistant populations could be developed through selection Salmonella Pathogenic Challenge for a lower level of contamination of spleen and cecum. and Quantification of Bacterial Load Over the past 10 yr numerous candidate gene studies have

found allelic variation to affect the immune response to S. The F8 chicks (n = 132) were intraeseophageally inocu- enteritidis in poultry (Hu et al., 1997; Cotter et al., 1998; lated at 1 d of age with S. enteritidis phage type 13a via Mariani et al., 2001; Lamont et al., 2002). syringe equipped with an infusion teat (Kaiser et al., 2002). Salmonella enteritidis has lipopolysaccharide (LPS)asa Each chick received an inoculation dose of 1 × 104 cfu/ major component of the outer membrane. Lipopolysaccha- chick in Luria broth (Qbiogene, Irvine, CA). Chicks were ride is a major trigger of inflammation and pathology monitored twice daily for clinical expression of the disease. caused by a variety of neuroendocrine and immunological Birds that survived tod7or8were euthanized, and the changes that activate different hematopoietic and nonhe- spleen and cecal contents were cultured for quantification matopoietic cells (MacKay and Lester, 1992; Nakamura et of S. enteritidis load. Spleens were cultured at a ratio of al., 1998). In recent years, many studies on the effects of 1:10 (spleen:medium; wt/vol), and cecal contents were LPS on chickens have been reported using different in vivo collected by wiping a 2.5-cm section of the lower cecum and in vitro parameters. Those studies suggest that birds with a sterile swab and placing the swab into 10 mL of show patterns of response to endotoxins (such as LPS) selenite enrichment broth (Difco, Detroit, MI). After 24 h similar to mammals (Miller and Qureshi, 1992; Zhang et of enrichment at 37°C, the cultures were held for 24 h at al., 1995; Koh et al., 1996). A study by Xie et al. (2000) 4°C and then serially diluted on brilliant green agar plates on S. typhimurium LPS showed that the LPS produced (Fisher Scientific, Pittsburgh, PA). Colonies were counted inflammatory responses in chickens characterized by an after 24 h at 37°C (Kaiser and Lamont, 2001). elevation in cloacal temperature, feed avoidance, loss of body weight, an increase in liver weight, the elevation of DNA Isolation, PCR, and Sequencing heterophil counts, an increase in plasma levels of interleukin 6, and selective changes in the concentrations of certain Genomic DNA was isolated from blood using the Gentra plasma proteins, notably a 65-kDa protein band. Xie et al. Puregene Kit (Gentra System, Plymouth, MN). Sequence (2000) also demonstrated that LPS stimulated interleukin information of the 5 genes was retrieved from UCSC 10 (IL10) gene expression in chickens. In the present study, Chicken genome browser database (http://genome.uc- genes in the IL10 cluster [polymeric immunoglobulin re- sc.edu/cgi-bin/hgGateway). Primers were designed, 2 for ceptor (PIGR), IL10, map kinase-activated protein kinase each gene, using the Primer3 program (Rozen and Skalet- 2(MAPKAPK2), and ligatin (LGTN)] and dual-specificity sky, 1998; Table 1). The PCR mixture contained 5 ng of tyrosine-(Y)-phosphorylation regulated kinase1A genomic DNA, 1 unit of Taq polymerase (Promega, Madi- ␮ (DYRK1A) were used to identify single nucleotide poly- son, WI), 1.5 mM MgCl2, 200 M deoxyribonucleotide morphisms (SNP) associated with response to S. enteritidis triphosphates (dNTP), and 50 pmol of each primer in a ␮ challenge in F8 advanced intercross lines (AIL) of chickens. total volume of 25 L. The amplification went through 30 cycles as follows: 94°C denaturation, 45°C annealing, MATERIALS AND METHODS touch-down annealing from 58.5 to 59.3°C for 30 s, and extension at 72°C for 35 s; repeated for 34 cycles. The PCR Experimental Birds primers and dNTP were removed before sequencing: 10 ␮L of PCR product was incubated with 2 ␮L of ExoSAP- The F8 generation of 2 related AIL of the Iowa Salmonella IT (Amersham Pharmacia, Cleveland, OH) for 45 min at Response Resource Population (ISRRP) was used (Ha- 37°C, followed by 20 min at 80°C for enzyme inactivation senstein and Lamont, 2007). The F1 generation of this popu- and purification. Three birds per AIL (6 birds total, 12 lation was generated by crossing outbred broilers (Kaiser sequences per gene) were analyzed to detect potential SNP. and Lamont, 2002) with dams of 2 unrelated, highly inbred Sequencing of the purified PCR products was done on an 24 GHEBREMICAEL ET AL.

′ Table 2. Associations (P-values) between single nucleotide polymorphism and Salmonella enteritidis count in spleen and cecal content of F8 advanced intercross lines (broiler × Fayoumi and broiler × Leghorn combined)

Tissue measured for bacterial load ′ Gene1 Spleen Cecum

PIGR 0.0265 0.0377 IL10 0.0006 0.0004 ′ MAPKAPK2 0.0002 0.0004 LGTN 0.344 0.314 = map kinase-activated protein DYRK1A 0.23 0.279

1PIGR = polymeric immunoglobulin receptor; IL10 = interleukin 10; MAPKAPK2 = map kinase-activated protein kinase 2; LGTN = ligatin; DYRK1A = dual-speciﬁcity tyrosine-(Y)-phosphorylation regulated ki-

MAPKAPK2 nase1A.

4 ABI Prism 3100 sequencer (Applied Biosystems, Foster City, CA) at the Nucleic Acid Facility, Iowa State Univer- sity, Ames. Sequencher Version 4.5 (Gene Cooles Corpora- tion, Ann Arbor, MI) and Bioedit software (Ibis Biosciences, Carlsbad, CA) were used to assemble the sequences and identify polymorphisms within the selected genes. One SNP per gene was selected, and single-base-pair (SBP) extension primers were designed for the selected SNP us- AGCAGTTCCACCCCCTC 3 ′ CCCCCCCCCCCCCCCCCCCCCCCACAGAGCAGCACGGAGC 3 CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTGAGGAAGAACTTGTTTATG 3 TTTTTTTCAACCCCCTGCTATGTGC 3 ′ ing Oligo5 software (Molecular Biology Insights Inc., Cas- Single base extension primers 5 ′ 5 ′ 5 ′ 5 ′ 5 ′ CCCCCCCCCCCCCCACAAGTAAAATCCAGTCCCT 3 cade, CO), and a unique oligonucleotide tag (such as poly T and C) was added to the 5′end of the primer to vary the size of each product for ease of genotyping all genes at one time (Table 1). The predicted temperature for the binding region of each extension primer (excluding the T/C tail) was designed with an average of 50 to 60°C.

Genotyping = dual-speciﬁcity tyrosine-(Y)-phosphorylation regulated kinase1A;

3 The F8 population was genotyped for 1 SNP per gene by using the Multiplexed SNaPshot assay (Applied Biosys- tems, Foster City, CA). For multiplexing of PCR, 2.5 ␮L DYRK1A of each PCR product of the 5 genes was pooled and puriﬁed by treating with 2 ␮L of ExoSAP-IT (USB Corporation, GTGCAAACACTTCCCCCTAA 3 ′ TTTGTGCAAATGGAGAACGA 3 ′ TGGAGCCTTAAATCCCACTG 3 ′ TAATGCAAGCCTCATTGTGC 3 ′ GGACAGATGGTGTTGCCTTT 3 ′ ACAGGGGTTGAAAGGGACTT 3 ′ CAGTGATGGGAGTGTTGGTG 3 ′ CACTGTGGCCTCCCAGTATT 3 ′ CCAGCAGGGCTATAATGGAA 3 ′ GTCTTTGGGGTTGCAAGAAA 3 ′ Primer sequence 5 ′ 5 ′ 5 ′ 5 ′ 5 ′ 5 ′ 5 ′ 5 ′ 5 ′ Cleveland, OH). The SNaPshot reaction was carried out with 1.5 ␮L of the puriﬁed PCR product, 0.5 ␮L of the 5 ␮ pooled SBP extension primers, 0.5 LofH2O, and 2.5 = interleukin 10; ␮L of SNaPshot Multiplex Ready Reaction Mix (Applied

2 ␮

IL10 Biosystems) in a total reaction volume of 5 L. The SNaP- 416 491 412 410 size shot reaction was run on the thermal cycler for 10 s at Product 90°C, followed by 5 s at 50°C, and 30 s at 60°C, and was repeated 25 times. To purify the unincorporated ddNTP, the post-SNaPshot reactions were incubated with 0.5 ␮L of shrimp alkaline phosphatase (Promega) for 1 h at 37°C and for 15 min at 72°C. The postextension samples were analyzed on an ABI Prism 3100 sequencer at the Nucleic Accession number AF303371 467 5 ′ AJ621254 AJ459381 NM_032960 AJ719434 Acid Facility, Iowa State University, Ames, and were genotyped using Genescan software (Perkin Elmer Biosystems,

= ligatin. Foster City, CA). LGTN = polymeric immunoglobulin receptor; Primer pair and single base pair extension primers of the 5 candidate genes analyzed Statistical Analysis 1

PIGR The product size (bp) amplifiedPrimers by designed the to primer amplify pairs. theSingle selected base gene pair region. extension primers designed for the selected single nucleotide polymorphism per gene. Statistical tests for associations of SNP with spleen and 1 2 3 4 Gene Table 1. PIGR kinase 2; IL10 DYRK1A MAPKAPK2 LGTN cecal content S. enteritidis burden were analyzed by AN- RESEARCH NOTE 25 OVA by using the JMP software (SAS Institute, 2000). Each DYRK1A gene plays a significant role in a signaling path- of the 5 SNP was independently tested for association with way that regulates cell proliferation (Shindoh et al., 1996). the phenotype, fitting the GLM to the data. Main effects An increasing amount of evidence indicates the im- included SNP, line, sex, and BW as fixed effects, and sire, portant impact of genetics on modulating the immune hatch day, and room as random effects. response in poultry (Lamont, 1998). By using genetic ap- The model was proaches to improve the innate immune systems and mini- mize the need for use of vaccines or antibiotics, it might ␮ Yijklmnop = + Genotypei + Linej + Sexk be possible to reduce S. enteritidis contamination in poultry without the hazards of antibody-resistant bacteria or resi- + β(BW)l + Sire[Line]jm + Roomo + Hatchp due consumption for humans. This study identifies associ- × + (Room Hatch)op +eijklmnop ations of polymorphisms in genes in the IL10 region and response to S. enteritidis challenge in chickens. The polymorphism of each gene was in the noncoding sequence of where Yijklmnop was the response variable (individual birds’ spleen and cecum bacterial count expressed as natural the gene, suggesting that the associations were because of ␮ linkage of the SNP to other functional polymorphisms in logarithms); was the mean; Genotypei was the fixed effect of the ith SNP genotype; Line was fixed effect of the same gene or nearby genes. The SNP, however, serve j as useful markers for positional cloning of causal genes the jth line; Sexk was the fixed effect of the kth sex; β(BW)l was the lth Bw as a fixed effect covariate; Sire[Line] was and for marker-assisted selection. jm MAPKAPK2 IL10 the random effect of the mth sire in the jth line; Room In conclusion, the SNP in and genes o were strongly associated with bacterial burden of spleen was the random effect of the oth room; Hatch was the p and cecal content after exposure to pathogenic S. enteritidis. random effect of the pth hatch; (Room × Hatch) was the op Use of these SNP in marker-assisted selection may enhance interaction effect of the oth room and the pth hatch; and disease resistance. The current study illustrated the efficacy e was the residual error term. ijklmnop of using genes of biological function defined in other species to identify candidate genes in chicken. RESULTS AND DISCUSSION ACKNOWLEDGMENTS Unique SNP were analyzed in the current study for 3 of the genes studied (DYRK1A, LGTN, and PIGR), whereas This journal paper of the Iowa Agriculture and Home the SNP analyzed in IL10 and MAPKAPK2 were reported Economics Experiment Station (Ames, Iowa) was sup- previously (Wong et al., 2004). The discovery of new SNP ported by Animal Health, Hatch Act, State of Iowa and was possible because the current population utilized a Iowa State University Center for Integrated Animal Geno- different breed (Fayoumi) from those used to identify the mics Funds; National Research Initiative Grant no. 2004- SNP in the Beijing Genomic Institute study (Wong et al., 35205-14234 from the USDA Cooperative State Research, 2004). Education, and Extension Service; and Research Grant US- There was generally no line effect; therefore, results are 3408-03 from BARD, the Binational Agriculture Research presented (Table 2) for analysis of the combined data of and Development fund. the 2 AIL. Because 5 genes were tested, a P-value < 0.01 was considered significant, and P < 0.05 suggestive. The REFERENCES MAPKAPK2 SNP showed a highly significant association with both spleen (P = 0.0002) and cecal content (P = 0.0004) Barrow, P. A., and M. Duchet-Suchaux. 1997. Salmonella carriage of S. enteriditis. There was a highly significant association and the carrier state. Pages 241–250 in Salmonella and Salmo- nellosis, ’97 Proceedings. Zoopoˆle, Ploufragan, France. of the IL10 SNP with spleen tissue (P = 0.0006) and cecal Beaumont, C., J. Protais, J. F. Guillot, P. Collin, K. Proux, N. content (P = 0.0004). The PIGR SNP showed a suggestive Millet, and P. Pardon. 1999. Genetic resistance to mortality of association with spleen tissue (P = 0.0265) and cecal content day-old chicks and carrier state of hens after inoculation with (P = 0.0377). Although the DYRK1A SNP was not associ- Salmonella enteritidis. Avian Pathol. 28:131–135. ated with bacterial burden in the combined-line analysis, Berthelot, F., C. Beaumont, F. Mompart, O. Girard Santosuosso, × P. Pardon, and M. Duchet Suchaux. 1998. Estimated heritabil- in the broiler Fayoumi AIL it was suggestively associated ity of the resistance to cecal carrier state of Salmonella enteritidis with both spleen (P = 0.036) and cecal content (P = 0.027; in chickens. Poult. Sci. 77:797–801. data not shown). No association of LGTN and bacterial Beyaert, R., A. Cuenda, W. Vanden Bergh, S. Plaisance, J. C. Lee, burden was observed. G. Haegeman, P. Cohen, and W. Fiers. 1996. The p38/RK mitogen-activated protein kinase pathway regulates interleu- The MAPKAPK2 gene is involved in many cellular pro- kin-6 synthesis response to tumor necrosis factor. EMBO J. cesses including stress, inflammatory responses, nuclear 15:1914–1923. export, gene expression regulation, and cell proliferation Cotter, P. F., R. L. Taylor, and H. Abplanalp. 1998. B-complex (Beyaert et al., 1996; Kotlyarov et al., 1999; Meng et al., associated immunity to Salmonella enteritidis challenge in con- 2002; Schindler et al., 2002). Interleukin 10 is a cytokine genic chickens. Poult. Sci. 77:1846–1851. Flynn, J. L., and J. Chan. 2001. Immunology of tuberculosis. Annu. with potent antiinflammatory and immunoregulatory ac- Rev. Immunol. 19:93–129. tivities and is produced primarily by monocytes and to a Girard-Santosuosso, O., F. Lantier, I. Lantier, N. Bumstead, J. M. lesser extent by lymphocytes (Flynn and Chan, 2001). The Elsen, and C. Beaumont. 2002. Heritability of susceptibility to 26 GHEBREMICAEL ET AL. Salmonella enteritidis infection in fowls and test of the role of Rozen, S., and H. J. Skaletsky. 1998. Primer 3. http:// the chromosome carrying the NRAMP1 gene. Genet. Sel. Evol. primer3.sourceforge.net/ Accessed Nov. 15, 2006. 34:211–219. SAS Institute. 2000. JMP Statistics and Graphics Guide. Version Hasenstein, J. R., and S. J. Lamont. 2007. Chicken gallinacin gene 4.0.2. SAS Inst. Inc., Cary, NC. cluster associated with Salmonella response in advanced in- Schindler, J. F., A. Godbey, W. F. Hood, S. L. Bolten, R. M. tercross line. Avian Dis. 51:561–567. Broadus, T. P. Kasten, A. J. Cassely, J. L. Hirsch, M. A. Mer- Hu, J., N. Bumstead, P. Barrow, G. Sebastiani, L. Olien, K. Morgan, wood, M. A. Nagy, K. F. Fok, M. J. Saabye, H. M. Morgan, and D. Malo. 1997. Resistance to salmonellosis in the chicken R. P. Compton, R. J. Mourey, A. J. Wittwer, and J. B. Monahan. is linked to NRAMP1 and TNC. Genome Res. 7:693–704. 2002. Examination of the kinetic mechanism of mitogen-acti- Kaiser, M. G., N. Deeb, and S. J. Lamont. 2002. Microsatellite vated protein kinase activated protein kinase-2. Biochim. Bio- markers linked to Salmonella enterica serovar Enteritidis vac- phys. Acta 158:88–97. cine response in young F1 broiler-cross chicks. Poult. Sci. Schlosser, W. D., and E. D. Ebel. 1998. A risk assessment of 81:193–201. Salmonella Enteritidis from eggs in the United States. USAHA Kaiser, M. G., and S. J. Lamont. 2001. Genetic line differences website: http://www.usaha.org/speeches/speech98/s98 in survival and pathogen load in young layer chicks after schol.html Accessed May 30, 2007. Salmonella enterica serovar Enteritidis exposure. Poult. Sci. Shindoh, N., J. Kudoh, H. Maeda, A. Yamaki, and S. Minoshima. 80:1105–1108. 1996. Cloning of a human homolog of the drosophila mini- Kaiser, M. G., and S. J. Lamont. 2002. Microsatellites linked to brain/rat DYRK gene from “the Down syndrome critical re- Salmonella enterica serovar enteritidis burden in spleen and cecal gion” of chromosome 21. Biochem. Biophys. Res. Commun. content of young F1 broiler-cross chicks. Poult. Sci. 81:657–663. 225:92–99. Koh, T. S., R. K. Peng, and K. C. Klasing. 1996. Dietary copper van der Zjipp, A. J. 1983. Breeding for immune responsiveness level affects copper metabolism during lipopolysaccharide- and disease resistance. World’s Poult. Sci. J. 39:118–131. induced immunological stress in chicks. Poult. Sci. 75:867–872. Warner, C. M., D. L. Meeker, and M. F. Rothschild. 1987. Genetic Kotlyarov, A., A. Neininger, C. Schubert, R. Eckert, C. Birchmeier, control of immune responsiveness: A review of its use as a tool H. D. Volk, and M. Gaestel. 1999. MAPKAP kinase 2 is essen- for selection for disease resistance. J. Anim. Sci. 64:394–406. tial for LPS-induced TNF-α biosynthesis. Nat. Cell Biol. White, D. G., S. Zhoa, R. Sudler, S. Ayers, S. Friedman, S. Chen, 1:94–97. P. F. McDermott, S. McDermott, D. D. Wagner, and J. Meng. Lamont, S. J. 1998. Impact of genetics on disease resistance. Poult. 2001. The isolation of antibiotic-resistant Salmonella from retail Sci. 77:1111–1118. ground meats. N. Engl. J. Med. 345:1147–1154. Lamont, S. J., M. G. Kaiser, and W. Liu. 2002. Candidate genes Wigley, P., S. D. Hulme, N. Bumstead, and P. A. Barrow. 2002. for resistance to Salmonella enteritidis colonization in chickens In vivo and in vitro studies of genetic resistance to systemic as detected in a novel genetic cross. Vet. Immunol. Immunopa- salmonellosis in the chicken encoded by the SAL1 locus. Mi- thol. 87:423–428. crobes Infect. 4:1111–1120. Lu, S., A. R. Manges, Y. Xu, F. C. Fang, and L. W. Riley. 1999. Womack, J. E. 1988. Molecular cytogenetics of cattle: A genomic Analysis of virulence of clinical isolates of Salmonella enteritidis approach to disease resistance and productivity. J. Dairy Sci. in vivo and in vitro. Infect. Immun. 67:5651–5657. 71:1116–1123. MacKay, R., and G. D. Lester. 1992. Induction of the acute-phase Wong, G., B. Liu, J. Wang, Y. Zhang, X. Yang, Z. Zhang, Q. Meng, cytokine, hepatocyte-stimulating factor/interleukin 6, in the J. Zhou, D. Li, J. Zhang, P. Ni, S. Li, L. Ran, H. Li, R. Li, H. Zheng, W. Lin, G. Li, X. Wang, W. Zhoa, J. Li, C. Ye, M. Dai, circulation of horses treated with endotoxin. Am. J. Vet. Res. J. Ruan, Y. Zhou, Y. Li, X. He, X. Huang, W. Tong, J. Chen, 53:1285–1289. J. Ye, C. Chen, N. Wei, L. Dong, F. Lan, Y. Sun, Z. Yang, Y. Mariani, P., P. A. Barrow, H. H. Cheng, M. M. Groenen, R. Yu, Y. Huang, D. He, Y. Xi, D. Wei, Q. Qi, W. Li, J. Shi, M. Negrini, and N. Bumstead. 2001. Localization to chicken chro- Wang, F. Xie, X. Zhang, P. Wang, Y. Zhao, N. Li, N. Yang, mosome 5 of a novel locus determining salmonellosis resis- W. Dong, S. Hu, C. Zeng, W. Zheng, B. Hao, L. W. Hillier, S. tance. Immunogenetics 53:786–791. P. Yang, W. C. Warren, R. K. Wilson, M. Brandstrom, H. McIlroy, S. G., R. M. McCracken, S. D. Neill, and J. J. O’Brien. 1989. Ellegren, R. P. Crooijmans, J. J. van der Poel, H. Bovenhuis, Control, prevention and eradication of Salmonella enteritidis M. A. Groenen, I. Ovcharenko, L. Gordon, L. Stubbs, S. Lucas, infection in broiler and broiler breeder flocks. Vet. Rec. T. Glavina, A. Aerts, P. Kaiser, L. Rothwell, J. R. Young, S. 125:545–548. Rogers, B. A. Walker, A. van Hateren, J. Kaufman, N. Meng, W., L. L. Swenson, M. J. Fitzgibbon, K. Hayakawa, E. Ter Bumstead, S. J. Lamont, H. Zhou, P. M. Hocking, D. Morrice, Haar, A. E. Behrens, J. R. Fulghum, and J. A. Lippke. 2002. D. J. de Koning, A. Law, N. Bartley, D. W. Burt, H. Hunt, H. Structure of mitogen-activated protein kinase-activated pro- H. Cheng, U. Gunnarsson, P. Wahlberg, L. Andersson, K. tein (MAPKAP) kinase 2 suggests a bifunctional switch that Institutet, E. Kindlund, M. T. Tammi, B. Andersson, C. Web- couples kinase activation with nuclear export. J. Biol. Chem. ber, C. P. Ponting, I. M. Overton, P. E. Boardman, H. Tang, 277:37401–37405. S. J. Hubbard, S. A. Wilson, J. Yu, and H. Yang. 2004. A genetic Miller, L., and M. A. Qureshi. 1992. Heat-shock protein synthesis variation map for chicken with 2.8 million single-nucleotide in chicken macrophages: Influence of in vivo and in vitro polymorphisms. Nature 432:717–722. heat shock, lead acetate, and lipopolysaccharide. Poult. Sci. Xie, H., N. C. Rath, G. R. Huff, W. E. Huff, and J. M. Balog. 2000. 71:988–998. Effects of Salmonella typhimurium lipopolysaccharide on broiler Nakamura, K., Y. Mitarai, M. Yoshioka, N. Koizumi, T. Shiba- chickens. Poult. Sci. 79:33–40. hara, and Y. Nakajima. 1998. Serum levels of interleukin-6, α- Zhang, S., H. S. Lillehoj, and M. D. Ruff. 1995. Chicken tumor acid glycoprotein, and corticosterone in two-week-old chick- necrosis-like factor. In vitro production by macrophages stim- ens inoculated with Escherichia coli lipopolysaccharide. Poult. ulated with Eimeria tenella or bacterial lipopolysaccharide. Sci. 77:908–911. Poult. Sci. 74:1304–1310. Rothschild, M. F., and M. Soller. 1997. Candidate gene analysis Zhou, H., and S. J. Lamont. 1999. Genetic characterization of to detect traits of economic importance in domestic livestock. biodiversity in highly inbred chicken lines by microsatellite Probe 8:13–18. markers. Anim. Genet. 30:256–264.