sign in sign up
<<
Home , Janus kinase, Janus kinase 3, Lck

The Journal of Immunology

Characterization and Analysis of the Proximal Janus 3 Promoter1

Martin Aringer,2*† Sigrun R. Hofmann,2* David M. Frucht,* Min Chen,* Michael Centola,* Akio Morinobu,* Roberta Visconti,* Daniel L. Kastner,* Josef S. Smolen,† and John J. O’Shea3*

Janus kinase 3 (Jak3) is a nonreceptor kinase essential for signaling via receptors that comprise the common ␥-chain (␥c), i.e., the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. Jak3 is preferentially expressed in hemopoietic cells and is up-regulated upon differentiation and activation. Despite the importance of Jak3 in lymphoid development and immune function, the mechanisms that govern its expression have not been defined. To gain insight into this issue, we set out to characterize the Jak3 promoter. The 5؅-untranslated region of the Jak3 is interrupted by a 3515-bp intron. Upstream of this intron and the initiation site, we identified an ϳ1-kb segment that exhibited lymphoid-specific promoter activity and was responsive to TCR signals. Truncation of this fragment revealed that core promoter activity resided in a 267-bp fragment that contains putative Sp-1, AP-1, Ets, Stat, and other binding sites. Mutation of the AP-1 sites significantly diminished, whereas mutation of the Ets sites abolished, the inducibility of the promoter construct. Chromatin immunoprecipitation assays showed that histone correlates with mRNA expression and that Ets-1/2 binds this region. Thus, transcription factors that bind these sites, especially Ets family members, are likely to be important regulators of Jak3 expression. The Journal of Immunology, 2003, 170: 6057–6064.

anus kinase 3 (Jak3)4 is a of major impor- important role in signaling. IL-7 has been demonstrated to be es- tance in the signaling pathways of the IL-2, -4, -7, -9, -15, sential for proper lymphoid survival and function in mice and hu- J and -21, whose receptors all comprise the common ␥-chain mans (13–19). By contrast, IL-15 is essential for proper NK cell (␥c) (1–5). Via its N terminus, Jak3 binds the intracellular portion development, as is apparent in mice deficient in this cytokine re- of ␥c (6, 7), whereas another kinase, Jak1, binds the -specific ceptor (20). The absence of signaling by both these in subunit. The importance of Jak3 is most vividly illustrated by the Jak3 SCID explains the block of lymphoid and NK cell develop- fact that mutations of human Jak3 are associated with SCID (8– ment seen in this disorder. The absence of IL-2 or one of its re- 10). Deficiency of Jak3 and ␥c in humans is typically associated ceptor subunits is associated with lymphoproliferation and auto- with the lack of and NK cell development; B cells develop, immune disease (21–23); the absence of IL-2 signaling probably but are poorly functional. In some patients with leaky mutations, explains why the remnant T of some Jak3 SCID pa- small numbers of T cells develop and, interestingly, exhibit acti- tients and of the knockout mice have an activated phenotype. The Ϫ Ϫ vation markers (11). Jak3 / mice also have profound immuno- distinct effects of Jak3 deficiency on development in humans deficiency, but the phenotype is somewhat different from that of and mice presumably reflect differences in cytokine requirements human Jak3 deficiency. These mice lack B cells and have small or cytokine expression in the two species, although the basis for numbers of T cells, which also have an activated phenotype (12). the differences has not been elucidated. It is interesting, however, The major defects in lymphoid development that occur in Jak3 that IL-21 appears to be an important regulator of murine B cell SCID can be explained in large measure by the function of three function (24, 25). The expression of Jak3 is of interest in that it is essential ␥c-using cytokines, for which Jak3 evidently plays an predominantly expressed in cells of hemopoietic origin and in or- gans where these cells are found (26–29). The abnormalities of patients with Jak3 defects are consistent with such a tissue distri- *Molecular Immunology and Inflammation Branch, National Institute of Arthritis and bution, as is the fact that successful bone marrow transplantation is Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD 20892; and †Department of Rheumatology, Internal Medicine III, University of Vi- essentially curative (9). Whereas the original reports on human and enna, Vienna, Austria murine distribution indicated absent or very low level Jak3 expres- Received for publication February 27, 2003. Accepted for publication April 7, 2003. sion in nonhemopoietic tissues (26, 28), other reports reached The costs of publication of this article were defrayed in part by the payment of page slightly different conclusions. Several studies have noted Jak3 ex- charges. This article must therefore be hereby marked advertisement in accordance pression in endothelium, glomeruli, and mesangial cells (30–32). with 18 U.S.C. Section 1734 solely to indicate this fact. Another study described wide expression of putative Jak3 mRNA 1 This work was supported by a Max Kade Foundation Postdoctoral Research Ex- change Grant (to M.A.). species in a variety of tissues (29); however, there was no direct 2 M.A. and S.R.H. contributed equally to this work. comparison with cells that express high levels of Jak3 (such as NK 3 Address correspondence and reprint requests to Dr. John J. O’Shea, Molecular Im- or activated T cells). Thus, whereas lymphoid and hemopoietic munology and Inflammation Branch, National Institute of Arthritis and Musculoskel- cells clearly express high levels of Jak3, it remains to be deter- etal and Skin Diseases, National Institutes of Health, 10 Center Drive, MSC-1820, mined whether Jak3 is expressed in meaningful levels in other Building 10, Room 9N252, Bethesda, MD 20892-1820. E-mail address: [email protected] tissues. It is notable that neither Jak3-deficient patients nor knock- 4 Abbreviations used in this paper: Jak3, 3; ␥c, common ␥-chain; ChIP, out mice suffer from any other abnormalities than those caused by chromatin immunoprecipitation. a lack of functional immune cells. Nonetheless, it is also pertinent

Copyright © 2003 by The American Association of Immunologists, Inc. 0022-1767/03/$02.00 6058 JAK3 PROMOTER CHARACTERIZATION AND ANALYSIS that despite the high level expression of Jak3 in monocytes, no Subcloning and luciferase assays significant defects of this cell lineage have been found in Jak3 Putative promoter constructs were generated by PCR from genomic DNA SCID patients (33). While it is clear that Jak3 is highly expressed and cloned into the Topo TA vector (Invitrogen, Carlsbad, CA). The inserts in hemopoietic cells, its relative expression and physiologic or were excised and subcloned into the pGL3-Basic vector (Promega, Mad- pathologic functional relevance in nonhemopoietic tissues remain ison, WI). The luciferase constructs were verified by sequencing. Two to be determined. micrograms of purified plasmid DNA was used per data point in each transfection together with 0.3 ␮g of pEF1/His/lacZ plasmid (␤-galactosi- Another interesting aspect of the expression of Jak3 is that it is dase vector; Invitrogen) using Superfect transfection reagent (Qiagen, Va- highly regulated by cell activation and cell differentiation. That is, lencia, CA). As positive control vector we used a CMV-promoter driven in T cells, lectins or phorbol esters induce Jak3 up-regulation (26, pGL3 vector. Alternatively, human PBMC and NK3.3 were transfected by 34). Similarly, B cell cross-linking or CD40 cross-linking electroporation using the human T cell Nucleofector Kit (Amaxa Biosys- tems, Cologne, Germany) according to the commercial protocol, using 5 in B lymphocytes up-regulates Jak3 expression (35), and LPS, ␮g of purified plasmid DNA together with 0.3 ␮g of pEF1/His/lacZ plas- IFN-␥, and IL-2 induce its expression in monocytes (36). In ad- mid. The transfection efficiency of electroporation, determined by flow dition, Jak3 was induced during the terminal differentiation of my- cytometry after transfecting a green fluorescence vector, was 30– eloid cell lines (37), whereas, in contrast to B cells, mature plasma 35%. The following day the cells were activated as described and harvested cells express only very low levels of Jak3 (35). In thymus, Jak3 is after another 30–36 h of incubation. The cells were lysed in ice-cold Re- porter Lysis Buffer (Promega, Madison, WI), and the lysates were consec- highly expressed at all stages, as it is in adult, double-negative utively analyzed for luciferase and ␤-galactosidase activities with the Dual (28). Given the activation-dependent regulation, it is Light Kit (Tropix, Bedford, MA) on a Monolight 3010 luminometer (An- tempting to speculate that Jak3 might be induced in a variety of alytical Luminescence Laboratory, Sparks, MD); luciferase expression is cells by inflammatory stimuli. This could explain the expression of represented as normalized by ␤-galactosidase activity (expressed as a percentage). Jak3 in nonlymphoid cells, particularly in pathological settings (30–32). Site-directed mutagenesis Despite this wealth of interesting findings, the promoter ele- The Ϫ74/ϩ27 and/or the Ϫ122/ϩ27 truncated luciferase promoter con- ments of JAK3 have not yet been characterized. Because of the structs were used as a template for mutations disrupting the binding con- pivotal role of Jak3 in lymphoid development and because of the sensus of several sites, using the Transformer site-directed mutagenesis interesting aspects of its regulated expression, we therefore (Clontech, Palo Alto, CA) as previously described (40). The following primers (mutated base pairs are underlined) were used for the construct thought it important to identify the Jak3 promoter and to begin lacking the Stat and both AP-1 binding sites, respectively: defining the mechanisms involved in its regulation. In particular, 5Ј-CCTGACTTTCGGTTTATGACAGTGGCTCAGGAA-3Ј and 5Ј-CA we wanted to find elements that could explain the hemopoietic and GCTCCCGCAGGGCCCTTCCTTTCGGTAAATTCCAGTGGCTCAGAC activation-dependent expression. CAAGG-3Ј. To create the three Ets-1 mutations, we used the following primers: 5Ј-CGGCTGATGCAGAGGCTTCCGCTACTTTCTGCCCCT CCTTGCCCG-3Ј,5Ј-GAAACCAAGGGGCCCACACAGCTAGGAGC Materials and Methods CGAGTGGGACTTTCCTC-3Ј, and 5Ј-GGGCGGCTGATGCAGAGGC Cells, cell lines, and stimulation TGACGCTACTTTCTGCCCCTCCTTGC-3Ј. All mutations were verified by sequencing. Transfections and luciferase assays were performed as de- PBMC were prepared from venous blood anticoagulated with preservative- scribed above. free heparin sedimented over Ficoll-Paque Plus (Amersham Pharmacia Biotech, Piscataway, NJ) gradients. PBMC, , JCAM1.1 (- Chromatin immunoprecipitation (ChIP) assay negative TCRbright Jurkat), and NK3.3 cells were grown in RPMI 1640 containing 10% FCS, glutamine, and antibiotics (Biofluids, Rockville, ChIP assays were performed according to protocol using a commercially MD). Jurkat cells that express large T Ag (Jurkat T) were also used in these available kit (Upstate Biotechnology, Lake Placid, NY) and polyclonal Abs studies; these cells constitutively express more Jak3 than parental Jurkat against Ets-1/2 and Stat-6 (Santa Cruz Biotechnology, Santa Cruz, CA) as cells (data not shown). Medium for NK3.3 was enriched with Lym- well as antiacetylated histone H3 and rabbit IgG (negative control; Upstate phocult-T (Biotest, Denville, NJ) and 40 U of IL-2/ml. COS7 and HeLa Biotechnology, Lake Placid, NY). Jurkat, HeLa, and COS7 cells were cells were grown in DMEM containing 10% FCS, glutamine, and antibi- cross-linked with formaldehyde, lysed, and sonicated using an XL2020 otic/antimycotic. Where described, cells were stimulated with PMA (50 sonicator (Heat Systems Ultrasonics, Farmingdale, NY); an aliquot of the ng/ml), ionomycin (3.5 ␮g/ml), cyclosporin A (500 ng/ml), or PHA (1 sonicated cells was amplified as input and immunoprecipitated with Abs to ␮g/ml; all from Sigma-Aldrich, St. Louis, MO). For stimulation with spe- acetylated histone H3, Ets-1/2, or control Ab (rabbit IgG). After reversing cific Abs, six-well tissue culture plates (BD Biosciences, Franklin Lakes, the cross-linking, PCR for the Jak3 gene was performed (35 cycles; 30 s at NJ) were incubated with PBS containing anti-CD3 and/or anti-CD28 (10 95°C,45sat59°C,45sat72°C) using the following primers for the human Ј Ј Ј Ј ␮g/ml; both from R&D Systems, Minneapolis, MN) for 16 h. Jak3 gene: 5 -ctcacacatgctacagatggg-3 and 5 -ggtttcctgagccactgtcat-3 (275-bp product; including Jak3 promoter region Ϫ6toϪ281). The PCR 5Ј RACE and DNA sequencing products were visualized on an ethidium bromide gel. Total RNA was purified from Jurkat T cells activated with PHA for 24 h Results and from NK3.3 cells using the RNeasy MiniKit (Qiagen, Valencia, CA) Ј Identification of the Jak3 transcriptional start site and or RNA STAT-60 (Tel-Test, Friendswood, TX). 5 RACE was performed Ј according to a commercial protocol (Life Technologies, Gaithersburg, organization of the 5 region of the Jak3 gene MD) using the following primers: 5Ј-tgcttgatgctaatgtctacgatt-3Ј,5Ј-tccag To identify the transcriptional start site in the Jak3 gene, we em- gtccatgatgtacttggcc-3Ј,5Ј-gtggtacacaggcaggatgccgctg-3Ј, and 5Ј-tcctccgt Ј ggccagagcaaa-3Ј. The F23402 cosmid was provided by L. K. Ashworth ployed 5 RACE using mRNA from Jurkat T or NK3.3 cells. We ( Center at the Lawrence Livermore National Laboratory). identified multiple products corresponding to 5Ј-untranslated se- Genomic DNA was purified from an EBV-transformed B cell line of a quence, the largest segment containing 111 bp of untranslated healthy donor using the QiaAmp kit (Qiagen, Santa Clarita, CA). PCRs mRNA (Fig. 1). The first base of this largest product was therefore were performed using Elongase (Life Technologies) on a Gene Amp 9700 assigned position ϩ1 and is identical with base 27,800 of the hu- PCR system (PerkinElmer, Norwalk, CT); the PCR products were purified over microconcentrators (Amicon, Beverly, MA). Sequencing reactions man 19 cosmid R34383 as deposited in GenBank by were performed with the same thermocycler using the Big Dye Terminator Lamerdin et al. (AC007201). Lai et al. (41) identified the same Kit (PE Applied Biosystems, Foster City, CA). The products were then 5Ј-untranslated segment of the Jak3 mRNA, but it was 20 bp purified over G-50 columns (5 Prime 3 Prime, Inc., Boulder, CO), vacuum- shorter than the longest product found by us. These differences in dried, and sequenced on an ABI 377 automated sequencer as previously described (38). Candidate promoter regions were scanned for possible tran- length may be due to alternative transcriptional start sites. scription factor binding sites using the programs of the TRANSFAC In- Comparison of the obtained mRNA with genomic DNA showed ternet site (39). a 3,515-bp intron with a splice acceptor site 13 bp upstream of the The Journal of Immunology 6059

FIGURE 1. The Jak3 mRNA start sites and the upstream region con- taining the putative promoter. The Jak3 mRNA is printed in bold letters interrupted by a 3515-bp intron; the initiation codon is heavily underlined. The first base pairs of all mRNAs found in this study are underlined; the first of our longest mRNA piece is denoted ϩ1. The first base pair of the study by Lai (41) is marked by a double underline; the common piece of all published mRNA sequences (26, 41) upstream of the large intron is marked by a dotted underline.

ATG codon (Fig. 1), again consistent with the reported R34383 sequence (intron from base 27,711 to base 24,197). The intron ends with a typical pyrimidine-rich stretch and AG. After identi- fying the region of the bona fide transcriptional start site, we se- quenced roughly 1,000 bp 5Ј to identify potential promoter/en- hancer elements. Fig. 1 shows 1,050 bp of genomic DNA upstream of the transcriptional start site containing the putative promoter region. With the exception of 1 bp (g instead of t at Ϫ947), this sequence is identical with the R34383 sequence (28,850 through FIGURE 2. The putative Jak3 promoter is active in T, but not in nonlym- 27,801 bp) as well as with bp 314,420 through 313,371 of the phoid, cells and is induced by lectin and phorbol esters. A, Jurkat T cells were Homo sapiens 19p13.1 sequence (Hs19_11445) (42), in accor- transfected with empty vector, vector containing the putative Jak3 promoter dance with the known chromosomal localization of Jak3. region, or vector containing the putative promoter in the reverse direction. Bars show the mean Ϯ SD of arbitrary units normalized for ␤-galactosidase The upstream JAK3 region contains tissue-specific (␤-Gal) light units (samples were measured as triplets). B, COS7 cells were promoter activity cotransfected with a ␤-galactosidase vector plus empty vector, vector contain- We next examined whether the DNA upstream of the transcrip- ing the putative promoter, or a positive control vector (CMV-promoter driven tional start site contained promoter activity. To this end we sub- pGL3 vector). Numbers given are luciferase light units normalized for ␤-Gal cloned a 1,039-bp fragment of upstream DNA (Ϫ1013 to ϩ27) light units. C, The acetylation status of histone H3 in the nucleosomes asso- ciated with the Jak3 core promoter region was assessed by ChIP assay in Jurkat into the pGL3 vector. Transfection of this construct into Jurkat T Ͼ and COS7 cells. Cells were lysed, and were cross-linked with form- cells resulted in considerable basal promoter activity, 20-fold aldehyde and immunoprecipitated with Ab to acetyl histone H3 (anti-acetyl higher than that in the empty vector (Fig. 2A). Since promoters H3) or control Ab (rabbit IgG). After reversing the cross-linking, PCR for the typically only function in the correct orientation, we also trans- Jak3 gene was performed. Input represents PCR amplification of the total fected a promoter construct that contained the same 1,039 bp but sample. Results are representative of two independent experiments. D, Jurkat in reverse orientation. This reverse construct had only minimal T cells were cotransfected with a ␤-galactosidase vector plus empty vector, vector promoter activity (Fig. 2A). These findings led us to conclude that containing the putative Jak3 promoter, or vector containing the putative promoter the roughly 1,000 bp upstream of the Jak3 transcriptional start site in the reverse orientation and were cultured without stimulation or with PHA or do indeed contain promoter activity. PMA. Results are expressed as luciferase light units normalized for ␤-Gal light Previous data have indicated two features of Jak3 expression. units. Results in AÐD are representative of two independent experiments. First, Jak3 is abundantly expressed in lymphoid and hemopoietic cells, but is not highly expressed in other cell types. Second, Jak3 expression apparently is activation dependent. Therefore, we next To test whether our promoter fragment also contained elements wanted to address whether the putative Jak3 promoter region could responsible for Jak3 tissue specificity, we transfected the identical be responsible for such regulation. construct into nonlymphoid cells. COS7, an embryonic kidney cell 6060 JAK3 PROMOTER CHARACTERIZATION AND ANALYSIS line, was useful, in that it does not express endogenous Jak3. The also trans-activated the Jak3 reporter construct. As shown in Fig. Jak3 promoter construct did not have activity in COS cells (Fig. 3A, TCR cross-linking was almost as efficient as PMA in activat- 2B) or HeLa cells (not shown), in contrast to a control construct ing the Jak3 promoter construct (Ͼ70% of the PMA-induced ac- driven by the CMV promoter. Thus, the Jak3 promoter construct tivation). Co-occupancy of the TCR and CD28 is a very potent also contained tissue-specific elements. stimulus for activating T cells. Some, but not all, T cell activation Chromatin remodeling is an important regulator of accessibility are synergistically induced by this combination. We therefore of DNA to transcription factors and subsequent transcriptional ac- next investigated whether the cross-linking of CD28, either alone or in tivation. Post-translational modification of histones, especially hi- conjunction with TCR cross-linking, had an effect on the Jak3 pro- stone acetylation, typically indicates remodeled genes, which are moter. As shown in Fig. 3A, CD28-dependent signals appeared to actively transcribed. We therefore examined whether histone acet- have little effect on the expression of the reporter construct. ylation in the Jak3 gene correlates with Jak3 expression. Using the Activation of the , Lck, is an early and essen- ChIP assay, comparing lymphoid vs nonlymphoid cells, we noted tial step in TCR . We therefore next wanted to histone H3 acetylation in the Jak3 promoter in Jurkat (Fig. 2C, lane 5) investigate whether promoter activation followed the usual path- and NK3.3 cells (not shown), but not in COS7 (lane 2) or HeLa (not way downstream of TCR cross-linking, which is dependent on shown) cells. The input DNA was equivalent (lanes 1 vs 4). Lck. To this end we compared wild-type Jurkat T cells with Lck- negative JCAM1.1 cells (Fig. 3B). Both cell lines had equivalent The putative Jak3 promoter region is induced by T cell activation high levels of CD3 surface expression as determined by flow cy- Having demonstrated that the promoter construct was active in tometry (not shown). Whereas both PMA and anti-CD3 stimula- lymphocytes, we next investigated whether it was also regulated in tion activated the promoter construct in wild-type Jurkat T cells, an activation-dependent manner. We and others have shown that stimulation with PMA, but not with anti-CD3, led to promoter lectins and phorbol ester up-regulate Jak3 expression (26, 34). We activity in JCAM1.1 cells (Fig. 3B). In conclusion, these findings therefore tested whether the candidate promoter segment we iso- indicated that TCR-dependent signals were capable of inducing lated could also be induced by these stimuli. As shown in Fig. 2D, this Jak3 promoter construct. in the absence of stimulation the promoter construct is expressed in Jurkat cells. Additionally, treatment of the cells with either PHA or PMA amplified expression (Ͼ4- and 6-fold, respectively). In con- The major promoter activity resides within 240 bp upstream of trast, the promoter construct in the reverse orientation was not the mRNA start site activatable. Taken together, these experiments are consistent with We next tried to delimit the essential regions of the Jak3 promoter the following conclusions. Jak3 gene promoter activity 1) resides in terms of both basal and inducible activities. For this purpose a in the region upstream of the Jak3 transcriptional start site and is series of 5Ј and 3Ј truncation constructs were generated and trans- orientation dependent; 2) is present in lymphoid, but not in COS7 fected into Jurkat T cells. As shown in Fig. 4A, the promoter ac- or HeLa cells; and 3) is both basally active and inducible. Based on tivity was similar after reducing the fragment to a 267-bp (Ϫ240/ these properties we will therefore refer to the segment isolated as ϩ27) segment, leaving the region upstream of the transcriptional the proximal Jak3 promoter. start site intact. In contrast, a 938-bp construct lacking 75 bp up- stream of the transcriptional start was completely inactive, indi- Signaling via the TCR activates the Jak3 promoter cating that this deletion disrupted the core promoter region. This PHA and PMA are nonspecific stimuli used experimentally to indicated that the Jak3 promoter was located within 240 bp up- mimic signaling by the TCR. We next examined whether TCR stream of the longest obtained cDNA and contained essential el- cross-linking by an anti-CD3⑀ Ab bound to tissue culture plates ements within 75 bp 5Ј of position ϩ1.

FIGURE 3. The Jak3 promoter can be activated by TCR cross-linking. A, Jurkat T cells were cotransfected with a ␤-galactosidase (␤-Gal) vector plus the luciferase vector containing the putative promoter region and were cultured in medium, in medium containing PMA, or on plates with immobilized anti-CD3, immobilized anti-CD28, or both. Results given are the mean Ϯ SD of luciferase light units normalized for ␤-Gal light units of the same sample. Results are representative of two independent experiments. B, Jurkat T cells and Lck-negative Jurkat cells (JCAM 1.1) expressing comparable levels of TCR (not shown) were cotransfected with a ␤-Gal vector plus the luciferase vector containing the Jak3 promoter region and were cultured in medium without activating agents or on immobilized anti-CD3 or with PMA. Results are luciferase light units normalized for ␤-Gal light units and are representative of two independent experiments. The Journal of Immunology 6061

FIGURE 4. Truncation defines the minimal active promoter region. A, Jurkat T cells were cotransfected with a ␤-Gal vector and equimo- lar amounts of luciferase vector containing dif- ferent pieces (base pairs above each column) of the Jak3 promoter region and cultured with or without activation on immobilized CD3 Abs. Results are representative of two independent experiments. B, Within the active promoter area, consensus core binding sites are underlined, whereas the dashed under- line denotes the binding matrix areas. C, The series of constructs used for delimiting the ac- tive promoter region are shown; important con- sensus binding sites still present on the respec- tive construct are indicated.

The 267 bp of DNA containing the promoter activity are shown made in the context of the active Ϫ240/ϩ27 construct (Fig. 5B). in Fig. 4B. This sequence was analyzed using the MatInspector Compared with the whole 267-bp construct, the baseline activity program (43) and revealed a number of potential transcription fac- was reduced by 80% when the 3Ј Ets-1 binding site was lost tor binding sites. Using 5Ј-truncated mutants (Fig. 4C), the relative (Ϫ240/ϩ2 construct), also removing a distal Ikaros site, although importance of the various elements was analyzed (Fig. 5A). Loss the relative induction remained similar to that of the complete of the putative AP4 and AP1 sites between Ϫ240 and Ϫ172 had construct. Removal of another 18 bp containing NF-AT, C/EBP, essentially no effect, whereas removal of the GATA and AP4 sites Ets-1, and Ikaros binding sites (Ϫ240/Ϫ16 construct) reduced the between Ϫ172 and Ϫ122 led to a mild increase in promoter ac- remaining baseline activity by another 50%, but the relative induction tivity. Removing the segment between Ϫ122 and Ϫ101, contain- stayed the same. Removing the AP1/Stat compound binding site and ing potential binding sites for Myb, Sp1, and AP4, did not appear a putative Oct-1 site (Ϫ240/Ϫ40 construct; Fig. 5B) completely abol- to affect promoter activity. Further truncation (beyond Ϫ101), ished both the baseline activity and the inducibility, arguing that this however, considerably reduced basal promoter activity. Specifi- region contained part of the JAK3 core promoter. cally, removal of a putative double Ets-1 binding site overlapping a C/EBP site diminished the baseline activity by almost two-thirds, Specific mutations confirm the roles of AP-1 sites and Ets-1 although the relative increase after TCR stimulation was un- binding enhancers changed. Continued truncation, which removed the GC/Sp1 sites To more specifically investigate the consensus AP-1/Stat/AP-1 overlapping with an Ikaros consensus site, completely abolished compound site, point mutations were made in both AP-1 sites in baseline activity and also led to a loss of inducibility, indicating the context of the Ϫ74/ϩ27 construct. Mutation of the AP-1 sites that these GC-rich motifs are part of the Jak3 core promoter. reduced baseline promoter activity to about one-fourth, demon- To further define the major elements that support Jak3 transcrip- strating the important role of AP-1 for the baseline activity of the tional control, a series of 3Ј truncation mutants (Fig. 4C) were Jak3 promoter (Fig. 5C). Mutation of these sites in the context of 6062 JAK3 PROMOTER CHARACTERIZATION AND ANALYSIS

FIGURE 5. Truncations and specific mutations confirm the important role of AP-1 and Ets-1 sites. A, Jurkat T cells were cotransfected with a ␤-galactosidase (␤-Gal) vector and equimolar amounts of empty luciferase vector or luciferase vector containing 5Ј truncation constructs of the Jak3 promoter region and cultured in the presence or the absence of immobilized CD3 Abs. Results are the mean Ϯ SD of luciferase light units normalized for ␤-Gal light units and are representative of three independent experiments. B, The same approach as in A was used to test 3Ј truncation constructs. C, Using the same approach in the context of the Ϫ74/ϩ27 construct, a 5Ј,3Ј truncation mutant lacking Ets-1 binding sites, and constructs with both AP-1 sites or the Stat site mutated were transfected and compared with the Ϫ74/ϩ27 construct and the empty vector. Results in B and C are representative of two independent experiments. FIGURE 6. AP-1 and Ets-1 sites are critical for expression of the Jak3 promoter. A, Jurkat T cells were cotransfected with a ␤-galactosidase (␤- Ϫ ϩ Gal) vector and equimolar amounts of empty luciferase vector or luciferase the larger 122/ 27 construct significantly reduced luciferase activ- vectors containing the Ϫ122/ϩ27 or the Ϫ74/ϩ27 5Ј truncation constructs ity (Fig. 6A), but did not affect inducibility. In contrast, mutation of the of the Jak3 promoter region with the AP-1 sites intact or mutated (⌬AP-1) consensus Stat binding site did not diminish promoter activity; how- and cultured in the presence or the absence of immobilized CD3 Abs. ever, the cytokine inducibility of this construct was not assessed. Results are the mean Ϯ SD of luciferase light units normalized for ␤-ga- We also mutated the Ets-1 binding sites in the context of the lactosidase light units. B, The same approach as in A was used in the Ϫ122/ϩ27 fragment. Interestingly, the disruption of these sites led context of the Ϫ122/ϩ27 construct to test constructs where Ets-1 binding to a total loss in promoter activity (Fig. 6B). Moreover, it was sites were mutated. C, Primary human T lymphocytes were transfected by sufficient to mutate either the 5Ј (Ϫ95/Ϫ91) or the 3Ј (ϩ9) Ets-1 electroporation with a ␤-Gal vector and equimolar amounts of empty lu- binding site to completely block promoter activity. These results ciferase vector or luciferase vectors containing the whole promoter region or the Ϫ122/ϩ27 construct with the 5Ј and 3Ј Ets-1 binding sites mutated confirm that the Ets-1 binding regions have an essential role in the and tested in the same way. D, ChIP assay with Jurkat cells and anti-Ets or regulation of the Jak3 promoter. Similar results were obtained us- control Ab. Cells were lysed, and proteins were cross-linked with formalde- ing primary human lymphocytes. The basal Jak3 promoter activity hyde and immunoprecipitated with Ab to Ets-1/2 (anti-Ets-1/2), Stat6 (anti- in these cells, which shows about a 5-fold increase compared with the Stat6), or control Ab (rabbit IgG). After reversing the cross-linking, PCR for empty vector, is abrogated when the Ets sites are mutated (Fig. 6C). the Jak3 gene was performed. Input represents PCR amplification of the total Comparable data were obtained using NK3.3 cells (not shown). sample. Results are representative of two independent experiments. The Journal of Immunology 6063

To confirm that Ets-1/2 binds the Jak3 promoter, we employed processes, including cell proliferation and differentiation, cell de- chromatin immunoprecipitation assays, which involve cross-link- velopment, transformation, and (47–49). Importantly, ing of proteins to DNA in vivo, followed by immunoprecipitation we identified Ets-1 binding to the Jak3 promoter using ChIP. This of a specific protein and identification of its associated promoter is notable because deficiency of Ets-1 (49, 50) has important ef- DNA by PCR. By using Abs that are specific for individual Ets fects on T cell survival and the development of NK cells (48); domain proteins, in vivo targets can be unambiguously identified. whether the absence of NK cells and the poor lymphoid survival in As shown in Fig. 6D, the Jak3 promoter was amplified when the Ets-1-deficient conditions relate to Jak3 deficiency is an interesting immunoprecipitation was performed using a polyclonal Ab spe- possibility and needs to be explored. It may be relevant in this cific for Ets-1/2 (lane 4), but not with a control Ab. regard that hemopoietic cells express other Ets-1 family members, such as PU.1 (important for myeloid and lymphoid differentiation), Discussion SAP-1 (biological role in T cell differentiation), Fli-1 (megakaryo- In this study we report the identification and characterization of the cyte differentiation), and SpiB (B cell function), which might also promoter region of the Jak3 gene, hoping to gain insight into two regulate Jak3. While the ChIP assay showed that Ets-1/2 bind di- properties of Jak3: its propensity to be expressed in hemopoietic rectly to the Jak3 promoter, it is conceivable that other Ets family cells and its induction following cell activation. members can also bind and might contribute to the regulation of All Jak3 mRNAs found in Jurkat T and NK cells begin 5Ј of a Jak3; indeed, there might be cell type variation depending upon large 3,515 base-pair intron with a splice-acceptor site in the 5Ј which family members are present in the greatest abundance. untranslated region, 13 bp upstream of the ATG codon. This is The other motif present in the Jak3 promoter found to have similar to the putative murine Jak3 promoter, which also contains an intron in the 5Ј untranslated mRNA. All published human Jak3 significant effects were AP-1 sites. AP-1 complexes are het- mRNA sequences also contain sequence 5Ј of this large intron and erodimers of Fos and Jun proteins, are ubiquitously expressed and start within the same region (26, 41). We therefore also expected downstream of mitogen-activated cascades, and to find promoter activity close to the transcriptional start sites. play an important role in the signaling response. The induction of Indeed, the 1-kbp region upstream of the transcriptional start site Fos and the activation of Jun necessary to form the complex are contained considerable promoter activity when cloned into a lu- well-known consequences of TCR signaling. Interestingly, Ets and ciferase vector and transfected into Jurkat T cells. In contrast, no AP-1 binding sites occur in a large number of promoter/enhancer promoter activity was found in nonhemopoietic cells, such as elements, and functional cooperation between Ets and AP-1 is critical COS7 or HeLa cells. Moreover, the promoter region was acety- for controlled expression of many genes, including cytokines (47, 51, lated in lymphoid but not nonlymphoid cells, fitting the known 52). It is notable, though, that AP-1 is not only activated in T cells tissue specificity of Jak3 (26–29). Consistent with the expectation following TCR cross-linking, but can be a consequence of a broad of finding the core promoter near the transcriptional start site, a spectrum of stimuli in a variety of cells (53). Thus, it is still possible 267-bp fragment (Ϫ240/ϩ27) surrounding the mRNA start site that under the appropriate circumstances activation of this pathway contained most of the promoter function, suggesting that this re- could lead to the expression of Jak3 in nonlymphoid cells. gion contains the major tissue-specific and TCR-inducible pro- In contrast to Ets-1 and AP-1 binding sites, the consensus moter elements. The described promoter region exhibited consid- NF-AT site also found 3Ј of the core promoter appeared to be of erable baseline activity and was further induced by PMA, PHA, minor importance, given the modest loss in activity after removal and direct TCR cross-linking. Moreover, the induction by TCR of this region (Fig. 5B) and the minimal effect of cyclosporin A cross-linking was absent in the Lck-negative Jurkat cell line (data not shown). This is again consistent with data on the murine JCAM1.1. Therefore, the Jak3 promoter is responsive to TCR- Jak3 promoter, where no NF-AT site was detected (44). mediated signals, and stimulation via the TCR clearly represents While the present studies were directed toward improving the an important way of stimulating Jak3 expression. understanding of Jak3 transcription, it should be noted that regu- Since COS cells do not express Jak3, the absence of promoter lation of transcription alone is likely to be an incomplete expla- activity was expected. However, we considered the possibility that nation of the regulation of Jak3 expression. In addition, determi- a negative control element might be operative in the vicinity of the nants such as the propensity to undergo ubiquitination and promoter. Truncation would therefore be expected to eliminate proteasomal degradation (54, 55) are likely to also affect the such a repressor element, which would then lead to transcription, amount of Jak3 present in a given cell at a given time. It is also but none of a series of truncation constructs was expressed in notable in this regard that the Jak3 gene has an AT-rich motif in its COS7 cells (data not shown). These findings argue against the idea 3Ј-untranslated region, similar to cytokines; so message stability may that Jak3 expression is down-regulated in nonlymphoid cells by also be an important, but unexplored, aspect of regulation. In view of engagement of a repressor. Rather, the data are consistent with the the essential function of Jak3, it will definitely be of interest to define interpretation that the lack of Jak3 expression and the lack of pro- moter activity in nonlymphoid cells are probably due to the lack of all the mechanisms involved in its regulation. positively acting transcription factors. Taken together, the present data indicate that the Jak3 promoter Several such transcription factors have binding sites in the is found 60 bp upstream of a large (roughly 3500 bp) intron in the Ј 267-bp Jak3 promoter region. Particularly interesting among these nontranslated 5 portion of Jak3 mRNA. The promoter is tissue are four consensus Ets-1 binding sites, mutation of which had dra- specific in that it is active in primary lymphocytes, Jurkat T cells, and matic effects on promoter activity. Importantly, Ets binding sites NK3.3 cells, but not in COS or HeLa cells, consistent with the pattern are also present in the putative promoters of the murine and puff- of Jak3 expression. The core promoter region extends over roughly 60 erfish Jak3 gene (44, 45). Ets proteins are a large family of Ͼ50 bp and is surrounded by elements containing essential binding sites evolutionary conserved transcription factors. These helix-turn-he- for Ets-1. These Ets-1 binding sites are of particular importance, as lix proteins do not typically dimerize, but, rather, form complexes mutations of these sites lead to complete abrogation of promoter ac- with other transcription factors (46). tivity. Using this information, it will be important to define exactly The founding member of this family, Ets-1, is expressed in hu- which transcription factors regulate Jak3 expression in vivo in normal man T, B, and NK cells and plays an important role in a variety of and pathologic states, in lymphoid and perhaps nonlymphoid cells. 6064 JAK3 PROMOTER CHARACTERIZATION AND ANALYSIS

References Molecular cloning of L-JAK, a Janus family protein-tyrosine kinase expressed in natural killer cells and activated leukocytes. Proc. Natl. Acad. Sci. USA 91:6374. 1. Ihle, J. N., W. Thierfelder, S. Teglund, D. Stravapodis, D. Wang, J. Feng, and 27. Takahashi, T., and T. Shirasawa. 1994. Molecular cloning of rat JAK3, a novel E. Parganas. 1998. Signaling by the superfamily. Ann. NY member of the JAK family of protein tyrosine . FEBS Lett. 342:124. Acad. Sci. 865:1. 28. Gurniak, C. B., and L. J. Berg. 1996. Murine JAK3 is preferentially expressed in 2. O’Shea, J. J. 1997. Jaks, STATs, cytokine signal transduction, and immunoregu- hematopoietic tissues and precursor cells. Blood 87:3151. lation: are we there yet? Immunity 7:1. 29. Safford, M. G., M. Levenstein, E. Tsifrina, S. Amin, A. L. Hawkins, C. A. Griffin, 3. Baird, A. M., D. C. Thomis, and L. J. Berg. 1998. T cell development and C. I. Civin, and D. Small. 1997. JAK3: expression and mapping to chromosome activation in Jak3-deficient mice. J. Leukocyte Biol. 63:669. 19p12–13.1. Exp. Hematol. 25:374. 4. Aringer, M., A. Cheng, J. W. Nelson, M. Chen, C. Sudarshan, Y. J. Zhou, and J. J. 30. Takahashi, T., T. Shirasawa, K. Miyake, Y. Yahagi, N. Maruyama, N. Kasahara, O’Shea. 1999. Janus kinases and their role in growth and disease. Life Sci. 64:2173. T. Kawamura, O. Matsumura, T. Mitarai, and O. Sakai. 1995. Protein tyrosine 5. Asao, H., C. Okuyama, S. Kumaki, N. Ishii, S. Tsuchiya, D. Foster, and kinases expressed in glomeruli and cultured glomerular cells: Flt-1 and VEGF K. Sugamura. 2001. Cutting edge: the common gamma-chain is an indispensable expression in renal mesangial cells. Biochem. Biophys. Res. Commun. 209:218. subunit of the IL-21 receptor complex. J. Immunol. 167:1. 31. Takahashi, T., T. Shirasawa, K. Miyake, Y. Yahagi, O. Matsumura, A. Abe, 6. Chen, M., A. Cheng, Y. Q. Chen, A. Hymel, E. P. Hanson, L. Kimmel, Y. Natori, H. Yamabe, Y. Utsunomiya, N. Maruyama, et al. 1996. Jak3 expression Y. Minami, T. Taniguchi, P. S. Changelian, and J. J. O’Shea. 1997. The amino in glomerular epithelia of IgA nephropathy (IgA-N) patients. Clin. Exp. Immunol. terminus of JAK3 is necessary and sufficient for binding to the common ␥ chain 104:517. and confers the ability to transmit 2-mediated signals. Proc. Natl. 32. Verbsky, J. W., E. A. Bach, Y. F. Fang, L. Yang, D. A. Randolph, and Acad. Sci. USA 94:6910. L. E. Fields. 1996. Expression of in human endothelial and other 7. Cacalano, N. A., T. S. Migone, F. Bazan, E. P. Hanson, M. Chen, F. Candotti, J. J. non-lymphoid and non-myeloid cells. J. Biol. Chem. 271:13976. O’Shea, and J. A. Johnston. 1999. Autosomal SCID caused by a point mutation 33. Villa, A., M. Sironi, P. Macchi, C. Matteucci, L. D. Notarangelo, P. Vezzoni, and in the N-terminus of Jak3: mapping of the Jak3-receptor interaction domain. A. Mantovani. 1996. Monocyte function in a severe combined immunodeficient EMBO J. 18:1549. patient with a donor splice site mutation in the Jak3 gene. Blood 88:817. 8. Buckley, R. H., R. I. Schiff, S. E. Schiff, M. L. Markert, L. W. Williams, 34. Sofer, L., D. Kampa, and J. Burnside. 1998. Molecular cloning of a chicken JAK T. O. Harville, J. L. Roberts, and J. M. Puck. 1997. Human severe combined homolog from activated T cells. Gene 215:29. immunodeficiency: genetic, phenotypic, and functional diversity in one hundred 35. Tortolani, P. J., B. K. Lal, A. Riva, J. A. Johnston, Y. Q. Chen, G. H. Reaman, eight infants. J. Pediatr. 130:378. M. Beckwith, D. Longo, J. R. Ortaldo, and K. Bhatia. 1995. Regulation of JAK3 9. Candotti, F., J. J. O’Shea, and A. Villa. 1998. Severe combined immune defi- expression and activation in human B cells and B cell malignancies. J. Immunol. ciencies due to defects of the common ␥ chain-JAK3 signaling pathway. Springer 155:5220. Semin. Immunopathol. 19:401. 36. Musso, T., J. A. Johnston, D. Linnekin, L. Varesio, T. K. Rowe, J. J. O’Shea, and 10. Schumacher, R. F., P. Mella, R. Badolato, M. Fiorini, G. Savoldi, S. Giliani, A. Villa, D. W. McVicar. 1995. Regulation of JAK3 expression in human monocytes: F. Candotti, A. Tampalini, J. J. O’Shea, et al. 2000. Complete genomic organization in response to 2, 4, and 7. J. Exp. Med. 181:1425. of the human JAK3 gene and mutation analysis in severe combined immunodefi- 37. Rane, S. G., and E. P. Reddy. 1994. JAK3: a novel JAK kinase associated with ciency by single-strand conformation polymorphism. Hum. Genet. 106:73. terminal differentiation of hematopoietic cells. Oncogene 9:2415. 11. Brugnoni, D., L. D. Notarangelo, A. Sottini, P. Airo, M. Pennacchio, 38. McDermott, M. F., I. Aksentijevich, J. Galon, E. M. McDermott, B. W. Ogunkolade, E. Mazzolari, S. Signorini, F. Candotti, A. Villa, P. Mella, et al. 1998. Devel- M. Centola, E. Mansfield, M. Gadina, L. Karenko, T. Pettersson, et al. 1999. Germ- opment of autologous, oligoclonal, poorly functioning T lymphocytes in a patient line mutations in the extracellular domains of the 55 kDa TNF receptor, TNFR1, with autosomal recessive severe combined immunodeficiency caused by defects define a family of dominantly inherited autoinflammatory syndromes. Cell 97:133. of the Jak3 tyrosine kinase. Blood 91:949. 39. Wingender, E., P. Dietze, H. Karas, and R. Knuppel. 1996. TRANSFAC: a database 12. Thomis, D. C., C. B. Gurniak, E. Tivol, A. H. Sharpe, and L. J. Berg. 1995. on transcription factors and their DNA binding sites. Nucleic Acids Res. 24:238. Defects in B lymphocyte maturation and T lymphocyte activation in mice lacking 40. Chen, M., A. Cheng, F. Candotti, Y. J. Zhou, A. Hymel, A. Fasth, Jak3. Science 270:794. L. D. Notarangelo, and J. J. O’Shea. 2000. Complex effects of naturally occurring 13. Park, S. Y., K. Saijo, T. Takahashi, M. Osawa, H. Arase, N. Hirayama, mutations in the JAK3 pseudokinase domain: evidence for interactions between K. Miyake, H. Nakauchi, T. Shirasawa, and T. Saito. 1995. Developmental de- the kinase and pseudokinase domains. Mol. Cell. Biol. 20:947. fects of lymphoid cells in Jak3 kinase-deficient mice. Immunity 3:771. 41. Lai, K. S., Y. Jin, D. K. Graham, B. A. Witthuhn, J. N. Ihle, and E. T. Liu. 1995. 14. Freeden-Jeffry, U., P. Vieira, L. A. Lucian, T. McNeil, S. E. Burdach, and A kinase-deficient splice variant of the human JAK3 is expressed in hematopoi- R. Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies etic and epithelial cancer cells. J. Biol. Chem. 270:25028. IL-7 as a nonredundant cytokine. J. Exp. Med. 181:1519. 42. Jang, W., H. C. Chen, H. Sicotte, and G. D. Schuler. 1999. Making effective use 15. He, Y. W. and T. R. Malek. 1996. Interleukin-7 receptor alpha is essential for the of human genomic sequence data. Trends Genet. 15:284. development of ␥␦ϩ T cells, but not natural killer cells. J. Exp. Med. 184:289. 43. Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in 16. Maraskovsky, E., M. Teepe, P. J. Morrissey, S. Braddy, R. E. Miller, nucleotide sequence data. Nucleic Acids Res. 23:4878. D. H. Lynch, and J. J. Peschon. 1996. Impaired survival and proliferation in IL-7 44. Gurniak, C. B., D. C. Thomis, and L. J. Berg. 1997. Genomic structure and promoter receptor-deficient peripheral T cells. J. Immunol. 157:5315. region of the murine Janus-family tyrosine kinase, Jak3. DNA Cell Biol. 16:85. 17. Candeias, S., J. J. Peschon, K. Muegge, and S. K. Durum. 1997. Defective T-cell 45. Leu, J. H., S. J. Yan, T. F. Lee, C. M. Chou, S. T. Chen, P. P. Hwang, C. K. Chou, receptor ␥ gene rearrangement in interleukin-7 receptor knockout mice. Immunol. and C. J. Huang. 2000. Complete genomic organization and promoter analysis of Lett. 57:9. the round-spotted pufferfish JAK1, JAK2, JAK3, and TYK2 genes. DNA Cell 18. Puel, A., S. F. Ziegler, R. H. Buckley, and W. J. Leonard. 1998. Defective IL7R Biol. 19:431. expression in TϪBϩNKϩ severe combined immunodeficiency. Nat. Genet. 20:394. 46. Sharrocks, A. D. 2001. The ETS-domain transcription factor family. Nat. Rev. 19. Baird, A. M., J. A. Lucas, and L. J. Berg. 2000. A profound deficiency in thymic Mol. Cell. Biol. 2:827. progenitor cells in mice lacking Jak3. J. Immunol. 165:3680. 47. Li, R., H. Pei, and D. K. Watson. 2000. Regulation of Ets function by protein- 20. Lodolce, J. P., D. L. Boone, S. Chai, R. E. Swain, T. Dassopoulos, S. Trettin, and protein interactions. Oncogene 19:6514. A. Ma. 1998. IL-15 receptor maintains lymphoid homeostasis by supporting lym- 48. Bories, J. C., D. M. Willerford, D. Grevin, L. Davidson, A. Camus, P. Martin, phocyte homing and proliferation. Immunity 9:669. D. Stehelin, and F. W. Alt. 1995. Increased T-cell apoptosis and terminal B-cell 21. Schorle, H., T. Holtschke, T. Hunig, A. Schimpl, and I. Horak. 1991. Develop- differentiation induced by inactivation of the Ets-1 proto-oncogene. Nature 377:635. ment and function of T cells in mice rendered interleukin-2 deficient by gene 49. Muthusamy, N., K. Barton, and J. M. Leiden. 1995. Defective activation and targeting. Nature 352:621. survival of T cells lacking the Ets-1 transcription factor. Nature 377:639. 22. Kundig, T. M., H. Schorle, M. F. Bachmann, H. Hengartner, R. M. Zinkernagel, 50. Barton, K., N. Muthusamy, C. Fischer, C. N. Ting, T. L. Walunas, L. L. Lanier, and I. Horak. 1993. Immune responses in interleukin-2-deficient mice. Science and J. M. Leiden. 1998. The Ets-1 transcription factor is required for the devel- 262:1059. opment of natural killer cells in mice. Immunity 9:5553. 23. Suzuki, H., T. M. Kundig, C. Furlonger, A. Wakeham, E. Timms, T. Matsuyama, 51. Bassuk, A. G., and J. M. Leiden. 1995. A direct physical association between R. Schmits, J. J. Simard, P. S. Ohashi, and H. Griesser. 1995. Deregulated T cell ETS and AP-1 transcription factors in normal human T cells. Immunity 3:223. activation and autoimmunity in mice lacking interleukin-2 receptor ␤. Science 52. Wasylyk, B., C. Wasylyk, P. Flores, A. Begue, D. Leprince, and D. Stehelin. 268:1472. 1990. The c-ets proto-oncogenes encode transcription factors that cooperate with 24. Ozaki, K., R. Spolski, C. G. Feng, C. F. Qi, J. Cheng, A. Sher, H. C. Morse III, c-Fos and c-Jun for transcriptional activation. Nature 346:191. C. Liu, P. L. Schwartzberg, and W. J. Leonard. 2002. A critical role for IL-21 in 53. Foletta, V. C., D. H. Segal, and D. R. Cohen. 1998. Transcriptional regulation in regulating immunoglobulin production. Science 298:1630. the : all roads lead to AP-1. J. Leukocyte Biol. 63:139. 25. Suto, A., H. Nakajima, K. Hirose, K. Suzuki, S. Kagami, Y. Seto, A. Hoshimoto, 54. Yu, C. L., and S. J. Burakoff. 1997. Involvement of proteasomes in regulating Y. Saito, D. C. Foster, and I. Iwamoto. 2002. prevents - Jak-STAT pathways upon interleukin-2 stimulation. J. Biol. Chem. 272:14017. induced IgE production by inhibiting germ line C⑀ transcription of IL-4-stimu- 55. Ungureanu, D., P. Saharinen, I. Junttila, D. J. Hilton, and O. Silvennoinen. 2002. lated B cells. Blood 100:4565. Regulation of Jak2 through the -proteasome pathway involves phos- 26. Kawamura, M., D. W. McVicar, J. A. Johnston, T. B. Blake, Y. Q. Chen, phorylation of Jak2 on Y1007 and interaction with SOCS-1. Mol. Cell. Biol. B. K. Lal, A. R. Lloyd, D. J. Kelvin, J. E. Staples, and J. R. Ortaldo. 1994. 22:3316.