Preliminary Results for Use Ssr Markers in Bitter Vetch “Vicia Ervilia (L.) Willd”

PRELIMINARY RESULTS FOR USE SSR MARKERS IN BITTER VETCH “VICIA ERVILIA (L.) WILLD”

Salama El Fatehi1,2, Gilles Béna2,4, Laïla Sbabou2,3, Abdelkarim Filali-Maltouf2,3 and Mohammed Ater1,2

1, Laboratoire de Diversité et Conservation des Systèmes Biologiques (LDICOSYB), Université Abdelmalek Essaâdi, P.B. 2121, Tétouan, Maroc. [email protected]. 2, Laboratoire Mixte International (LMI), Université Mohamed V-Agdal. Avenue Ibn Batouta BP 1014, Rabat, Maroc. 3, Laboratoire de Microbiologie et Biologie Moléculaire, Université Mohamed V-Agdal, Avenue Ibn Batouta BP 1014, Rabat, Maroc. 4, Laboratoire des Symbioses Tropicales et Méditerranéennes, Institut de Recherche pour le Développement (IRD), Campus International de Baillarguet, 34398 Montpellier Cedex 5, France.

ABSTRACT

A development of genomic DNA extraction protocol from the leaves of Vicia ervilia was conducted. The extraction from fresh material gives better outcomes than extraction from dried leaves. The DNA extracts obtained have significantly higher quality (ratio A260/280 is 1.99 and A260/230 is 1.92). The yields quantity of extracted DNA is also superior (1030 ng/µl). Using enriched genomic bank, sequences containing microsatellite were isolated. Twenty-four pairs of primers allowing the amplification products that are easy to read have been obtained, nine of which have revealed the polymorphism. The average value of the index PIC (Polymorphism Information Content) is 0.65 and the average number of alleles per locus is 7.6. These values prove to be more interesting compared to the available data in leguminous plants.

Keywords : Vicia ervilia, DNA extraction, SSR, polymorphism

resulted in ecotypes adapted to the local agro- 1. INTRODUCTION climatic conditions) whose genetic resources assessment has nearly never been done (but see Vicia ervilia (L.)Willd. is an ancient cultivated Francis et al. (1994); Van de Wouw et al. (2001) leguminous. Currently, it is a minor crop distributed for limited Vicia studies). Although it is a marginal in Southern of Europe, West and Central Asia and and minor culture, it represents significant genetic North Africa (GRIN, 2008). World production is resources which require efforts for conservation. estimated around 800,000 tons per year with an average yield of 1600Kg/ha (FAO, 2013). The On the other hand; the Mediterranean climate primary use of the bitter vetch seeds is animal regions have experienced sensitive rise in feeding (Enneking, 1995; Francis et al., 1999). The temperatures and periods of severe drought under use in human food is rare due to its toxicity the effect of climate change during the last decades (Sadeghi et al., 2009) and it is only mentioned (Bindi & Olesen, 2011; Supit et al., 2010). during starvation periods (Enneking et al., 1995). Thereby, rainfed agriculture is now facing high risks and climate uncertainties (Trnka et al., 2011). In Morocco, it is a minor crop in the northern Among the cultivated Vicia, V. ervilia is a very part of the country (Foury, 1954). Indeed, the interesting species with adaptive capacities, cultivated areas were already stagnated in the 80s especially tolerance to aridity and can be cultivated and 90s around 20,000 ha (Bounejmate, 1997) with poor rainfall (Foury, 1954 ; Maxted, 1995 ; reaching nowadays 10,000 ha (FAO, 2013). The Abd El-Moneim & Saxena, 1997). varieties used are populations locally maintained by traditional farming practices within traditional agro- Microsatellites (SSR) markers (Chambers & ecosystems of the Rif Mountain (Hmimsa & Ater, MacAvoy, 2000) have been shown to be excellent 2008; Ater & Hmimsa, 2008). This local selection molecular markers for the study of genetic diversity

(Karp et al. 1997; Luikart et al., 2003) and we will adapt DNA extraction protocol to our commonly used in studies of genetic diversity and material and then search for interpretable powders genotypic characterization. Indeed, they are for SSR markers. This is a relevant contribution to codominant and reveal high levels of polymorphism the assessment of genetic diversity of this species, because they are multi-allelic (Jarne & Lagoda, with a view to its valorization. 1996). Upgrading to SSR markers points conducted in several species in the legumes (Rong et al., 2012; 2. MATERIAL AND METHODS Sun et al., 2012; Ohtsuki et al., 2011) and genus Vicia (Chung et al., 2013); especially in Vicia faba 2.1. Vegetal Material (Gong et al., 2010; Gong et al., 2011; Yang et al., 2012) species of great interest for Mediterranean A collection made up of 19 accessions collected agriculture. Vicia ervilia use of SSR markers was in the North-West of Morocco was carried (Tab. 1). not yet performed. Each accession is composed of 10 individuals sampled directly into the fields; thus, the collection Hence the goals of this study were to provide a has a total of 190 individuals. first assessment to characterizing the genetic diversity with SSR markers among local populations of Vicia ervilia in Morocco. To do this,

Table 1: Localization of the sampled populations Locality name Longitude East Latitude North Altitude (m) Kramat 05’34,780 35’40,638 301 Dharlahdida 05’34,307 35’39,893 373 Rouman 05’38,098 35’32,080 175 Ahrit 05’33,511 35’38,990 224 Adrou 05’33,236 35’25,308 566 Achakrad 05’29,985 35’23,729 468 Tafifoute 05’22,355 35’23,507 647 Bouatou 05’25,355 35’221,507 713 Jnanate 05’23,301 35’17,876 720 Iabasan 05’25,504 35’16,551 819 Talamboute 05’18,888 35’18,262 504 Pont Talamboute 05’20,992 35’18,979 419 Khizana 05’14,750 35’03,583 825 Bab el hourrate 05’04,150 34’59,348 492 Asserdoune 05’03,178 34’59,797 644 Ain Beida 05’24,647 35’01,393 185 Tiamma 05’32,011 34’55,654 136 Douaher 05’33,317 34’52,120 228 El Jabriyine 05’32,703 34’52,914 170

2.2. DNA extraction i. According to Doyle & Doyle (1987): Preheat 4 ml of CTAB isolation buffer Extraction of genomic DNA of Vicia ervilia is (2% hexadecyltrimethyl ammonium made from dried leaves harvested in the field. bromide [CTAB: Sigma H-5882], 1.4 M Alone, the last pairs of leaves are collected and then NaCl, 20 mM EDTA, 100 mM Tris-HCl, dried by Silica gel. A second extract made from the pH 8.0). Grind 35 mg dry leaf tissue with fresh plant material. The seeds are germinated in 300µl CTAB isolation buffer. Incubate the Petri dishes and the seedlings are used for the sample at 60°C for 60min. with optional extraction of DNA. occasional gentle swirling. Extract once with chloroform-isoamyl alcohol Two protocols have been tested: Doyle & Doyle (400µl), mixing gently but thoroughly, (1987) and Khanuja et al. (1999). this produces two phases, an upper

aqueous phase which contains the DNA, 2.4. Development of nuclear microsatellite and a lower chloroform phase that primers and amplification contains some degraded proteins, lipids, and many secondary compounds. The The genomic bank was constructed from the interface between these two phases DNA of 7 individuals belonging to the collection, contains most of the "junk" cell debris, according to the pyrosequencing method many degraded proteins, etc. Spin in (GENOSCREEN, Lille, France). 24 primer pairs clinical centrifuge at room temperature at were tested (Tabl. 2). 6000 x g for 10min.. Remove aqueous PCR amplification was performed with 20 ng of phase with wide pipette, transfer to clean total DNA and in a final volume of 10μl containing glass centrifuge tube, add 2/3 (200µl) 37.5 pmol of MgCl2, 6 pmol of dNTPs, 1 pmol of volumes cold isopropanol, and mix each primer and one unit of Taq DNA polymerase. gently to precipitate nucleic acids. The DNA amplification program adopted is as Incubate sample at 4°C for 60min.. After follows: 95°C for 10 min., followed by 40 cycles of spin in centrifuge at 6000 x g for 10 min, 30s at 95°C, 30s at 55°C and 1min. at 72°C, the supernatant removed and the pellet followed by a final extension for 10min. at 72°C. was washed with ethanol 80% and dried. Resuspend nucleic acid pellet in 70µl TE The lengths of the PCR products are revealed by (10 mM Tris-HCl, 1 mM EDTA, pH capillary electrophoresis at sequencer ABI 3730, by 7.4). Add 5 µl RNAase and incubate using the size marker Liz500 (Applied Biosystems). 30min. at 37°C. The reading of lengths of the fragments is performed using the GeneMapperR software ii. According to Khanuja et al. (1999): The (Applied Biosystems). extraction buffer is composed of 2,5% CTAB, 1.5 M NaCl, 25 mM EDTA, 100 The PIC value (polymorphism information mM Tris-HCl, pH 8.0 et 0,2% β- content) was calculated according to the formula

mercaptophénol. After grinding with the (Anderson et al., 1993): PIC= 1 – ∑ , where buffer solution. Samples were incubated Pij is the frequency of the jth allele at the ith locus. at 60°C for 90 min. Proteins were removed by the chloroform-isoamyl 3. RESULTS AND DISCUSSIONS alcohol, and then by centrifugation at 8000g for 10 min, DNA is located in the 3.1. DNA extraction aqueous phase, and to precipitate it, one adds the NaCl (5M) and the Isopropanol In the literature, many DNA extraction then the sample was incubated at 4°C for protocols existed. The extraction protocol with 60 min. After centrifugation at 10000g CTAB was developed for the first time by Murray for 20 min, the supernatant is eliminated and Thompson (1980). It is suitable for extraction and the pellet was washed with ethanol and purification of plant DNA and particularly for 80% then dried. Finally the pellet is the suppression of polysaccharides and polyphenols suspended in the Tris EDTA (10-1) and which affect the purity of the DNA and therefore was added ARNase before incubating the the quality of the extracts. The protocol most samples at 37°C for 30 min. widely cited in the literature and adapted for different types of plants is that of Doyle & Doyle 2.3. DNA quality (1987). At vetch, this protocol has been used by Haider et al. (2012) in a comparative study of The quantity and quality of DNA are estimated different species of the genus Vicia. Although these by dosage in a spectrophotometer NanoDrop methods have proven their effectiveness, they are (Thermo Scientific – NanoDrop 2000 rarely applied without modification in all taxa and Spectrophotometer). For each of tested protocols, from different types of materials (leaves, seeds, the DNA quantities and ratios of optical densities fresh or dried tissue). In the case of our experiment, A260/A280 and A260/A230 are estimated by 10 the protocol of Doyle & Doyle (1987), did not give repetitions. They are compared by the test of the best results from the dry leaves harvested on the Student-Newman-Keuls (SNK) by using the SPSS ground. Indeed, the obtained concentrations are too statistics software (17.0). The DNA extracts are weak (Tab. 2) and the ratio 260/280 is only 1.41 deposited on an agarose gel 0.8%. The gels are and the ratio 260/230 is around of 0.71. Such values visualized under UV in the transilluminator (Fisher are too low compared to standard values. The – Bioblock Scientific). normally expected value of the ratio 260/280 of the purified DNA range between 1,8 to 2 and 2 to 2,2

Nov. 2013. Vol. 1, No.1 ISSN 2311-2476 International Journal of Research In Agriculture and Food Sciences © 2013 IJRAFS & K.A.J. All rights reserved http://www.ijsk.org/ijrafs.html for the ratio 260/230 (Sambrook et al., 1989). We by Silica gel affects the quality of the DNA tried a second protocol, that of Khanuja et al. extracted from the leaves. A second test with (1999) from the same type of material (dried leaves protocol Khanuja et al. (1999) will be performed on in Silica gel). The results obtained are significantly fresh plant material obtained from the leaves of better (Tab. 2), the quantity of DNA is significantly plantlets after seeds germination. The results are important and the ratio 260/280 is closer to the satisfactory both at the level of the concentration of standard. However, the value of the ratio 260/230 is extracted DNA (1030 ng / µl) than of their qualities too far from the standards, which means a possible (ratio A260/280= 1.99 and A260/230 = 1.92) (Tab. contamination by polysaccharides. We believe that 2). the drying technique and storage of plant material

Table 2: Comparisons of means (SNK) of the three protocols. Sample size=10 for each parameter tested (concentration of DNA, ratio 260/280 and 260/230); s: standard deviation; the alphabetical order of the letters is classifying the means by increasing order at the threshold of 0.05. Concentration of DNA ng/µl±s 260/280±s 260/230±s

Doyle & Doyle (1987) (dry leaves) 7.67±3.99 a 1.41±0.17 a 0.71±0.66 a Khanuja et al. (1999) (dry leaves) 349.65±233.26 b 1.84±0.17 b 1.49±0.49 b Khanuja et al. (1999) (fresh leaves) 1030.35±270.92 c 1.99±0.11 c 1.92±0.27 c

The quality of the extracts was controlled by staining with ethidium bromide solution, and visualization on agarose gel (Fig. 1). One can see visualization under UV light for 30 individual and on the gel, the quality of the extracted DNA after 100 bp DNA ladder.

100pb

Figure 1: Migration of the DNA extracted according to the protocol Khanuja et al. (1999) from fresh leaves on agarose gel 0.8%.

3.2. SSR markers only 9 are polymorphic (VE02, VE03, VE05, VE07, VE09, VE14, VE19, VE27, VE8).The 24 primers between di-nucleotide and fourth- revealed polymorphism from the tested primers is nucleotide were identified (Tab. 3). The results relatively important because 53% of the loci are obtained showed that 17 primers made it possible to polymorphic (Tab. 3). The polymorphism rates amplify products interpretable and easy to read, that revealed in this study are relatively high in is codominant locus in which one can recognize the comparison with that obtained in other leguminous alleles. Among the 17 loci, 8 are monomorphic and plants as Phaseolus lunatus with 48.89%

(Ouédraoga et al., 2005) and Medicago ruthenica with 34% (Rong et al., 2012).

Table 3: Characterization of 24 microsatellite primers tested in Vicia ervilia. (NI : No Interpretable; P : Polymorphic ; M : Monomorphic) Primer Size Sequences F Sequences R Repeat Result VE01 240 ACCTCACCCCATCAACATCT CGGTCGGAGATAGGACTCAA CTT (20) NI VE02 240 CAAGCTGGCCACCTAATGC ATATTAAGGGTTTCGAGTTGGG GA (17) P VE03 155 TAGCAAGCCTTTGAACCTTTT CCTGAAACAGCAAACCAACA AC (17) P VE05 250 TTTAATTTTGCTCCTTGCGG CCTTACCATAACCTAAACCTAACCC TATG (16) P VE07 248 TTCGGATATGGGAACCTTTATG GGTTCTAGAAAACAGCTCCCAA TG (16) P VE08 191 GACGAGTTACATCTTCGGCG TGAGTTTTGAGATTTAGCCCTTG CTT (16) NI VE09 149 CTGCTGATGATGTTGTGGATG GAACACGTGTACGGAGACCA TGT (15) P VE10 132 AGAAGGGGTACTACGTGAATGC TGTGATGCATGGCATATCATT TTG (15) NI VE12 190 GGTTGAGCATACACTTTGATCATT CGGAGCTATCAGAATCCGAA TCT (13) NI VE13 91 GTGGAAGCCAAGGTCTTTTG AGGAGGTCCAGCAGGAAAAT TGT (13) NI VE14 118 TTTGGAGGCTTTGAGCCTTA CCCAACAGGGATACCACTTC TTC (13) P VE16 205 GAAATTGTGAAGATTATGGTGGG GCGTTCGCTACAAGACCAA GT (13) NI VE19 254 GTCAGAATCCCCATGTACACAA CCCTCTCAAAACACCTTCCA CTT (12) P VE21 145 TCTTGTATCCTCGGGAATTGA TCTCCTTTTCCTTCATCGCT AG (12) M VE22 106 GCAATACATGATGAATGAAACCA GAATTGCCAACAGTGGGATT TG (12) M VE23 111 CTCTTTCACTAAAATGAAACAACAAGA AAACCAAGTTGGAATTAAAGGG TC (11) M VE24 147 CGTTTCCTCCAGCTTCTTTG ACCTTCAAGGAACCTCCCAT GGA (11) M VE26 292 TTTATCATCAATAGGAAACACTGTTAG CGTGATCTCAAAGCTAGCAAC ACA (11) NI VE27 191 GTGTCTTAGATTTCATCAATGCG TCATTCATCACAAAGTTACTGCAA GA (10) P VE28 158 CCCATATCACCATCACCAAA CATTGTTGAGCATGTTGAAGG AC (10) P VE29 192 ACTTTCAAGGCTGCCTCCTA CTCTTCATGGAGTTGGGTGG GA (10) M VE30 125 GCTAAGCAGCGACAATCACA GAGCATGGGAACATCATCG AAC (10) M VE35 216 GCGACCAGCCACTGTTATTT TGGCCATAGCTTAGAAACGAA TC (10) M VE36 101 TCGATTGGAGAACTTCCTAAACA TCACACAATCAATTGGTTCACA TC (10) M

At the polymorphic loci, the average number of alleles observed. The polymorphism index (PIC) alleles (Na) observed is 7.6 (Tab. 4). The revealed an average value of 0.65 (Tab. 4). The maximum was observed in VE02 and VE07 maximum value is 0.87 observed in VE07 and the respectively with 15 and 16 alleles. The minimum minimum value is 0.24 in VE27. was observed in VE27 and VE28 with only 3

Table 4: Results of primer screening in 19 accessions of Vicia ervilia. (Na : Number of alleles, PIC : Polymorphic Information Content) Locus Na PIC VE02 15 0.79 VE03 8 0.62 VE05 5 0.59 VE07 16 0.87 VE09 6 0.80 VE14 8 0.69 VE19 4 0.68 VE27 3 0.24 VE28 3 0.62

However, it is difficult to compare the Nevertheless, we can use the literature data to polymorphism values (Na and PIC) obtained by assess the level of polymorphism revealed by SSR SSR in the literature, because they vary in function in this study. Indeed, in comparison with the results of several parameters such as, the nature and the published at Vicia faba (Suresh et al., 2013) number of loci studied, sample size and the number showing a Na =6 and a PIC=0.55 with 32 loci and of used accessions. For example, at Vicia faba the at Vicia sativa (Chung et al., 2013) showing a Na is in the order of 6 in a study of Suresh et al. Na=5.7 and a PIC=0.62 with 65 loci; we can (2013) with 32 loci; yet Gong et al. (2010) are consider that the values obtained (Na=7.6 and obtained only a value of 1.93 but with 11 loci. PIC=0.65) in this study at Vicia ervilia with only 9

Nov. 2013. Vol. 1, No.1 ISSN 2311-2476 International Journal of Research In Agriculture and Food Sciences © 2013 IJRAFS & K.A.J. All rights reserved http://www.ijsk.org/ijrafs.html loci are very satisfactory for assessing the genetic diversity. 5. Bounejmate M.; 1997. Le patrimoine fourrager et pastoral au Maroc : acquis et perspectives. In 4. CONCLUSIONS Ressources phytogénétiques et développement durable (eds. A. Birouk et M. Rejdali), Actes This study has developed an effective protocol Editions, Rabat, Maroc. pp 219-238. for extracting DNA of Vicia ervilia. Thus, it has 6. Chambers G. K. and MacAvoy E. S.; 2000. proved that we must use the fresh material for the Microsatellites: consensus and controversy. Comp. extraction and avoid the use of dried material. The Biochem. Physiol. B Biochem. Mol. Biol. 126: 455- protocol of Khanuja et al. (1999) is better suited 476. than Doyle & Doyle (1987). 7. Chung J., Kim T., Suresh S., Lee S. and Cho G.; The test of 24 pairs of primers allowed us to 2013. Development of 65 Novel Polymorphic cDNA- evidence of 9 polymorphic loci. The obtained SSR Markers in Common Vetch (Vicia sativa subsp. polymorphism level is very satisfactory and allows sativa) Using Next Generation Sequencing. a good evaluation of the genetic diversity in Vicia Molecules, 18 : 8376-8392; ervilia. doi:10.3390/molecules18078376.

This protocol will be used in the future for an approach to the characterization of the genetic 8. Doyle J. J. and Doyle J. L.; 1987. A rapid DNA isolation procedure for small quantities of fresh leaf diversity in local varieties of bitter vetch grown in tissue. Phytochemical Bulletin 19: 11-15. the Morocco. 9. Enneking D.; 1995. Post-harvest detoxification: the Acknowledgments: This work was supported by key to alternative Vicia grain legumes? In : Yusuf H. OREAL-UNESCO award "For Women and K. M. and Lambein F. ; Eds. Lathyrus sativus and Science" 2009 and a scholarship program Human Lathyrism: Progress and Prospects. Dhaka: UNESCO/MAB for Young Scientists 2010. We University of Dhaka, pp 85-92. also thank Mr. Younes Hmimsa for his help and assistance during the surveys. The authors 10. FAO; 2013. acknowledge Mr. Samir Chekri for his help in the http://faostat3.fao.org/home/index.html#DOWNLOA translation of this paper. D.

REFERENCES 11. Foury A.; 1954. Les légumineuses fourragères au Maroc (deuxième partie). Cah. Rech. Agron. 5: 287- 658. INRA, Rabat, Maroc 1. Abd El Moneim A. M. and Saxena M. C.; 1997. Developing cultivated forage legumes for improved 12. Francis C. M., Bounejmate M. and Robertson L. D.; yield and quality to feed livestock in the dry areas. In: 1994. Observations on the distribution and ecology Haddad, N.; Tutwiler, R.; Thomson, E. ed. of Vicia and Lathyrus species in Morocco. Al Improvement of crop-livestock integration systems in Awamia 84: 17-42. West Asia and North Africa. Proceedings of the

Regional Symposium on Integrated Crop-Livestock Systems in the Dry Areas of West Asia and North 13. Francis C. M., Enneking D. and Abd El Moneim A. Africa, pp 6–8 November 1995, Amman, Jordan. M.; 1999. When and where will vetches have an ICARDA, Aleppo, Syria. impact as grain legumes?. In: Knight, R. (ed.) Linking Research and Marketing Opportunities for 2. Anderson J.A., Churchill G.A., Autrique J.E., Pulses in the 21st Century. Proceedings of the Third Tanksley S.D. and Sorrells M.E.; 1993. Optimizing International Food Legume Research Conference, parental selection for genetic link-age maps. Genome Adelaide 1997 .Current Plant Science and 36: 181-186. Biotechnology in Agriculture. Vol. 34:671-683. Kluwer Academic Publishers, Dordrecht/Boston/London. 3. Ater M. and Hmimsa Y.; 2008. Agriculture

traditionnelle et agrodiversité dans le bassin versant de Oued Laou (Maroc). Bayed A. &Ater M. 14. Germplasm Resources Information Network (GRIN); (éditeurs). Du bassin versant vers la mer: Analyse 2008. GRIN taxonomy for Plants. United States multidisciplinaire pour une gestion durable. Travaux Department of Agriculture, Agricultural Research de l'Institut Scientifique, Rabat, série générale 5 : Service, Beltsville Area. available at: http://www.ars- 107-115. grin.gov/cgi-bin/npgs/html/taxon.pl?41481.

4. Bindi M. and Olesen J. E.; 2011. The responses of 15. Gong Y., Xu S., Mao W., Hu Q., Zhang G., Ding J. agriculture in Europe to climate change. Reg Environ and Li Z.; 2010. Generation and characterization of Change 11 (Suppl 1): S151–S158. DOI 11 novel EST derived microsatellites from Vicia faba 10.1007/s10113-010-0173-x.

(Fabaceae). American Journal of Botany Primer 27. Sadeghi G. H., Mohammadi L., Ibrahim S. A. and Notes & Protocols in the Plant Sciences. pp 69–71. Gruber K. J.; 2009. Use of bitter vetch (Vicia ervilia) as a feed ingredient for poultry. World's Poultry 16. Gong Y., Xu S., Mao W., Li Z., Hu Q., Zhang G. and Science Association 2009 World's Poultry Science Ding J.; 2011. Genetic Diversity Analysis of Faba Journal, Vol. 65: 51-64. Bean (Vicia faba L.) Based on EST-SSR Markers. doi:10.1017/S0043933909000004. Agricultural Sciences in China. 10(6): 838-844. 28. Sambrook J., Fritsch E.F. and Maniatis T.; 1989. 17. Haider N., NabulsiI. and Mirali N.; 2012. Molecular Cloning: A Laboratory Manual. Cold Identification of species of Vicia subgenus Vicia Spring Harbour, New York: Cold Spring Harbour (Fabaceae) using chloroplast DNA data. Turk J Laboratory Press. Agric For 36:297-308. doi:10.3906/tar-1105-17. 29. Khanuja S. P. S., Shasany A. K., Darokar M. P. and 18. Hmimsa Y. and Ater M.; 2008. Agrodiversity in the Kumar S.; 1999. Rapid Isolation of DNA from Dry traditional agrosystems of the Rif mountains (north of and Fresh Samples of Plants Producing Large Morocco). Biodiversity: Journal of life on earth. Vol. Amounts of Secondary Metabolites and Essential 9, N° 1 & 2: 78–81. Oils. Plant Molecular Biology Reporter V. 17: 1–7.

19. Jarne P. and Lagoda P.J. L.; 1996. Microsatel-lites, 30. Sun X., Yang T., Guan J., Ma Y., Jiang J., Cao U., from molecules to populations and back. Trends Ecol. Burlyaeva M., Vishnyakova M., Semenova E., Evol. 11: 424-429. Bulyntsev S. and Zong X.; 2012. Development of 161 novel EST-SSR markers from Lathyrus sativus 20. Karp A., Kresovich S., Bhat K.V., Ayad W.G. and (Fabaceae). American Journal of Botany primer Hodgkin T.; 1997. Molecular tools in plant genetic notes & protocols in the plant sciences. pp 379–390. resources conservation: a guide to the technologies. Technical Bulletin 2. Rome, International Plant 31. Supit I., Van Diepen C. A., Wit AJW D. E., Kabat P., Genetic Resources Institute (IPGRI). 27p. Baruth B. and Ludwig F.; 2010. Recent changes in the climatic yield potential of various crops in 21. Luikart G., England P. R., Tallmon D., Jordan S., and Europe. AgricSyst 103: 683–694. Taberlet P.; 2003. Te power and promise of population genomics: from genotyping to genome 32. Suresh S., Park J.H., Cho G.T., Lee H.S., Baek H.J., typing. Nat. Rev. Genet. 4: 981-994. Lee S.Y. and Chung J.W.; 2013. Development and Molecular Characterization of 55 Novel Polymorphic 22. Maxted N.; 1995. An ecogeographical study of Vicia cDNA-SSR Markers in Faba Bean (Vicia faba L.) subgenus Vicia. IPGRI, Rome. Using 454 Pyrosequencing. Molecules, 18: 1844- 1856; doi:10.3390/molecules18021844.

23. Murray H.G. and Thompson W.F.; 1980. Rapid isolation of high molecular weight DNA. Nucleilc 33. Trnka M., Olesen J. E., Ker Sebaum K. C., Skjelvag Acids Res 8: 4321-4325. A. O., Eitzinger J., Seguin B., Peltonen-Sainio P., Rotter R., Iglesias A., Orlandini S., Dubrovsky M., Hlavinka P., Balek J., Eckersten H., Clloppet E., 24. Ohtsuki T., Kaneko Y. and Setoguchi H.; 2011. Calanca P., Gobin A., Vuecetic V., Nejedlik P., Isolated history of the coastal plant Lathyrus Kumar S., Lalic B., Mestre A., Rossi F., Kozyra J., japonicus (Leguminosae) in Lake Biwa, an ancient Alexandro V., Semeradova D. and Zalud Z.; 2011. freshwater lake. AoB PLANTS plr021 Agroclimatic conditions in Europe under climate doi:10.1093/aobpla/plr021. change. Global Change Biology, doi: 10.1111/j.1365-

2486.2011.02396.x. 25. Ouédraogo M., Maquet A., Baudoin J.P.; 2005. Étude comparative de la diversité et de la structure 34. Van de Wouw M., Enneking D., Maxted N. and génétique de populations sauvages de Phaseolus Robertson L. D.; 2001. Genetic resources of lunatus L. à l’aide des marqueurs enzymatiques et Mediterranean Vicia species. Chapter 9 in: Maxted N. microsatellites. Biotechnol. Agron. Soc. Environ. 9 and Bennett S. J. Eds. Plant genetic Resources of (3): 195–205. Legumes in the Mediterranean. pp. 132-157.

Dordrecht; Kluwer. 26. Rong Y.P., Cao Z., Zhu L.L., Zhao M., Zhang Y.J. and Bai K.Y.; 2012. Genetic variation patterns of 35. Yang T., Bao S., Ford R., Jia T., Guan J., He Y., Sun Medicago ruthenica populations from Northern X., Jiang J., Hao J., Zhang X. and Zong X.; 2012. China. African Journal of Biotechnology Vol. 11 High-throughput novel microsatellite marker of faba (22): 6011-6017, Available online at bean via next generation sequencing. BMC http://www.academicjournals.org/AJB. Genomics, doi: 10.1186/1471-2164-13-602