Temporal Expression of Genes in Biofilm-Forming Ocular Candida

Home , Natamycin

Immunology and Microbiology Temporal Expression of Genes in Bioﬁlm-Forming Ocular Candida albicans Isolated From Patients With Keratitis and Orbital Cellulitis

Konduri Ranjith,1 Sama Kalyana Chakravarthy,1 HariKrishna Adicherla,2 Savitri Sharma,1 and Sisinthy Shivaji1 1Jhaveri Microbiology Centre Prof. Brien Holden Eye Research Centre, L V Prasad Eye Institute, L V Prasad Marg, Banjara Hills, Hyderabad, India 2CSIR-Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad, India

Correspondence: Sisinthy Shivaji, PURPOSE. To study antibiotic susceptibility and biofilm-forming potential of ocular isolates of Jhaveri Microbiology Centre, Prof. Candida albicans along with gene expression. Brien Holden Eye Research Centre, L V Prasad Eye Institute, L V Prasad METHODS. Seven clinical isolates of C. albicans (keratitis-6 and orbital cellulitis-1) were Marg, Banjara Hills, Hyderabad evaluated. Biofilm formation in one isolate was monitored by scanning electron microscopy 500034, India; (SEM) and confocal laser scanning microscopy (CLSM). Expression of 27 genes (real-time [email protected]. PCR) associated with biofilm formation and virulence was compared between biofilm-positive Submitted: September 6, 2017 and biofilm-negative ocular C. albicans isolates. The temporal expression (4 to 72 hours) of Accepted: December 5, 2017 the 27 overexpressed genes was also determined. Similar studies were also done with biofilm- positive and biofilm-negative nonocular . Citation: Ranjith K, Kalyana Chakra- C. albicans varthy S, Adicherla H, Sharma S, RESULTS. Four of seven ocular C. albicans isolates exhibited the potential to form biofilm, one Shivaji S. Temporal expression of of which was resistant to three antifungals, whereas three were susceptible to all. SEM studies genes in biofilm-forming ocular Can- indicated that biofilm increased from two to three adherent layers of cells at 24 hours to dida albicans isolated from patients multiple layers by 72 hours. CLSM showed that biofilm thickness increased from 5.2 lmat24 with keratitis and orbital cellulitis. hours to 17.98 lm at 72 hours. Upregulation of 27 genes involved in virulence and biofilm Invest Ophthalmol Vis Sci. 2018;59:528–538. https://doi.org/ formation was observed both in the ocular and nonocular C. albicans positive for biofilm 10.1167/iovs.17-22933 formation and compared to the respective non–biofilm-forming C. albicans. The results also indicated similarity in expression of genes between biofilm-forming ocular and nonocular pathogenic C. albicans. Temporal expression of the 27 genes (involved in adhesion, initiation, maturation, and dispersal stages of biofilm) in the biofilm-positive ocular isolate indicated that expression pattern followed four different patterns.

CONCLUSIONS. This is the ﬁrst study showing similarity in expression of genes in bioﬁlm- forming ocular and nonocular isolates of C. albicans, suggesting that upregulated genes could serve as a potential target for developing therapeutic strategies. Keywords: Candida albicans, biofilm, antimicrobial resistance, expression of genes, ocular yeast, keratitis, orbital cellulitis

eratitis is an inflammatory disease of the eye wherein the negative bacilli and yeast.13 Biofilm-associated strains are K cornea becomes inflamed, making the eye red and painful, known to be more resistant to antimicrobial agents.4,14 Thus, and affecting vision. Keratitis is caused by bacteria, fungi, or it is the right time to devise strategies to overcome antifungal viruses.1 Several species of fungi like Fusarium solani, resistance that may help achieve better treatment outcome. Cladosporium spp., Acremonium spp., Candida albicans, The potential to form biofilms has been demonstrated in and Aspergillus fumigatus2–4 are known to be the causative some ocular fungi (A. fumigatus, C. albicans, F. solani, agents of keratitis. C. albicans causes 10% to 45% of fungal Cladosporium sphaerospermum, and Acremonium implica- ocular infections.1,5,6 Normally, fungi can be treated with tum),15–17 but the molecular mechanism of biofilm formation antifungal agents (such as voriconazole, fluconazole, caspofun- with respect to the genes involved is not established. For gin, and itraconazole), but over time many of these organisms instance, it is known that during biofilm formation in nonocular have become resistant to antifungals7 owing to excessive use of pathogenic C. albicans, genes coding for motility, adhesion to corticosteroids and antibiotics, due to diseases associated with substratum,18–25 efflux pumps,26,27 transcription factors,28–30 immunodeficiency and the ability of fungi to form biofilms on virulence,31–33 EPS production, among others, are upregulated. the surface of contact lenses, intraocular lenses, scleral buckles, Thus, it would be worthwhile to investigate whether similar and suture material.8,9 Biofilm formation has also been detected genes are upregulated in ocular C. albicans organisms, which in patients with infective crystalline keratopathy10;the exhibit resistance to antimicrobial agents and also exhibit the microorganisms involved were C. albicans11 and other capability to form biofilm. Our knowledge about ocular isolates microorganisms12 such as Streptococci and unidentified gram- of fungi with respect to biofilm formation and antibiotic

This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 529

TABLE 1. Clinical Details of Patients With Candida albicans Infection

Medical Treatment Laboratory Age/ Visual Acuity at No. Sex Diagnosis Presentation Topical Systemic Final Visual Acuity

L-726/11 60/F Keratitis PL þ PR accurate Natamycin Ketoconazole PL þ PR inaccurate L-304/12 67/M Orbital cellulitis PL þ PR inaccurate Nil Nil PL þ PR inaccurate L-534/13 66/M Keratitis HM þ PL þ PR accurate Natamycin Nil HM þ PR inaccurate L-1376/13 50/M Keratitis 20/100 Chlorocol Nil CFCF, PL þ PR inaccurate L-664/14 56/M Keratitis CFCF Natamycin Nil CF@1/2m L-2033/14 65/M Keratitis CF@2m Natamycin Ketoconazole HM þ PR inaccurate L-391/15 29/F Keratitis PL þ PR inaccurate Natamycin Nil HM þ PR inaccurate CF, counting ﬁngers; CFCF, counting ﬁngers close to face; F, female; HM, hand movement; M, male; m, meter; PL, perception of light; PR, perception of rays.

resistance is very limited. With this in view, in the present 106 cells/mL) with SDM, and 100 lL of this inoculum was study we chose ocular C. albicans derived from patients with added to a single well of a 96-well tissue culture plate keratitis and orbital cellulitis to assess the biofilm formation (ThermoFisher Scientific, Nunclon, Roskilde, Denmark) already potential and correlation with antifungal sensitivity and to containing 100 lL SDM medium. The plates were incubated at evaluate by real-time PCR whether genes overexpressed during 308C for 48 hours. After incubation, the broth was discarded biofilm formation in nonocular pathogenic C. albicans are also and wells were washed thrice with 200 lL phosphate-buffered overexpressed in ocular C. albicans with a potential to form saline (PBS) (Sigma-Aldrich Corp., St. Louis, MO, USA). Cells biofilm. that adhered to the plate were stained with 200 lL 0.1% crystal This would add to our understanding of ocular C. albicans violet (Sigma-Aldrich Corp.) for 30 minutes and washed thrice with respect to biofilm formation and identification of targets with 200 lL PBS. The crystal violet that had stained the biofilm for overcoming antifungal resistance. was solubilized by adding 200 lL absolute alcohol and the absorbance of the crystal violet solution was spectrophotometrically monitored at 655 nm39 (iMARK microplate reader; MATERIALS AND METHODS Bio-Rad, Shinagawa-ku, Tokyo, Japan). C. albicans ATCC90028, which is biofilm negative, was used as control. The absorbance Isolates of C. albicans (OD) value of the control culture (C. albicans ATCC90028) at 655 nm, following crystal violet staining and washing, was 0.25 Seven isolates of C. albicans, obtained from patients diagnosed and all isolates that had an OD value greater than 0.25 were with microbial keratitis and orbital cellulites, and attending the considered as biofilm-positive strains of C. albicans.All outpatient department of the L V Prasad Eye Institute, experiments were set up in triplicate with incubation at Hyderabad, India, were used. All the cultures were grown in 308C for 2 days. Sabouraud dextrose medium (SDM) (dextrose 20 g and The optimum temperature and pH for biofilm formation peptone 10 g in 1 L distilled water and final pH adjusted to was also determined for ocular C. albicans by using SDM 5.6) at 308C. Clinical features of patients from whom the seven medium of different pH (3.6, 5.6, and 7.6) and incubation at isolates of C. albicans were isolated are shown in Table 1. different temperatures (258,308, and 378C).

Antifungal Susceptibility Profile of Ocular C. Biofilm-Forming Potential of Ocular Isolates of C. albicans albicans by the XTT Method Antibiotic susceptibility of all isolates was performed in Biofilm formation in seven ocular isolates of C. albicans and compliance with CLSI (Clinical and Laboratory Standards two ATCC isolates (ATCC 90028 and ATCC 14053) was also Institute) guidelines, using the broth dilution method34 for 35 36 determined by the XTT ((2,3-bis (2-methoxy-4-nitro-5-sulfo- natamycin (NA) and E-test (BioMerieux,´ Craponne, France) phenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) for amphotericin B (AB), voriconazole (VO), itraconazole (IT), method.40 Briefly, overnight culture was adjusted to 100 lL 0.5 caspofungin (CS), and fluconazole (FL), using Mueller Hinton McF units (5 3 106 cells/mL) by using SDM (pH 5.6) and then agar plates containing 2% glucose with 0.005% methylene blue transferred to one of the wells of the 96-well tissue culture (Himedia, M1825, Mumbai, India). Antibiotic profile pattern of plate (ThermoFisher Scientific, Nonclon) already containing ocular C. albicans isolates was classified as susceptible or 100 lL SDM (pH 5.6). The plate was incubated at 308C for 48 resistant as based on the guidelines of CLSI (M27-S4). Minimum hours. After incubation, the broth was discarded and wells inhibitory concentration (MIC) breakpoints for itraconazole were washed thrice with 200 lL PBS (Sigma-Aldrich Corp.). and natamycin (not available in CLSI guidelines) were noted as Next, 200 lL PBS with 50.5 lL 1 mg/mL XTT (Sigma-Aldrich 36 per published literature. Corp.) and 2.5 lL 0.4 mM of Menadione (Sigma-Aldrich Corp.) were added to each well of the 96-well plates. The plates were Biofilm-Forming Potential of Ocular Isolates of C. incubated in the dark at 378C for 3 hours. One hundred albicans by the Crystal Violet Method microliters of solution from each well was then transferred to the wells of a new plate and calorimetric changes were The potential to form biofilm was assessed for all isolates by measured at 490 nm by using a microplate ELISA reader using the microtiter/tissue culture plate (TCP) method.37,38 (SpectraMax M3; Molecular Devices, Sunnyvale, CA, USA). OD Briefly, overnight culture was adjusted to 0.5 McF units (5 3 of C. albicans ATCC 90028, a biofilm-negative isolate, was used

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 530

as cutoff value (0.1) for determining the biofilm-positive Expression of Candidate Genes in Ocular C. isolates. All experiments were set up in triplicate. albicans L-391/2015 (Biofilm Positive), Ocular C. albicans L-1376/2013 (Biofilm Negative), Biofilm Formation Monitored by SEM Nonocular C. albicans ATCC14053 (Biofilm Sterile 10 3 10-mm sections of overhead projector (OHP) Positive), and Nonocular C. albicans ATCC 90028 sheets (KENT, Secunderabad, India) were used as a substra- (Biofilm Negative) tum for biofilm formation. For this purpose, 100 lL 0.5 McF (5 3 106 cells/mL) of C. albicans organisms was transferred to a RNA was extracted from C. albicans L-391/2015 in the biofilm well of a 16-well tissue culture plate. Subsequently, the 10 3 phase by allowing the organisms to grow on a Petri plate for 48 10-mm OHP sheet was submerged into the medium and hours at 308C as described above. After 48 hours of growth, incubated at 308C in SDM (pH 5.6) for different time intervals planktonic cells were decanted and the biofilm was washed (24, 48, and 72 hours). After incubation, the biofilm adhering thoroughly with PBS. Cells adherent to the Petri plate were to the substratum was fixed with 2.5% glutaraldehyde removed by using a cell scraper (ThermoFisher Scientific, solution for 2 hours and processed for SEM (Model S-3400N; Nunclon) and collected directly in RNAlater (Ambion, Carlsbad, CA, USA) and incubated for 30 minutes. RNA was HITACHI, Minato-ku, Tokyo, Japan). The biofilms were then extracted by using Qiagen (Hilden, Germany) RNA metalized by gold sputtering for 45 seconds in a High isolation kit and converted into cDNA (Takara Prime script 1 Vacuum Evaporator (SC7620 PALARON Sputter Coater; strand cDNA synthesis kit; Takara BIO, Inc., Nojihigashi, Shiga, Quorum Technologies Ltd, Lewes, East Sussex, UK) before Japan). Quality and quantity of RNA were checked by A260/ visualization.39 Experiments were performed in triplicate. A280 value of 1.8 to 2.0 and by visualization of the RNA after electrophoresis on 1.5% agarose gel. RNA was also extracted Visualization of Biofilm by CLSM from non–biofilm-forming ocular C. albicans L-1376/2013 (as a control), which was allowed to grow for 48 hours at 308C. To Biofilm thickness was measured by CLSM as described.39 compare the expression of genes between ocular and non- Briefly, 100 lL 0.5 McF (5 3 106 cells/mL) of C. albicans ocular C. albicans, RNA was also extracted from nonocular C. organisms was added and allowed to grow on a sterile OHP albicans ATCC 14053 (biofilm positive) and nonocular ATCC sheet (KENT) for different time intervals (4, 12, 24, 48, and 72 90028 (biofilm negative). hours) at 30 C in SDM broth, pH 5.6, or RPMI (Roswell Park 8 RT-PCR was then used for monitoring the expression of 27 Memorial Institute) medium (Himedia, Secunderabad, India). different genes coding for adhesion (ALS1, HWP1, ECE1, Sterile 10 10-mm sections of OHP sheet were used for 3 EAP1, and OCH1) and transcription factors required for biofilm biofilm formation. After incubation, OHP sheet was washed formation (EFG 1, ACE2, CPH1, TUP1,andZAP1); and with PBS, fixed with 4% formaldehyde (Himedia) for 45 virulence genes coding for transferase activity (MNT4 and minutes and stained with 100 lL3.3lMSyto9nuclear MNT2), drug transmembrane transport (MDR1), aspartyl fluorescent dye (ThermoFisher Scientific, Eugene, OR, USA). proteinases (SAP1, SAP2, SAP3, SAP4, SAP5, SAP6, SAP7, Confocal images were taken with the Zeiss confocal laser SAP8, and SAP9), phospholipases (PLB1, PLB2, PLC, and scanning microscope (LSM 510; Carl Zeiss Promenade, Jena, PLD), and ATPases (PMR1). The primers used for the above Germany). Argon laser excited at 450 to 490 nm was used 39 genes were as reported for nonocular pathogenic C. albicans with an 340 objective and Zoom 2. Experiments were (Table 2) and amplification conditions were as follows: 508C performed in triplicate. for 2 minutes, 40 cycles (958C for 30 seconds, 608C for 1 minute). The results were compared between C. albicans L- Antifungal Susceptibility of C. albicans L-391/2015 391/2015 and C. albicans L-1376/2013 to identify the Before and After Biofilm Formation differential regulation of genes during biofilm formation. Relative expression of genes was calculated by the DDCT Antifungal susceptibility of the seven ocular isolates of C. method.42 Only genes that showed >2.0-fold expression with a albicans to NA, AB, VO, IT, CS, and FL was determined by P value < 0.05 were considered as significantly differentially using the broth dilution method. Overnight culture of C. expressed. Expression of EFB1 gene coding for elongation albicans was diluted to 0.5 McF (5 3 106 cells/mL) with SDM factor B was used as an internal standard. All values reported and 100 lL was transferred to a well of a 96-well plate and represent the mean of three independent experiments. incubated at 308C. To determine the MIC of the six different Expression of genes in nonocular C. albicans ATCC 14053 antifungal agents before biofilm formation, the agent was (biofilm positive) and ATCC 90028 (biofilm negative) was also added to the culture at the start of the incubation of the plate determined as above. Finally, the gene expression was at 308C. The antifungal agents were dissolved in SDM broth and compared between the biofilm-positive ocular and nonocular added to the wells. Each concentration of an agent was tested strains of C. albicans. in triplicate. The minimum concentration at which no growth was observed, as determined spectrophotometrically, was Temporal Expression of Candidate Genes in C. determined as the MIC of the antifungal agent. albicans L-391/2015 (Biofilm Positive) During To determine the MIC of the six antifungal agents after biofilm formation, the ocular C. albicans organisms were Biofilm Formation incubated in the 96-well plate as above at 308C for 48 hours to RNA was extracted from biofilm phase of C. albicans L-391/ allow biofilm formation. After this incubation period the 2015 incubated for 4, 12, 24, 48, and 72 hours and used as the medium was decanted, the biofilm washed thrice with Milli Q source of cDNA preparation. Biofilm cells were grown as in the water, and the antifungal agent dissolved in SDM broth was abovementioned protocol, and RNA was isolated and convert- added to the wells and incubated for another 16 hours. Biofilm ed into cDNA. The expression of 27 genes was monitored by was then quantified by the crystal violet method (as described RT-PCR to evaluate the temporal expression of the genes above) in presence and absence of antibiotic in triplicate. This during biofilm formation. Expression of cells harvested after 4 method is similar to that described41 for determining the effect hours was used as a control, since biofilm formation was not of antifungal agents in the biofilm phase. visible at this time.

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 531

TABLE 2. Primers Used for RT-PCR of Genes Involved in Bioﬁlm Development in Ocular C. albicans

Serial Number Gene Sequence (50-30) Molecular Function Reference

1 EFG1 F- TGCCAATAATGTGTCGGTTG Transcription 56 R- CCCATCTCTTCTACCACGTGTC 2 ACE2 F- AGAATTGACCGTTGTCCGTGTAAG Transcription 68 R- AATGGGTGAATAAATCCCTCCCTAA 3 ECE1 F- GTCGTCAGATTGCCAGAAATTG Adhesion 56,68 R- CTTGGCATTTTCGATGGATTGT 4 EAP1 F- TGTGATGGCGGTTCTTGTTC Cell wall–related proteins 21,56 R- GGTAGTGACGGTGATGATAGTGACA 5 HWP1 F- CGGAATCTAGTGCTGTCGTCTCT Cell wall–related proteins 21,56 R- CGACACTTGAGTAATTGGCAGATG 6 SAP1 F- GAACCAAGGAGTTATTGCCAAGA Aspartyl proteases 21 R- TTTGTCCAGTGGCAGCATTG 7 SAP2 F- GTCACTTTAAAAAAACAAGGAGTCATTG Aspartyl proteases 21 R- TATTTGTCCCGTGGCAGCAT 8 SAP3 F- CAGCTTCTGAATTTACTGCTCCATT Aspartyl proteases 21 R- TCCAAAAAGAAGTTGACATTGATCA 9 SAP4 F- CGCTGGTGTCCTCTTAGATTCTG Aspartyl proteases 21 R- AGGCATAGATAATGCTACGAGCAA 10 SAP5 F- CCAGCATCTTCCCGCACTT Aspartyl proteases 21 R- TTTAGCGTAAGAACCGTCACCAT 11 SAP6 F- GATTGTAAAACTTCAGGTACCGTTGA Aspartyl proteases 21 R- CGAAGCAGGAACGGAGATCT 12 SAP7 F- TTCTCGTGATGCTGTCCAAG Aspartyl proteases 21 R- AAAGCCTTCAAATCCCCAGT 13 SAP8 F- GGTGTTAGTAGAGATCTGGCCACTATT Aspartyl proteases 21 R- GGTGTTCCCATCAAGATCATAAACT 14 SAP9 F- TTCGGGTTCAGGAACAACATCT Aspartyl proteases 21 R- GCTGAATGACGTGTGCTGGTA 15 PLB1 F- GGTGGAGAAGATGGCCAAAA Phospholipase 21 R- AGCACTTACGTTACGATGCAACA 16 PLB2 F- TGAACCTTTGGGCGACAACT Phospholipase 21 R- GCCGCGCTCGTTGTTAA 17 PLC F- AGCCACCAATTGGCAAACTTA Phospholipase 21 R- ACTGCTTGATTTTAAAGTTGGTTTCC 18 PLD F- TGTTTACGGTGAAGGGTTGGA Phospholipase 69 R- CACTGCTAACCCTTGCTCTCTTG 19 CPH1 F- ACGCAGCCACAAGCTCTACT Transcriptional factor 70 R- GTTGTGTGTGGAGGTTGCAC 20 ZAP1 F- CGACTACAAACCACCAGCTTCATC Zinc response regulator 55 R- CCCCTGTTGCTCATGTTTTGTT 21 ALS1 F- CCTATCTGACTAAGACTGCACC Cell surface protein 71 R- ACAGTTGGATTTGGCAGTGGA 22 MDR1 F- TCAGTCCGATGTCAGAAAATGC Major facilitator transporter 69,72 R- GCAGTGGGAATTTGTAGTATGACAA 23 MNT2 F- CGTCAAGGTGCCTGAAGAAT Glycotransferase 55 R- GAGGAGGAGGAGGATTTTGG 24 MNT4 F- TGAGCAATCGTCAAAACCAG Glycotransferase 55 R- GGCGGTTGTCATTTGTTGAT 25 PMR1 F- GAATCCCCGCAGACATTAGA ABC transporter 55 R- GGGCCTGTTTTCACCAGTTA 26 OCH1 F- TCATCCAATGTTGCGTGAAT Membrane protein 55 R- TCATGATATCGCCACCTTCA 27 TUP1 F- GCTTCAGGTAACCCATTGTTGAT Transcriptional repressor 69 R- CTTCGGTTCCCTTTGAGTTTAGG 28 EFB1 F- AAGAAGGCTGCTAAAGGTCCAA Housekeeping gene 21 F, forward; R, reverse.

RESULTS antifungal drugs tested. Biofilm-forming potential was assessed by using the microtiter/TCP and XTT methods. The results indicated Antibiotic Susceptibility and Biofilm Formation in that four of seven isolates of ocular C. albicans (L-391/2015, L- Ocular C. albicans 534/2013, L-664/2014, and L-2033/2014) were positive for Three of seven isolates of C. albicans, namely, L-391/2015, L-726/ biofilm formation by both the crystal violet and XTT methods. 2011, and L-2033/2012, were resistant to one or more of the six This included L-391/2015 and L-2033/2013, which were resistant

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 532

TABLE 3. Susceptibility of Seven Ocular C. albicans Isolates to Six Different Antifungal Agents

Laboratory Number AB IT VO CS FL NA

L-726/2011 0.094 (S) 8 (R) 0.25 (S) 0.38 (S) 128 (R) 8.00 (S) L-304/2012 0.094 (S) 0.5 (S) 0.064 (S) 0.064 (S) 2 (S) 8.00 (S) L-534/2013 0.125 (S) 0.5 (S) 0.016 (S) 0.064 (S) 2.00 (S) 4.00 (S) L-1376/2013 0.25 (S) 0.25 (S) 0.032 (S) 0.125 (S) 1.00 (S) 8.00 (S) L-664/2014 0.25 (S) 0.19 (S) 0.023 (S) 0.032 (S) 2.00 (S) 8.00 (S) L-2033/2014 0.094 (S) 0.75 (R) 0.094 (S) 0.125 (S) 16 (R) 16 (S) L-391/2015 0.38 (S) 16 (R) 8 (R) 2 (R) 4.00 (S) 16 (S) R, resistant; S, susceptible. * Values above are in lg/mL. MIC of the six antibiotics as per the CLSI guidelines in lg/mL are AB 1, IT 0.5, VO 0.75, CS 0.5, FL 4, and NA 16. This included L-391/2015, which was resistant to three antifungals, and L-534/2013, L-664/2014, and L-2033/2014, which were susceptible to the six antifungals.

to three and two antifungals, respectively, and L-534/2013 and L- biofilm formation. In general it was observed that the MIC of an 664/2014, which were susceptible to the six antifungals (Table 3). antifungal agent required to kill C. albicans L-391/2015 in the C. albicans L-391/2015 was the best biofilm producer (Fig. 1), and planktonic phase was 100 to 200 times less than the MIC for the optimum conditions for biofilm formation were observed to biofilm cells. For instance, the MIC of AB was 1 lg/mL before be pH 5.6 and 308C incubation temperature (data not shown). biofilm formation (Fig. 4A) and in the biofilm phase it increased to 200 lg/mL (Fig. 4B); in the same manner, the MIC was as Biofilm Formation in C. albicans L-391/2015 follows for IT (16 lg/mL and 3.2 mg/mL before and after biofilm formation, respectively), CS (2 lg/mL and 0.2 mg/mL), Monitored by SEM and CLSM NA (16 lg/mL and 1.6 mg/mL), and VO (8 lg/mL and 0.8 mg/ Biofilm formation in C. albicans L-391/2015 grown on an OHP mL) (Figs. 4A, 4B). sheet at 308C for 24, 48, and 72 hours when processed for SEM indicated progressive deposition of biofilm, from two to three Expression of Candidate Genes in C. albicans L- adherent layer of cells at 24 hours (Fig. 2A) to a multiple layered 391/2015 (Biofilm Positive) and C. albicans L- (8–10 layers) structure by 72 hours (Fig. 2C). CLSM also confirmed luxuriant growth of biofilm by 72 hours of incubation (Fig. 3A) 1376/2013 (Biofilm Negative) and concurrently,the thickness increased from 4.65 lm at 4 hours The purpose of the study was to compare the expression of 27 to 17.98 lm at 72 hours (Fig. 3B), after which the thickness genes associated with biofilm formation and virulence between decreased at 96 hours. It may also be noted that the clumping of biofilm-positive ocular C. albicans and biofilm-positive non- cells seen from 24 to 96 hours is also facilitated by the extra ocular C. albicans. For this purpose, by RT-PCR we determined polymeric secretion, which masks the morphology of the cells. the genes that were up- or downregulated in the ocular biofilm- forming C. albicans L-391/2015 by using ocular C. albicans L- Antifungal Susceptibility of C. albicans L-391/2015 1376/2013 (biofilm negative) as the control; we also deter- Before and After Biofilm Formation mined the expression of the 27 above genes in nonocular biofilm-forming C. albicans (ATCC 14053) by using the Antifungal susceptibility of C. albicansL-391/2015 to six nonocular biofilm-negative C. albicans (ATCC 90028) as the different antifungal drugs was monitored before and after control. The results indicated that all the 27 genes were

FIGURE 1. Biofilm formation in seven ocular isolates of Candida albicans from corneal scrapings (keratitis) and pus (orbital cellulitis) evaluated by tissue culture plate method (A)andXTTmethod(B). C. albicans L-534/2013, L-664/2014, L-2033/2014, and L-391/2015 were positive for biofilm formation. OD of C. albicans ATCC 90028 by crystal violet (0.25) and XTT method (0.1) is considered as cutoff for determining the biofilm-positive isolates.

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 533

FIGURE 2. Biofilm formation of C. albicans L-391/2015 on the surface of an OHP sheet in SDM medium after 24 (A), 48 (B), and 72 (C) hours of biofilm growth as monitored by scanning electron microscopy. Scale bar:20lm. Images were taken at a magnification of 32.5K. The black dot represents the layers in the biofilm from the substratum to the top of the biofilm. There are three, five, and nine layers visible at 24 (A), 48 (B), and 72 (C) hours.

significantly overexpressed in the ocular biofilm-forming C. Temporal Gene Expression During Different albicans in the biofilm phase (L-391/2015) as compared to Stages of Biofilm Formation in C. albicans L-391/ their respective controls (L-1376/2013). In the nonocular C. 2015 albicans ATCC 14053 in the biofilm phase, 24 genes were upregulated as compared to the respective control (ATCC Time-dependent expression of 27 of the above genes encoding 90028). The remaining three genes were neither up- nor for biofilm formation, drug resistance, transcription factors, adhesion, and virulence was monitored in C. albicans L-391/ downregulated in the nonocular biofilm-forming as C. albicans 2015 by teal-time PCR using cells grown for 4 hours as a compared to the control (Table 4). The three genes that were control, since at 4 hours no biofilm formation was detected not overexpressed in the nonocular C. albicans in the biofilm (Fig. 5). In biofilm cells, the expression of genes varied phase include ACE2, CPH1, and SAP6. Only genes that showed depending on the gene and the time of biofilm formation (12– >2.0 fold-increase in expression with a P value < 0.05 were 72 hours). The expression followed four different patterns. In considered as significantly differentially expressed. pattern 1, five genes, namely, SAP3, SAP7, PLD, PLB1, ALS1,

FIGURE 3. (A) Biofilm formation in ocular C. albicans L-391/2015 grown on OHP sheet in RPMI medium for 4, 12, 24, 48, 72, and 96 hours and monitored by confocal laser scanning microscope. (B) Z stack represents the thickness of biofilm at different time points (4, 12, 24, 48, 72, and 96 hours) of biofilm growth. Biofilm was stained with Syto9 dye. All images in (A) and (B) were acquired at a magnification of 340 with zoom scale 2. Scale bar:10lm.

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 534

FIGURE 4. Antifungal susceptibility of C. albicans L-391/2015 before (A) and after (B) biofilm formation. In (B) x-axis represents the MIC concentration of the above six antifungal agents at 10, 100, and 200 times the MIC concentration (10X, 100X, and 200X, respectively) as determined in (A). MIC of amphotericin B was 1 lg/mL before biofilm formation (A) and in the biofilm phase it increased to 200 lg/mL (B). (A, B) In the same manner, the MIC was as follows for itraconazole (16 lg/mL and 3.2 mg/mL before and after biofilm formation, respectively), caspofungin (2 lg/mL and 0.2 mg/mL), fluconazole (8 lg/mL and 3.2 mg/mL), natamycin (16 lg/mL and 1.6 mg/mL), and voriconazole (8 lg/mL and 0.8 mg/mL).

and ACE2, showed no significant change in expression Earlier studies using nonocular isolates of C. albicans have between 12 and 72 hours as compared to the 4-hour cells reported that biofilm confers high level of resistance to (Fig. 5A). In pattern 2, four genes, namely, PMR1, SAP1, TUP1, antifungals, notably the azoles and polyenes. This has been and SAP2, showed more than 2.0-fold expression between 12 attributed to the elevated expression of several genes51,52 like and 72 hours (Fig. 5B). In pattern 3, eleven genes, namely, the azole efflux genes CDR1, CDR2, and MDR110,26,27; the HWP1, PLC, OCH1, MNT4, MDR1, PLB2, SAP5, EFG1, EAP1, genes that are implicated in adhesion like ALS1, HWP1, EAP1, 18–25 MNT2, and ECE1, showed more than 2.0-fold expression at up ECE1, and OCH1 ; genes coding for several secreted to 48 hours and increased significantly at 72 hours (P 0.05) enzymes crucial for host tissue invasion and nutrient acquisi- tion31 like the secreted aspartyl proteinases (SAPs)and (Fig. 5C). In pattern 4, six genes, namely, ZAP1, SAP8, SAP4, 21,32,33 SAP9, SAP6, and CPH1, showed increased expression from 24 phospholipases (PLB, PLC,andPLD) ; and several to 72 hours. All the upregulated genes showed more than 2- transcriptional regulators like EFG1, TEC1, BCR1, NDT80, BRG1, ROB1, ACE2, ZAP1, and TUP1 required for biofilm fold increases in expression with a P value 0.05 as compared 28–30 53 to the expression in 4-hour cells (Fig. 5D). Thus, it is obvious development. Fox et al. have demonstrated that three that genes that are required for biofilm formation, drug new regulators, FLO8, GAL4, and RFX2, also play distinct roles during biofilm development over time. The present study resistance, and virulence exhibit differential temporal expres- confirms increased expression of several of the above genes sion patterns in ocular C. albicans L-391/2015. like MDR1, ALS, HWP1, ECE1, EAP1, SAPs 1–9, PLB1, PLB2, PLC, PLD, EFG1, ACE2, ZAP1, CPH1, and TUP1 in biofilm- forming ocular C. albicans L-391/2015, which was resistant to DISCUSSION two different azole antifungal agents as compared to the ocular Our results indicate that of seven ocular isolates of C. albicans, C. albicans L-1376/2013, which does not possess the capacity four were biofilm positive and only two of these biofilm- to form a biofilm and is sensitive to the six antifungals tested. positive isolates were resistant to at least two or more of the six We also observed increased expression of glycotransferase genes MNT2 and MNT454 and PMR1, the ABC transporter antifungals tested. The other two isolates, namely, C. albicans 55 L-534/2013 and L-664/2014, were sensitive to all the six gene. We also compared the expression of the above 27 antifungals tested and yet formed a biofilm. Thus, our data genes (Table 4) in ocular C. albicans and nonocular C. albicans would indicate that biofilm formation is not tightly associated in the biofilm phase and observed that 24 of the 27 genes were overexpressed in both strains of in the biofilm with antibiotic resistance in C. albicans, as observed in earlier C. albicans 43 phase. Only three genes (ACE2, CPH1, and SAP6) were neither studies on ocular Candida and non-Candida isolates, up- nor downregulated in the nonocular biofilm-forming C. showing that non–biofilm-forming isolates are resistant to albicans. Other genes with similar function may be compen- antifungals. Similar studies on have Acinetobacter baumannii sating for their activity. Overall these studies would indicate also demonstrated that of 63 strong biofilm makers, 79.4% are 44 that expression of genes related to biofilm formation and non–multidrug-resistant strains. antimicrobial resistance are similar in ocular and nonocular C. C. albicans L-391/2015 was the best biofilm producer, and albicans. the thickness of the biofilm increased with time of incubation In nonocular pathogenic C. albicans, biofilm development from 24 to 72 hours as judged both by SEM and CLSM. occurs in a series of four sequential steps. The first step is However, by 96 hours of growth, biofilm thickness was adhesion when single cells adhere to the substratum, followed reduced and appeared to be less dense and more dispersed; by the initiation step when cells proliferate and produce in the confocal micrographs, the biofilm at 96 hours revealed hyphae. Initiation is followed by the maturation step when the single cells of C. albicans, implying the occurrence of biofilm cells get embedded in an extracellular polymeric substance and dispersal cells.15,28,45–50 This study also confirms that biofilm- finally they enter the dispersal phase when yeast cells are forming cells in the biofilm phase are 100 to 200 times more released to seed new biofilms.15,28,45–50 From the above resistant to antifungals as compared to the planktonic cells. criteria, in ocular C. albicans the adhesion step extends up This is in accordance with earlier studies on pathogenic C. to 12 hours when cells adhere to the substratum, followed by albicans18 and other fungi.4,14 the initiation step up to 48 hours when hyphae are prominent,

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 535

TABLE 4. Comparison of the Genes Overexpressed in Ocular Bioﬁlm-Positive C. albicans L-391/2015 Versus Nonocular Bioﬁlm-Positive C. albicans ATCC 14053

Fold Change in Ocular Biofilm-Positive Fold Change in Nonocular Biofilm-Positive C. albicans L-391/2015 vs. Ocular Biofilm-Negative C. albicans ATCC 14053 vs. Nonocular Biofilm-Negative S. No. Gene C. albicans L-13762013 C. albicans ATCC 90028

Transcription factor 1 EFG1 4.73 6 1.13 (P ¼ 0.012) 2.68 6 0.58 (P ¼ 0.0174) 2 ACE2 2.12 6 0.16 (P ¼ 0.0547) 1.193 6 0.289 (P ¼ 0.076) 3 CPH1 4.44 6 1.43 (P ¼ 0.0149) 0.273 6 0.277 (P ¼ 0.054) 4 TUP1 8.16 6 1.68 (P ¼ 0.0503) 3.768 6 0.994 (P ¼ 0.044) 5 ZAP1 5.02 6 1.55 (P ¼ 0.02) 2.452 6 0.533 (P ¼ 00027) Virulence genes 6 MNT4 2 6 0.58 (P ¼ 0.0102) 2.039 6 0.466 (P ¼ 0.00225) 7 MNT2 9.73 6 1.4 (P ¼ 0.042) 2.85 6 0.278 (P ¼ 0.009) 8 MDR1 7.03 6 1.94 (P ¼ 0.048) 2.54 6 0.133 (P ¼ 0032) Phospholipase gene 9 PLB1 2.24 6 0.63 (P ¼ 0.035) 4.397 6 0.576 (P ¼ 0.0023) 10 PLB2 2.57 6 0.56 (P ¼ 0.025) 4.289 6 0.21 (P ¼ 0.0031) 11 PLC 2.99 6 0.6 (P ¼ 0.04) 2.776 6 0.28 (P ¼ 0.0083) 12 PLD 5.13 6 0.55 (P ¼ 0.05) 2.536 6 0.099 (P ¼ 0.024) Adhesion 13 ALS1 5.35 6 0.73 (P ¼ 0.0412) 2.03 6 0.2 (P ¼ 0.0042) 14 HWP1 3.79 6 0.19 (P ¼ 0.036) 5.34 6 0.211 (P ¼ 0.05) 15 ECE1 2.61 6 0.09 (P ¼ 0.05) 2.021 6 0.777 (P ¼ 0.05) 16 EAP1 2.14 6 0.57 (P ¼ 0.05) 4.69 6 0.325 (P ¼ 0.005) 17 OCH1 10.67 6 1.67 (P ¼ 0.048) 2.039 6 0.258 (P ¼ 0.0056) Aspartyl proteinase gene family 18 SAP1 3.77 6 0.63 (P ¼ 0.0126) 2.447 6 3.577 (P ¼ 0.085) 19 SAP2 3.28 6 0.66 (P ¼ 0.029) 2.36 6 1.15 (P ¼ 0.0352) 20 SAP3 9.99 6 0.69 (P ¼ 0.0012) 3.797 6 0.542 (P ¼ 0.0175) 21 SAP4 5.23 6 0.48 (P ¼ 0.054) 3.65 6 0.229 (P ¼ 0.0507) 22 SAP5 3.87 6 1.28 (P ¼ 0.0171) 2.98 6 0.381 (P ¼ 0.012) 23 SAP6 3.13 6 0.69 (P ¼ 0.0249) 1.327 6 0.641 (P ¼ 0.052) 24 SAP7 6.89 6 0.7 (P ¼ 0.0164) 25.003 6 0.302 (P ¼ 0.00478) 25 SAP8 4.24 6 0.11 (P ¼ 0.050) 4.58 6 0.472 (P ¼ 0.0145) 26 SAP9 2.47 6 0.28 (P ¼ 0.0284) 4.18 6 0.256 (P ¼ 0.024) 27 PMR1 6.92 6 0.53 (P ¼ 0.05) 6.946 6 0.6 (P ¼ 0.0082) Only those genes that showed more than 2-fold decrease or increase in expression and a P value 0.05, compared to the respective control, were considered as differently expressed.

then the maturation step up to 72 hours when the yeast cells (ACE2)—showed less than 2-fold increase in expression up or hyphae get embedded in an extracellular polymeric matrix to 72 hours. Though ALS47,48 has been implicated in the and are not clearly visible, and finally, the dispersal phase up to adhesion phase, the other four genes—SAP3, SAP7, PLD, 96 hours when the biofilm appears to be fragmented and a few PLB1—and ACE2 with similar expression pattern are not single cells are visible (Fig. 3A). involved in adhesion. SAP genes (SAP1–SAP10) are known to Temporal expression of genes during biofilm formation has be differentially regulated in yeast during biofilm formation,31 helped to delineate the expression of genes during the four and the SAP genes along with PLB genes have a key role in different phases. According to Finkel and Mitchell,56 in yeast colonization58,59 and contribute to the pathogenesis of C. pathogenic C. albicans, EAP1 and ALS1 are expressed in the albicans.21,32,33 In accordance with these early reports in adhesion phase to bind to the substrate, ALS3 and HWP1 in the ocular C. albicans, the expression of SAP5, PLC, and PLB2 was initiation phase to mediate cell–cell binding, ZAP1 in the also upregulated in the biofilm cells and the genes were maturation phase characterized by accumulation of extracellu- significantly overexpressed at 72 hours compared to 12 to 48 lar polymeric substance, and the transcription regulators hours of biofilm phase, implying that these genes are required UME6, PES1, and NRG1 are expressed in the dispersal phase in the maturation phase. In addition, the pattern of expression when the biofilm releases cells that seed new biofilms. In of HWP1, OCH1, MNT4, MDR1, EFG1, EAP1, MNT2, and ECE1 ocular C. albicans three of the four adhesion genes, namely, was also similar, implying that these genes are also required in HWP1, ECE1, and EAP1, but not ALS,47,48 showed significant the maturation phase. EFG1, which is a transcription factor upregulation at 12 hours and beyond, up to 72 hours, implying and regulates HWP1, also exhibits a similar expression these regulate binding to the substratum all through the pattern.60,61 The increased expression of HWP1 in biofilm biofilm phase. Chandra et al.,18 Samaranayake et al.,21 and Zhao cells is in accordance with that reported by Samaranayake et et al.57 have also earlier demonstrated that ALS1 was not al.21 It is suggested that HWP1 is required for filamentation, overexpressed at the adhesion phase. In addition to ALS1, it normal biofilm formation, and virulence.62 Earlier studies have was observed that five other genes—coding for the secreted indicated increased expression of MDR163 and other drug- enzymes aspartyl proteinases (SAP3 and SAP7), phospholipas- resistant genes like CDR1, CDR2,andFLU1 in biofilm- es (PLD and PLB1), and one involved in transcription associated C. albicans cells compared to planktonic cells26

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 536

FIGURE 5. Temporal expression of genes in C. albicans L-391/2015 during bioﬁlm formation between 12 and 72 hours as compared to expression at 4 hours. Expression of genes greater than 2.0-fold (and P < 0.05) over the expression at 4 hours is indicated with an asterisk. A, B, C, and D represent the different patterns of expression of the genes during bioﬁlm formation (see Results for details).

and in vivo.64,65 The expression of four genes, namely, SAP1, as potential targets for overcoming biofilm formation and SAP2, PMR1, and of TUP1 was upregulated from 12 to 72 concurrent resistance to antifungal agents. hours, implying that they are required from adhesion to maturation phase. An earlier study has demonstrated that TUP1 Acknowledgments is upregulated in farnesol-treated biofilms.30 In ocular C. albicans, the ZAP1 gene, which is a Zinc-response transcrip- The authors thank Indumathi Mariappan, MSc, PhD, and Vinay tion factor, was the only gene that showed increased Kumar for their help with the use of the confocal laser scanning expression all through the biofilm formation phase, with microscope. greater increase in expression between 48 and 72 hours of Presented at the annual meeting of the Association for Research in biofilm formation, and may thus be required for maturation Vision and Ophthalmology (Program No. 5786, Poster Board No. phase/dispersal phase. In C. albicans, ZAP1 is a negative B0338), Baltimore, Maryland, United States, May 2017. regulator of a major matrix component54 and is required for Supported by DST-SERB grant from the Government of India (SiS). 66,67 efficient hyphae formation. Disclosure: K. Ranjith, None; S. Kalyana Chakravarthy, None; Our results confirm earlier studies that ALS1, HWP1, OCH1, H. Adicherla, None; S. Sharma, None; S. Shivaji, None MNT4, MDR1, EFG1, ZAP1, PLB1, and SAP7 are associated with biofilm formation. In addition, this study on ocular C. References albicans also identified other genes such as SAP1 and PMR1 in the adhesion phase; PLC, PLB2, and SAP5 for initiation and 1. Gopinathan U, Sharma S, Garg P, Rao GN. Review of dispersal phases; and ACT1, PLD, and SAP3 all through the epidemiological features, microbiological diagnosis and treat- biofilm formation phase. ment outcome of microbial keratitis: experience of over a In conclusion, ocular C. albicans organisms isolated from decade. Indian J Ophthalmol. 2009;57:273–279. patients diagnosed with microbial keratitis and cellulitis exhibit 2. Bharathi MJ, Ramakrishnan R, Vasu S, Meenakshi R, Palaniap- differential susceptibility to antifungals, and some have the pan R. Epidemiological characteristics and laboratory diagno- potential to form a biofilm. In the biofilm phase C. albicans sisoffungalkeratitis:athree-yearstudy.Indian J was 100 times more resistant to antifungals than the planktonic Ophthalmol. 2003;51:315–321. phase cells. Several genes associated with biofilm formation, 3. Ramage G, Mowat E, Jones B, Williams C, Lopez-Ribot J. Our drug resistance, and virulence were upregulated in biofilm- current understanding of fungal biofilms. Crit Rev Microbiol. forming C. albicans compared to the non–biofilm-forming C. 2009;35:340–355. albicans. Temporal expression of genes in biofilm-forming C. 4. Sengupta J, Saha S, Khetan A, Sarkar SK, Mandal SM. Effects of albicans helped to identify potential genes involved in lactoferricin B against keratitis-associated fungal biofilms. J different phases of biofilm formation; such genes could serve Infect Chemother. 2012;18:698–703.

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 537

5. Saha S, Banerjee D, Khetan A, Sengupta J. Epidemiological 26. Mukherjee PK, Chandra J, Kuhn DM, Ghannoum MA. profile of fungal keratitis in urban population of West Bengal, Mechanism of fluconazole resistance in Candida albicans India. Oman J Ophthalmol. 2009;2:114–118. biofilms: phase-specific role of efflux pumps and membrane 6. Tanure MA, Cohen EJ, Sudesh S, Rapuano CJ, Laibson PR. sterols. Infect Immun. 2003;71:4333–4340. Spectrum of fungal keratitis at Wills Eye Hospital, Philadel- 27. Rajendran R, Mowat E, McCulloch E, et al. Azole resistance of phia, Pennsylvania. Cornea. 2000;19:307–312. Aspergillus fumigatus biofilms is partly associated with 7. Sharma S. Diagnosis of fungal keratitis: current options. efflux pump activity. Antimicrob Agents Chemother. 2011; Expert Opin Med Diagn. 2012;6:449–455. 55:2092–2097. 8. Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a 28. Nobile CJ, Fox EP, Nett JE, et al. A recently evolved common cause of persistent infections. Science. 1999;284: transcriptional network controls biofilm development in 1318–1322. Candida albicans. Cell. 2012;148:126–138. 9. Zegans ME, Becker HI, Budzik J, O’Toole G. The role of 29. Finkel JS, Xu W, Huang D, et al. Portrait of Candida albicans bacterial biofilms in ocular infections. DNA Cell Biol. 2002;21: adherence regulators. PLoS Pathog. 2012;8:e1002525. 415–420. 30. Ramage G, Saville SP, Thomas DP, Lopez-Ribot JL. Candida 10. Fulcher TP, Dart JK, McLaughlin-Borlace L, Howes R, biofilms: an update. Eukaryot Cell. 2005;4:633–638. Matheson M, Cree I. Demonstration of biofilm in infectious 31. Naglik JR, Challacombe SJ, Hube B. Candida albicans crystalline keratopathy using ruthenium red and electron secreted aspartyl proteinases in virulence and pathogenesis. microscopy. Ophthalmology. 2001;108:1088–1092. Microbiol Mol Biol Rev. 2003;67:400–428. 11. Elder MJ, Matheson M, Stapleton F, Dart JK. Biofilm formation 32. Leidich SD, Ibrahim AS, Fu Y, et al. Cloning and disruption of in infectious crystalline keratopathy due to Candida albi- caPLB1, a phospholipase B gene involved in the pathogenicity cans. Cornea. 1996;15:301–304. of Candida albicans. J Biol Chem. 1998;273:26078–26086. 12. Georgiou T, Qureshi SH, Chakrabarty A, Noble BA. Biofilm 33. Theiss S, Ishdorj G, Brenot A, et al. Inactivation of the formation and coccal organisms in infectious crystalline phospholipase B gene PLB5 in wild-type Candida albicans keratopathy. Eye (Lond). 2002;16:89–92. reduces cell-associated phospholipase A2 activity and atten- 13. Bispo PJ, Haas W, Gilmore MS. Biofilms in infections of the uates virulence. Int J Med Microbiol. 2006;296:405–420. eye. Pathogens. 2015;4:111–136. 34. Pfaller MA, Diekema DJ. Progress in antifungal susceptibility 14. Imamura Y, Chandra J, Mukherjee PK, et al. Fusarium and testing of Candida spp. by use of Clinical and Laboratory Candida albicans biofilms on soft contact lenses: model Standards Institute broth microdilution methods, 2010 to development, influence of lens type, and susceptibility to 2012. J Clin Microbiol. 2012;50:2846–2856. lens care solutions. Antimicrob Agents Chemother. 2008;52: 171–182. 35. Pradhan L, Sharma S, Nalamada S, Sahu SK, Das S, Garg P. Natamycin in the treatment of keratomycosis: correlation of 15. Zhang X, Sun X, Wang Z, Zhang Y, Hou W. Keratitis-associated treatment outcome and in vitro susceptibility of fungal fungi form biofilms with reduced antifungal drug susceptibil- isolates. Indian J Ophthalmol. 2011;59:512–514. ity. Invest Ophthalmol Vis Sci. 2012;53:7774–7778. 36. Motukupally SR, Nanapur VR, Chathoth KN, et al. Ocular 16. Beauvais A, Schmidt C, Guadagnini S, et al. An extracellular infections caused by Candida species: type of species, in matrix glues together the aerial-grown hyphae of Aspergillus vitro susceptibility and treatment outcome. Indian J Med fumigatus. Cell Microbiol. 2007;9:1588–1600. Microbiol. 2015;33:538–546. 17. Muller¨ FM, Seidler M, Beauvais A. Aspergillus fumigatus biofilms in the clinical setting. Med Mycol. 2011;49(suppl 1): 37.RamageG,VandeWalleK,WickesBL,Lopez-RibotJL. S96–S100. Standardized method for in vitro antifungal susceptibility testing of Candida albicans biofilms. Antimicrob Agents 18. Chandra J, Kuhn DM, Mukherjee PK, Hoyer LL, McCormick T, Chemother. 2001;45:2475–2479. Ghannoum MA. Biofilm formation by the fungal pathogen Candida albicans: development, architecture, and drug 38. Hassan A, Usman J, Kaleem F, Omair M, Khalid A, Iqbal M. resistance. J Bacteriol. 2001;183:5385–5394. Evaluation of different detection methods of biofilm formation in the clinical isolates. Braz J Infect Dis. 2011;15:305– 19. Naglik JR, Moyes DL, Wachtler B, Hube B. Candida albicans 311. interactions with epithelial cells and mucosal immunity. Microbes Infect. 2011;13:963–976. 39. Ranjith K, Arunasri K, Reddy GS, Adicherla H, Sharma S, 20. Li F, Svarovsky MJ, Karlsson AJ, et al. Eap1p, an adhesin that Shivaji S. Global gene expression in Escherichia coli, isolated mediates Candida albicans biofilm formation in vitro and in from the diseased ocular surface of the human eye with a vivo. Eukaryot Cell. 2007;6:931–939. potential to form biofilm. Gut Pathog. 2017;9:15. 21. Samaranayake YH, Cheung BP, Yau JY, Yeung SK, Samara- 40. Dhale RP, Ghorpade MV, Dharmadhikari CA. Comparison of nayake LP. Human serum promotes Candida albicans biofilm various methods used to detect biofilm production of growth and virulence gene expression on silicone biomate- Candida species. J Clin Diagn Res. 2014;8:DC18–C20. rial. PLoS One. 2013;8:e62902. 41. Goncalves S, Silva PM, Felicio MR, de Medeiros LN, 22. Phan QT, Myers CL, Fu Y, et al. Als3 is a Candida albicans Kurtenbach E, Santos NC. Psd1 effects on Candida albicans invasin that binds to cadherins and induces endocytosis by planktonic cells and biofilms. Front Cell Infect Microbiol. host cells. PLoS Biol. 2007;5:e64. 2017;7:249. 23. Murciano C, Moyes DL, Runglall M, et al. Evaluation of the 42. Livak KJ, Schmittgen TD. Analysis of relative gene expression role of Candida albicans agglutinin-like sequence (Als) data using real-time quantitative PCR and the 2(-Delta Delta proteins in human oral epithelial cell interactions. PLoS C(T)) Method. Methods. 2001;25:402–408. One. 2012;7:e33362. 43. Ranjith K, Sontam B, Sharma S, et al. Candida species from 24. Peters BM, Ovchinnikova ES, Krom BP, et al. Staphylococcus eye infections: drug susceptibility, virulence factors, and aureus adherence to Candida albicans hyphae is mediated molecular characterization. Invest Ophthalmol Vis Sci. 2017; by the hyphal adhesin Als3p. Microbiology. 2012;158:2975– 58:4201–4209. 2986. 44. Qi L, Li H, Zhang C, et al. Relationship between antibiotic 25. Sundstrom P. Adhesion in Candida spp. Cell Microbiol. 2002; resistance, biofilm formation, and biofilm-specific resistance 4:461–469. in Acinetobacter baumannii. Front Microbiol. 2016;7:483.

Downloaded from iovs.arvojournals.org on 09/26/2021 Temporal Gene Expression in C. albicans Biofilm IOVS j January 2018 j Vol. 59 j No. 1 j 538

45. Harding MW, Marques LL, Howard RJ, Olson ME. Can 61. Kumamoto CA, Vinces MD. Contributions of hyphae and filamentous fungi form biofilms? Trends Microbiol. 2009;17: hypha-co-regulated genes to Candida albicans virulence. Cell 475–480. Microbiol. 2005;7:1546–1554. 46. Ramage G, Rajendran R, Gutierrez-Correa M, Jones B, Williams 62. Nobile CJ, Nett JE, Andes DR, Mitchell AP. Function of C. Aspergillus biofilms: clinical and industrial significance. Candida albicans adhesinHwp1inbiofilmformation. FEMS Microbiol Lett. 2011;324:89–97. Eukaryot Cell. 2006;5:1604–1610. 47. Hoyer LL. The ALS gene family of Candida albicans. Trends 63. Sanglard D, Kuchler K, Ischer F, Pagani JL, Monod M, Bille J. Microbiol. 2001;9:176–180. Mechanisms of resistance to azole antifungal agents in 48. Williams D, Lewis M. Pathogenesis and treatment of oral Candida albicans isolates from AIDS patients involve specific candidosis. J Oral Microbiol. 2011;3:10.3402/jom.v3i0.5771. multidrug transporters. Antimicrob Agents Chemother. 1995; 39:2378–2386. 49. Ricicova M, Kucharikova S, Tournu H, et al. Candida albicans biofilm formation in a new in vivo rat model. Microbiology. 64. Andes D, Nett J, Oschel P, Albrecht R, Marchillo K, Pitula A. 2010;156:909–919. Development and characterization of an in vivo central venous catheter Candida albicans biofilm model. Infect 50. Mathe L, Van Dijck P. Recent insights into Candida albicans Immun. 2004;72:6023–6031. biofilm resistance mechanisms. Curr Genet. 2013;59:251– 264. 65. Nett JE, Lepak AJ, Marchillo K, Andes DR. Time course global gene expression analysis of an in vivo Candida biofilm. J 51. Nobile CJ, Johnson AD. Candida albicans biofilms and Infect Dis. 2009;200:307–313. human disease. Annu Rev Microbiol. 2015;69:71–92. 66. Ganguly S, Bishop AC, Xu W, et al. Zap1 control of cell-cell 52. Tsui C, Kong EF, Jabra-Rizk MA. Pathogenesis of Candida signaling in Candida albicans biofilms. Eukaryot Cell. 2011; albicans biofilm. Pathog Dis. 2016;74:ftw018. 10:1448–1454. 53. Fox EP, Bui CK, Nett JE, et al. An expanded regulatory 67. Kim MJ, Kil M, Jung JH, Kim J. Roles of Zinc-responsive network temporally controls Candida albicans biofilm transcriptionfactorCsr1infilamentousgrowthofthe formation. Mol Microbiol. 2015;96:1226–1239. pathogenic yeast Candida albicans. J Microbiol Biotechnol. 54. Nobile CJ, Nett JE, Hernday AD, et al. Biofilm matrix 2008;18:242–247. regulation by Candida albicans Zap1. PLoS Biol. 2009;7: 68. Kamran M, Calcagno AM, Findon H, et al. Inactivation of e1000133. transcription factor gene ACE2 in the fungal pathogen 55. Uppuluri P, Chaturvedi AK, Lopez-Ribot JL. Design of a simple Candida glabrata results in hypervirulence. Eukaryot Cell. model of Candida albicans biofilms formed under conditions 2004;3:546–552. of flow: development, architecture, and drug resistance. 69. Watamoto T, Samaranayake LP, Egusa H, Yatani H, Seneviratne . 2009;168:101–109. Mycopathologia CJ. Transcriptional regulation of drug-resistance genes in 56. Finkel JS, Mitchell AP. Genetic control of Candida albicans Candida albicans biofilms in response to antifungals. JMed biofilm development. Nat Rev Microbiol. 2011;9:109–118. Microbiol. 2011;60:1241–1247. 57. Zhao X, Daniels KJ, Oh SH, et al. Candida albicans Als3p is 70. Thomson LM, Bates S, Yamazaki S, Arisawa M, Aoki Y, Gow required for wild-type biofilm formation on silicone elastomer NA. Functional characterization of the Candida albicans surfaces. Microbiology. 2006;152:2287–2299. MNT1 mannosyltransferase expressed heterologously in 58. Schaller M, Borelli C, Korting HC, Hube B. Hydrolytic Pichia pastoris. J Biol Chem. 2000;275:18933–18938. enzymes as virulence factors of Candida albicans. Mycoses. 71. Ding X, Liu Z, Su J, Yan D. Human serum inhibits adhesion and 2005;48:365–377. biofilm formation in Candida albicans. BMC Microbiol. 59. Hube B, Naglik J. Candida albicans proteinases: resolving the 2014;14:80. mystery of a gene family. Microbiology. 2001;147:1997–2005. 72.ChenLM,XuYH,ZhouCL,ZhaoJ,LiCY,WangR. 60. Felk A, Kretschmar M, Albrecht A, et al. Candida albicans Overexpression of CDR1 and CDR2 genes plays an important hyphal formation and the expression of the Efg1-regulated role in fluconazole resistance in Candida albicans with proteinases Sap4 to Sap6 are required for the invasion of G487T and T916C mutations. JIntMedRes. 2010;38:536– parenchymal organs. Infect Immun. 2002;70:3689–3700. 545.

Downloaded from iovs.arvojournals.org on 09/26/2021