ANALYSIS OF CHITINASE ACTIVITY
Maheshi Kukule Kankanamge
A Thesis
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
MASTER OF SCIENCE
August 2017
Committee:
Vipaporn Phuntumart, Advisor
Paul Morris
Raymond Larsen
© 2017
Maheshi Kukule Kankanamge
All Rights Reserved iii ABSTRACT
Vipaporn Phuntumart, Advisor
The oomycete Aphanomyces astaci infects crayfish, which can result in the mass mortality commonly referred to as “crayfish plague”. Additional oomycetes in the genera
Aphanomyces and Saprolegnia also infect crayfish. In the present study, two distinct organisms were isolated and identified from infected marbled crayfish Procambarus fallax forma virginalis and two phylogenetic trees based on internal transcribed spacer I (ITSI) were constructed using
MEGA 7 software and maximum likelihood method with 1000 bootstraps. It is known that crayfish pathogens that infect crayfish produce chitinases that enable them to penetrate the cuticle of the crayfish. Preliminary testing for chitinase activity of Aphanomyces sp. indicated that in vitro growth in terms of surface area of the plates covered by mycelia and dry weight of mycelia increased with increasing chitin concentration from 1%-3% and leveled off at 4% chitin. The effects of chitin on timing of sporangia formation and zoospore release of Apahanomyces sp. suggested that chitin plays a role in asexual reproduction of the pathogen. The time taken for
Aphanomyces sp. to develop sporangia and zoospore release increased with the amount of chitin incorporated in the media. Based on these observations, isolates of Aphanomyces sp. and of
Saprolegnia sp. were tested for their chitinase activity. Both isolates could utilize chitin as carbon and nitrogen source in their growth. Additional experiments suggested that the chitinase activity of Aphanomyces sp. and Saprolegnia sp. involved an unidentified acidic substance produced by both organisms. Dinitrosalicylic acid assay (DNS assay) indicated the presence of unidentified secondary metabolites and/or pigment produced by Saprolegnia sp. and
Aphanomyces sp.in nutrient deprived media. In DNS assay, the media with chitin and water in which both pathogens were grown showed highest absorbance after 72 hours indicating the possibility of their maximum production of chitinase and other enzymes within 48-72 hours. iv Based on the average absorbance readings, Aphanomyces sp. could be producing significantly higher amount of enzymes that break down chitinous cuticle compared to Saprolegnia sp.
Overall, the observations made in this study could indicate chitinase production in Aphanomyces sp. and Saprolegnia sp.
v ACKNOWLEDGMENTS
I would first like to thank my advisor, Dr. Vipa Phuntumart, for her mentorship and guidance. I would also like to thank my committee members Dr. Paul Morris and Dr. Ray Larsen for their time, help and advice. I thank Dr. Robert Huber for providing the marbled crayfish used in my project and thank other Biology faculty members for providing materials needed for my research.
In addition, I would like to thank lab members in the Phuntumart lab who were always willing to lend a hand. Last but not least, I would like to acknowledge Bowling Green State
University for providing a valuable graduate experience. vi
TABLE OF CONTENTS
Page
INTRODUCTION…………………………………………………………………..……...... 1
The Class Oomycota………………………………………………………………… 1
Oomycete Life Cycle………………………………………………………………... 1
CHAPTER I. BACKGROUND……………………………………………….…………...... 4
Crayfish Pathogen- Aphanomyces astaci ……………………………………………. 4
Mechanism of Infection ……………………………………………………………… 6
Crayfish ………………………………………………………………………………. 7
Molecular Identification of the Oomycete Pathogens ………………...……………… 8
Chitinase ……………………………………………………………………………… 9
Roles of Chitin in Oomycete Cell Wall………………………………………………. 12
Hypothesis ……………………………………………………………………………. 12
Aims …………………………………………………………………………………… 13
CHAPTER II. MATERIALS & METHODS …………………………………………………. 14
Isolation of Crayfish Pathogen from Infected Crayfish …..…………………………... 14
Identification of the Isolated Organisms Using ITS Region …………………………... 15
Genomic DNA Isolation ……………………………………………………………….. 15
ITS Amplification and Sequence Analysis……………………………………... 16
Phylogenetic Analysis ……………………………………………………...….. 17
Chitinase Assay ……………………………………………………………………….. 18
Preparation of Colloidal Chitin ……………………………………………….. 18
vii
The Effects of Chitin on Growth and Asexual Reproduction of Isolated
Aphanomyces sp. ……………………………………………………..….…… 18
Measuring Surface Area of Mycelia ………………………..….……. 18
Wet and Dry Weight of the Mycelia …….…………………..….……. 19
Density of the Mycelia ……………………………………..…….…... 20
Zoospore Production and Quantification of Zoospores ..…….…....…. 20
pH Indicator Assay ...…………………………………………….….….……. 21
3, 5- Dinitrosalicylic Acid Assay ………………………………….…….…... 21
Construction of the Standard Curve Using N-Acetyl glucosamine .….………. 22
Assessing the Growth Capability of Aphanomyces sp. and Saprolegnia sp.
on YPS Media with Different Strength and Composition ..……...……..…… 22
Performing Dinitrosalicylic Acid Assay .…………………..…………….…. 23
CHAPTER III. RESULTS ………………………………………………………………...... 25
Isolation of Crayfish Pathogen from Infected Crayfish ……………………………… 25
Molecular Identification of the Organism Using ITS Region ……………………….. 26
Genomic DNA Isolation ……………………………………………………… 26
PCR Amplification of ITS Region and Sequence Analysis ………………….. 29
Sequence Analysis ……………………………………………………………. 34
Phylogenetic Analysis ………………………………………………………… 38
Chitinase Assay …………………………………………………………………..…… 41
The Surface Area of Mycelial Growth ...……………………………………… 41
Dry Weight of Mycelia ...... …………………………………………………… 44
Density of Mycelia ..…...... …………………………………………………… 45 viii
Timing for Sporangia Formation and Zoospore Release in the Presence of
Varying Percentages of Chitin ……………………...... … 47
The Zoospore Counts for Aphanomyces sp.………………..………………… 47
Observing the Morphology of Sporangia in the Presence of Varying
Percentages of Chitin ……...…………………………………………………… 48
pH Indicator Assay ………………………...…………….…………………… 50
DNS Assay ……………………………………………………………………. 56
N-Acetyl glucosamine standard curve ……………………………..………….. 56
Assessing the Growth Capability on YPS Media with Different Nutrient
Composition …………………………………………………………………… 58
Performing DNS Assay ……………………………………………………...… 58
CHAPTER IV. DISCUSSION & CONCLUSION ………………………………….……..... 66
Discussion ……………………………………………………………………………. 66
Conclusion …………………………………………………………………………….. 76
REFERENCES …………………………………………………………………….………….. 78
ix
LIST OF FIGURES
Figure Page
1.1 Lifecycle of A. astaci ...... 5
1.2 ITS1 and ITS2 Regions and Primer Annealing ...... 9
3.1 Growth #1 (after 3 days) (Later Identified as Aphanomyces sp.) ...... 25
3.2 Growth #2 (after 3 days) (Later Identified as Saprolegnia sp.) ...... 26
3.3 Genomic DNA from Growth #1 & Growth #2 Visualized on 0.8% Agarose Gel ….. 28
3.4 PCR Products of ITS Region for Growth #1 ...... 30
3.5 PCR Products of ITS Region for Growth #2 ...... 31
3.6 The Sequence Chromatogram for Growth #1 ITS Sequence with Reverse Primer ... 33
3.7 The Sequence Chromatogram for Growth #2 ITS Sequence with Reverse Primer ... 34
3.8 The Sequence Alignment on blastn for Growth #1 on FungiDB...... 35
3.9 The Sequence Alignment on blastn for Growth #2 on FungiDB...... 37
3.10 The Phylogenetic Tree for Genus Aphanomyces ...... 39
3.11 The Phylogenetic Tree for Genus Saprolegnia ...... 40
3.12 The Average Surface Area (cm2 ) of Aphanomyces sp. Mycelia Grown on YPS
with Varying Percentages of Chitin Over 4 days...... 42
3.13 The Increase of Mycelial Surface Area (cm2 /day) of Aphanomyces sp. Grown on
YPS with Varying Percentages of Chitin Over Four Days ...... 43
3.14 The Average Dry Weight (g) of Aphanomyces sp. Mycelia Grown on YPS with
Varying Percentages of Chitin ...... 44
3.15 The Average Density of Aphanomyces sp. Mycelia ...... 46
3.16 Zoospore Count for Aphanomyces sp...... 48 x
3.17A Morphology of Sporangia of Aphanomyces sp. Grown on YPS Media with
No Chitin ...………………...……………………………………………………… 49
3.17B Morphology of Sporangia of Aphanomyces sp. Grown on YPS Media Containing
1% Chitin ….……………………………………………………………………… 49
3.17C Morphology of Sporangia of Aphanomyces sp. Grown on YPS Media Containing
2% Chitin ….……………………………………………………………………… 49
3.17D Morphology of Sporangia of Aphanomyces sp. Grown on YPS Media Containing
3% Chitin ……………….…………………………...……………………………. 50
3.17E Morphology of Sporangia of Aphanomyces sp. grown on YPS media containing
4% Chitin ….……………………………………………………………………… 50
3.18A The Color of YPS Media with/ without 1.5% Chitin Media at pH 4.2, 4.7
and 5.2 …..……………………………………………………………………..... 51
3.18B The Color of YPS Media with/ without 1.5% Chitin Media at pH 7.1 ……....…… 52
3.18C Aphanomyces sp. Grown on YPS Media at pH 4.2 After Four days A: no chitin,
B: chitin ...………………………………………………………………………… 52
3.18D Aphanomyces sp. Grown on YPS Media at pH 4.7 After Four Days C: No Chitin,
D: Chitin ….…………………………………………………………………….. 53
3.18E Aphanomyces sp. Grown on YPS Media at pH 5.2 after Four Days E: No Chitin,
F: Chitin ….……………………………………………………………………… 53
3.18F Aphanomyces sp. Grown on YPS Media at pH 7.1 After Four days E: No Chitin,
F: Chitin ….………………………………………………………………………. 54
3.18G Saprolegnia sp. Grown on YPS Media at pH 4.2 After Two Days I: No Chitin,
J: Chitin …………………………………………………………………………. 54 xi
3.18H Saprolegnia sp. Grown on YPS Media at pH 4.7 After Two Days K: No Chitin,
L: Chitin ..………………………………………………………………………….. 55
3.18I Saprolegnia sp. Grown on YPS Media at pH 5.2 After Two Days M: No Chitin,
N: Chitin .…………………………………………………………………………. 55
3. 18J Saprolegnia sp. Grown on YPS Media at pH 7.1 After Two Days O: No Chitin,
P: Chitin …………………………………………………………………………... 56
3.19 Standard Curve for N- Acetyl glucosamine (NAG) Using 0.05ug/ml - 0.30 ug/ml
of NAG …………………...………………………………………………………... 57
3.20 DNS Assay Measured by Average Absorbance at 540nm for Aphanomyces sp. &
Saprolegnia sp. Grown in Water+ Antibiotics & 1.5% Chitin + Water +
Antibiotics Over 7 Days ……………………………………………….…………… 60
3.21 Average Absorbance at 540 nm for Aphanomyces sp. and Saprolegnia sp.
Grown in Water+ Antibiotics & 1.5% Chitin + Water + Antibiotics Over 7 Days ….. 62
3.22 Average Absorbance of the Culture Media with Water without Antibiotics …...... 64
xii
LIST OF TABLES
Table Page
1.1 List of Other Known Crayfish Pathogens ...... 8
3.1 Concentrations and Purity Values of Genomic DNA Isolated from Four Replicates
Each of Growth #1 & Growth #2 ………..………………………………………….. 27
3.2 Concentrations and Purity Values for Clean PCR Products From Growth #1 and
Growth #2 …………..……………………………………………………………….. 32
3.3 Timing (hours) of Sporangia Formation and Zoospore Release for Aphanomyces sp.
Grown on YPS with Varying Percentages of Chitin ………………………………… 47
1 INTRODUCTION
The Class Oomycota
Oomycetes (also known as water molds) are large class of terrestrial and aquatic eukaryotes. Although they appear to resemble fungi in terms of the growth of mycelia and mode of nutrients utilized, molecular phylogeny indicates that they are they are members of the
Phylum Heterokontophyta (also referred to as stramenopiles) in the Kingdom Chromalveolata
(Link et al., 2002). As such, they are most closely allied with the brown and golden algae and diatoms. Some oomycetes infect plants and animals. Terrestrial oomycetes infect vascular plants and aquatic oomycetes infect fish and crustaceans.
There are many differences between oomycete and fungi. One of the major differences is the cell wall composition. Oomycete cell wall consists of cellulose, beta glucans and amino acid hydroxyproline while fungi cell wall majorly consists of chitin. At the cellular level, oomycete hyphae have diploid nuclei and have aseptate hyphae. Conversely, fungal nuclei are haploid
(except for the zygote stage) and their hyphae can be septate or aseptate haploid (Carris et al.,
2012).The shape of mitochondrial cristae of oomycetes and fungi is also different, with oomycete mitochondria having tubular cristae while the cristae in fungal mitochondria are flattened (Mclaughlin et al., 2001).
Oomycete Life Cycle
Oomycetes have both sexual and asexual reproduction. The only exception is
Aphanomyces astaci, which does not have sexual stages (Oditmann et al., 2002). Oomycetes are diploid throughout their life cycle except for the gamete stage. A specialized hypha called a sporangiophore differentiates into a sporangium, the structure for asexual reproduction. Different oomycete pathogens have different shapes of sporangia. For example, in Aphanomyces sp. the
2 sporangium is filamentous and looks similar to a vegetative hypha, while in Phytophthora megasperma, the sporangium is lemon-shaped. Supporting structures also differ; while most sporangiophores bear a single sporangium, in Peronospora sp., sporangiophores branch with sporangia found at the tip of each branch (Link et al., 2002).
Zoospores are generated when the sporangial cytoplasm is cleaved to produce zoospores
(Kim et al., 2003). Formation and release of zoospores is promoted by free water and wet saturated soil. (Williams et al, 2007). Zoospores are motile and have two types of anteriorly and posteriorly directed flagella. Tinsel flagellum with hairs is directed anteriorly and whiplash flagellum is directed posteriorly. The anterior flagellum pulls zoospore through water, while the posterior flagellum acts as a rudder for steering zoospore (Schechter et al., 2009). Dispersed zoospores swim in water by chemotaxis, which means movement of the zoospores by increasing or decreasing gradient of chemicals released from potential food sources. In plant pathogens, zoospores are attracted by amino acids, sugars and metabolites exuded by plant roots (Lucas et al., 1995). Upon finding a suitable host, zoospores shed their flagella, encyst and make secondary cyst. When necessary nutrients are present, the secondary cyst germinates at colder temperature around 10°C-12°C. The resultant germ tube penetrates into the host, establishing infection. If zoospores don’t find a host, they can undergo repeated emergence of zoospores.
This involves repeated encystment and zoospore emergence. This can be repeated up to three generations (Islam et al., 2010).
In oomycetes where sexual reproduction is seen, germinated zoospores give rise to male and female hyphae. The apex of these hyphae under goes meiosis and differentiates into haploid female (oogonium) or male (antheridium) gametes, collectively called gametangia. The oogonium is spherical, while the antheridium looks like a swollen hyphal cell. In some
3 oomycetes, the antheridium is located at the side of oogonium (paragynous arrangement) while in others, the antheridium is arranged as a collar at the base of the oogonium
(anamphigynous).The anthiridium mates with the oogonium via its fertilization tube. Nuclei in the antheridium fuse with eggs in the oogonium. Once fertilized, the zygote develops a thick wall called an oospore. Oospores can survive in dry and cold conditions for a large number of years.
These oospores can directly germinate to form hyphae on the surface of host cells (Fry et al.,
2010).
4 CHAPTER I. BACKGROUND
Crayfish Pathogen- Aphanomyces astaci
The aquatic oomycete Aphanomyces astaci is a crayfish pathogen. It belongs to the order
Saprolegniales. The genus Aphanomyces consists of 35-40 species and contains both plant pathogens, animal pathogens and saprotrops (Diéguez-Uribeondo et al., 2009). Aphanomyces astaci causes lethality in crayfish with non- North American origin. Crayfish families with North
American origin serve as reservoirs (carriers) for the disease (Filipova et al., 2013).
Aphanomyces astaci invades the crayfish through soft cuticle of its exoskeleton (Unestam et al., 1977). The hyphae of the mycelia penetrate through the chitinous layer of the host and reach the muscle and nervous system, damaging the internal organs and the nervous system. The mycelia associated with the intra-matrix prevent crayfish from molting. In severe cases, mycelia grow outward from the exoskeleton showing visible signs of Aphanomyces astaci in infected crayfish. Encapsulation by blood cells, blood clotting and melanization result as immune responses of A. astaci infection in crayfish (Unestam et al., 1968b, 1974a). Other than crayfish,
A. astaci can also infect the Chinese mitten crab (Eriocheir sinensis) and some plankton crustaceans for example, Calanoida Copepod (Schrimpf et al., 2014). The life cycle of A. astaci is summarized in Figure 1.1.
5
Figure 1.1: Lifecycle of A. astaci. Hyphae grow outward of the cuticle of crayfish making a sporangium with primary spores (p). At the tip of the sporangium, primary cysts form in a sporeball cluster (pc). Primary cysts develop into primary zoospores (pz), which then differentiate into secondary zoospores (sz) following encystment (epz). Following contact with a host, the flagella are shed and the zoospore differentiates into a secondary cyst (sc), then germinates (gc). The resultant mycelium grows in the cuticle, ultimately leading to a new cycle.
The abbreviations given in the figure are as follows: primary spores (p), sporangia (sp), primary cysts in a sporeball cluster (pc), emerging zoospores (ez), secondary zoospore (sz), secondary
6 cyst (sc), germinating secondary cyst (gc), mycelium (my), cuticle (cu) (adapted from Cerenius
& Söderhäll, 1996; Cerenius et al., 1988).
Mechanism of Infection
Upon finding a suitable host (crayfish), the zoospore will encyst and germinate within one hour (Nyhlén & Unestam, 1975). The resultant germ tube penetrates the cuticle of the crayfish to infect the host. Crayfish with a damaged cuticle, openings in the body, or a soft cuticle can be infected faster (Unestam & Weiss, 1970). As the severity of the infection increases, the hyphae grow more inward reaching the internal organs, including the ventral nerve cord and brain ganglion, making affected tissues become brown or yellow (Unestam & Weiss,
1970). Hyphae can sometimes be seen in the eyes.
At the moribund stage of the crayfish infection, hyphae protrude out through the cuticle into the water to make sporangia, which makes primary spores. They form a cyst wall and become primary cysts. These primary cysts aggregate and make a cluster at the apex of the sporangium. If the primary spores do not encyst within sporangium, they could release bi- flagellated zoospores with flagella attached at the same point. Upon finding a suitable host, zoospores encyst to make secondary cyst. In the presence of necessary nutrients, secondary cysts geminate by penetrating the cuticle with its hyphae using the lytic enzymes such as proteases, chitinases and esterases it produced or they can undergo repeated emergence of zoospore (REZ) and its subsequent encystment. (Smith & Söderhäll, 1983; Alderman & Polglase, 1986;
Cerenius et al., 1988).Aphanomyces astaci can go through REZ up to 3 generations. This is a successful adaptation to its parasitic lifestyle as it renders the pathogen to find a suitable host
(Cerenius & Söderhäll, 1985; Diéguez-Uribeondo & Söderhäll, 1999; Royo et al., 2004).
7 When crayfish are infected with A. astaci, they mount an innate immune response that becomes evident as melanized spots in their cuticle (Aquiloni et al., 2010). This involves a defense mechanism where the hyphal tips of the A. astaci mycelium that spread into the cuticle become encapsulated by a melanin cap. This melanization is caused by phenoloxidase activity of the host, which in its active form catalyzes the oxidation of phenols to melanin. The melanin cap prevents the growth of the pathogen and minimizes damage to the host. A. astaci can regrow when crayfish is under stress or with weak immunity due to secondary infections. (Cerenius et al., 2003).
The most prominent symptom of A. astaci infection in susceptible crayfish is the fuzzy mycelium growing outward from the crayfish abdomen. Other symptoms include the appearance of the nocturnal crayfish in daylight showing perplexed behavior (Marren et al., 1986). The susceptible crayfish dies within few weeks after infection.
Crayfish
Based on the phenotypes rendered by A. astaci infection, crayfish can be susceptible or resistant to the disease. European crayfish such as, Noble crayfish (Astacus astacus), White- clawed crayfish (Austropotamobius pallipes), Stone crayfish (Austropotamobius torrentium) and
Narrow-clawed crayfish (Astacus leptodactylus) are susceptible to the A. astaci infection with no immune defense mechanism against the pathogen (Unestam 1969; 1971; Evans & Edgerton,
2002). Native North American crayfish such as the Signal crayfish (Pacifastacus leniusculus),
Red swamp crayfish (Procambarus clarkii), and the Spinycheek crayfish (Orconectes limosus) are carriers of the pathogen and are not susceptible unless they are under stress and with primary infection by other pathogens including bacteria. Other known pathogens that infect crayfish are listed in Table 1.1.
8 Table 1.1: List of other known crayfish pathogens.
Name of the Pathogen Host Effect(s)
Aphanomyces laevis Red swamp crayfish Parasitize and cause mortality
Aphanomyces frigidophilus White-clawed crayfish Parasitize and cause mortality
European crayfish, noble Saprolegnia ferax Infect wounds crayfish, broad fingered crayfish European crayfish, noble Trichosporon beigelli Infect wounds crayfish, broad fingered crayfish Red swamp crayfish, Lousiana Aphanomyces repetans Non pathogenic swamp crayfish, Signal crayfish
Fusarium tabacinum White clawed crayfish Black gill disease
Saprolegnia australis Freshwater crayfish Ulcerative disease
(Aspan & Söderhäll, 1991; Diéguez-Uribeondo et al., 1994; Royo et al., 2004; Ballesteros et al.,
2006)
Molecular identification of the oomycete pathogens
Molecular identification approaches are widely used for organism classification.
Identification of oomycete pathogens based solely on morphology is not accurate and acceptable.
The consonance between the taxonomic conjecture based on molecular identification and that of morphological identification is a reliable method in identifying and classifying oomycete.
Molecular identification of oomycete includes analysis of small and large subunit ribosomal RNA(rRNA),cytochrome oxidase subunit I&II genes (which are mitochondrial genes encoding cytochrome oxidase subunits I & II) and internal transcribed spacer (ITS) which are non-coding regions located between 18S and 28S rDNA (Figure 1.2, Van de Peer et al., 1996).
9
Figure 1.2: ITS1 and ITS2 regions and primer annealing (Aguilera-Muñoz et al., 2008).
Genes that have a similar function in all organisms are highly conserved over an evolutionary time period. Since rRNA and mitochondrial genes have essential and similar functions in all organisms, the genes encoding rRNA and mitochondrial genes are conserved and being used widely to identify organisms based on its divergence (Yang et al., 2014).
Compared with rRNA genes, which have a definite function across all organisms, the ITS is highly variable in sequence, even between closely related species. This is because the ITS does not code for proteins, thus non-lethal mutations could be tolerated within this region. Therefore, there is a relatively low evolutionary pressure exerted on those sequences. Thus ITS, being a variable region, can be used as a tool to identify species.
Chitinase
Chitinase breaks down chitin and it is a virulence factor in some fungi and oomycetes that infect hosts with exoskeletons containing chitin. For example, fungi that infect insects show chitinase production in response to chitin (Leger et al., 1996a; Schickler et al., 1998). Oomycetes like A.astaci that infect crayfish produce chitinase to break down chitin in crayfish cuticle
(Andersson et al., 2002).
Chitin is a polysaccharide composed of N-acetyl-β-D-glucosamine monomers. Chitinases hydrolyze the β-1,4-linkages in chitin (Funkhouser et al., 2007).There are two groups of chitinases; endochitinases that catalyze the random cleavage of glycosidic linkages in the chitin
10 chain generating free ends and long chitooligosaccharides and exochtinases that process chitooligosaccharides to release diacetyl chitobiose or N- Acetyl glucosamine from the non- reducing end of chitin.
In oomycetes, chitinase is secreted at the apex of mycelia (Guerriero et al., 2010). Some oomycete pathogens, including A. astaci, express chitinase constitutively while in others (e.g.
Saprolegnia parasitica) the expression is inducible in the presence of the substrate. A. astaci mycelia produce chitinase constitutively regardless of the presence of chitin when grown on agar plates (Unestam, 1966). This is an adaptation to its parasitic lifestyle. Thus it is of great importance to look at chitinase expression in crayfish pathogens.
There are three chitinase genes in A. astaci: CHI1, CHI2 and CHI3. The CHI1 is found in many other oomycetes including Aphanomyces spp. and Saprolegnia spp. and its expression is inducible. CHI2 and CHI3 genes are A. astaci specific, constitutively expressed members of the glycosyl hydrolase (GH18) gene family of chitinases. The primary amino acid sequence of these
CHI1, CHI2 and CHI3 genes consists of N-terminal signal peptide, catalytic GH18 domain and
C-terminal cysteine rich chitin binding site (Hochwimmer et al., 2009).
In asexual life cycle of A. astaci, chitinase activity is not found in cyst and zoospores and neither CHI1 transcripts nor chitinase are produced for storage in zoospores. It is expressed at high levels during germination (Andersson & Cerenius, 2002). When zoospores find the upper lipoprotein layer of the crayfish cuticle they discard flagella and develop germ tube, which penetrates the lipid layer by weakening it enzymatically and by mechanical force. Then the hyphae secrete protease and chitinase and the chitin is degraded, providing nutrients for the growth of mycelia parallel to the chitin fibrils in the endocuticle (Hochwimmer et al., 2009).
11 The expression of CHI1was not detected in cyst and germlings younger than 6 hours but a significant chitinase activity was detected in germlings after 10 hours. The level of chitinase produced during the early stages of germination might be very low due to the fact that the A. astaci germ tube reaches the chitinous part of the cuticle after 24 hours of the infection
(Söderhäll et al., 1978) at which point, a greater amount of chitinase is required. It was also found that in A. astaci, CHI1 transcripts are produced in hyphae that are in early stage of sporulation and in starving mycelia washed with lake water (Andersson & Cerenius, 2002).
Chitinase is expressed in sporulating mycelia or in mycelia that have not yet been developed into sporangia. Chitinase expression is also induced with starvation such as when washing with lake water. This induced expression of chitinase is seen as the pathogen penetrates the cuticle of moribund crayfish from inside out before releasing zoospores into the water. At this point, the crayfish cuticle becomes soft due to chitinase and proteinase activities. Chitinase expression upon sporulation was found only in A. astaci but not in other Aphanomyces spp.
(Andersson & Cerenius, 2002).
CHI1 expression is inducible in the presence of the substrate chitin. Both A. astaci chitinase genes CHI2 and CHI3 are constitutively expressed in mycelia regardless of substrate chitin in the media. The substrate chitin has no effect on the level of CHI1 expression or the pattern of CHI1 expression. But the level of expression changes at different time points. The maximum CHI3 is reached at 24 hours and 48 hours while maximum level of CHI2 was observed after 48 hours, post inoculation. (Hochwimmer et al., 2009).
Infection of A. astaci starts by penetration of the outer layer that consist of lipid and then reaching the chitinous layer of the cuticle which contains chitin embedded by proteins and phenolic compounds. Then the hyphae grow along the chitin fibrils (Nyhlén &Unestam, 1980).
12 Since the cuticle consists of protein and phenolic compounds other than chitin, the accessibility of chitinase to chitin is poor. This could be the reason why A. astaci has chitin independent constitutive chitinase expression; excessive production of chitinase allows efficient in degradation of chitin on the spot upon reaching the chitin part of cuticle rather than waiting for induction. This is an adaptation of A. astaci that enhances the efficiency of their pathogenic lifestyle.
Roles of chitin in oomycete cell walls
The oomycete cell wall consists of cellulose micro fibrils together with β-1, 3, and β-1,6 glucans which provide rigidity and structural support to the hyphae (Guerriero et al., 2010).
These sugars account for more than 70% of the dry weight of the cell wall (Badreddine et al.,
2008). Although most of the oomycete cell walls have very little chitin, a crystalline chitin was found at less than 0.5% of the total cell wall content. (Guerriero et al., 2010) The role of chitin in oomycete cell wall is to give structural rigidity (mechanical support) to cell wall of hyphal tip and involved in hyphal growth in some oomycete, while the details of how it promotes hyphal growth is unknown.
In Saprolegnia sp., 0.7% of the cell wall consists of true crystalline chitin N- acetyl glucosamine which is not essential for hyphal growth. In Aphanomyces spp., 10% of the cell wall consists of non-crystalline chitosaccharides, which are required for hyphal growth (Guerriero et al., 2010).
Hypothesis
Isolated oomycete pathogens that infect crayfish produce chitinases that enable the penetration of the chitinous cuticle of the crayfish.
13 Aims
The overall aim of this project is to isolate and identify oomycete pathogens of crayfish and to investigate the chitinase activity of the isolated pathogen. Specific aims are as follows:
Aim 1) Isolation of oomycete crayfish pathogen from infected crayfish.
Aim 2) Identification of the oomycete isolate using ITS region sequence similarities.
Aim 3) Development of a chitinase assay to detect the chitinase activity of the oomycete isolates
14 CHAPTER II. MATERIALS & METHODS
Aim 1: Isolation of crayfish pathogen from infected crayfish
A marbled crayfish (Procambarus fallax forma virginalis) with visible melanin spots was provided by the Robert Huber lab, Bowling Green State University, OH. The crayfish was euthanized by keeping on ice for two hours. Limbs and abdomen were dissected and transferred to a 2ml eppendorf filled with sterile de-ionized water such that the dissected parts were completely immersed. The tube was vortexed for 30 seconds and the water was discarded. Then the tissues were disinfected with 70% ethanol. Tubes were incubated at room temperature for 30 seconds and vortexed for another 30 seconds. The ethanol supernatant was discarded and the crayfish parts were rinsed with sterile deionized water and vortexed for 30 seconds. These steps were repeated for three times. After the final rinse of the crayfish parts, they were transferred on to a sterile empty petri dish kept in sterile hood and the flesh was carefully taken out from the inside of the cuticle. Crayfish cuticle was then transferred on to YPS plates containing 68ug/ml streptomycin and 68ug/ml chloramphenicol. The plates were incubated in the dark at room temperature. Growth was observed for five days. When mycelia were seen growing around the crayfish cuticle, plugs were taken from the edge of the mycelia and transferred separately on to fresh YPS plate media containing streptomycin and chloramphenicol. These plates were incubated in the dark at room temperature and mycelia were observed under microscope.
Sporangia formation and zoospore production were observed as a preliminary identification of oomycete. The isolated pathogen was maintained on YPS plates containing chloramphenicol and streptomycin. The isolated pathogen was sub cultured for 5 times before subsequent experimental methods such as genomic DNA isolation to ensure the purity of the culture.
15 Aim 2: Identification of the isolated organisms using ITS region
Genomic DNA isolation
After sub culturing the mycelia for five times to ensure that pure cultures were obtained, transferred five-day-old mycelial plugs onto YPS/ chloramphenicol/ streptomycin plates with cellophane membrane laid on top of the agar. Plates were incubated in dark incubator at room temperature for three to five days. 100 mg of mycelia were scraped off with sterile scooper and immersed quickly in liquid nitrogen. Then the mycelia were crushed into fine powder using a sterile mortar and pestle. The extraction of genomic DNA was conducted with some modifications following the protocol of Zelaya-Molina et al., (2011).
Before starting the DNA extraction, 10ml of digestion / lysis buffer was made using 10 mM Tris-HCl pH 8.0, 50 mM EDTA, 0.5% w/v SDS, 0.5% v/v Triton X-100, 0.5% v/v Tween
20. Right before each extraction, add 2μL of 20 mg/mL proteinase K, 2 μL of 100-mg/ml RNase
A (Sigma-Aldrich, MO) to 800μL of lysis buffer. Five day old fresh mycelia were scraped off the cellophane membrane and crushed in liquid nitrogen to obtain a fine mycelial powder. From this frozen powder, 50 mg was taken into a separate eppandorf tube and 800μL of lysis buffer was added. This tube was incubated at 37°C for 30 minutes in a shaking incubator to allow protein and RNA degradation. These tubes were vortexed for 30s and incubated for a minimum of 30 minutes at 55°C while inverting the tube every 10 minutes. Once the incubation is complete, 800 μL phenol: chloroform: isoamyl alcohol (25:24:1, v/v) was added to the tube and vortexed for 30s. Then the tube was centrifuged at 10,000x g for 10 min. The supernatant was transferred to a new 1.5ml tube, being sure to not touch the bottom layer which contains phenol: chloroform: isoamyl alcohol (25:24:1, v/v). An equal volume of chloroform: isoamyl alcohol
(24:1, v/v) was added to the supernatant, vortexed again for 30 seconds and centrifuged at
16 10,000x g for 10 minutes. The supernatant was then transferred to a new tube, being sure to not touch the bottom layer. An equal volume of isopropanol was added to this tube containing supernatant to precipitate DNA. This tube was then inverted 5 times, and then incubated at -20°C for 15 minutes. Once the incubation was complete, centrifuged the tube at 10,000x g for 10 minutes to pellet the DNA. The resulting supernatant was pipetted off and DNA was washed with 1 mL of 70% (vol/vol) ethanol, being sure not to disturb the pellet. Ethanol was then pipetted off as much as possible. DNA was air dried at room temperature or in a heating block at
55°C for 15 minutes, until the pallet is dried. The pallet was re- suspended in 50μL of di- ionized water. The concentration and purity of the extracted genomic DNA was measured using
Nanodrop (Thermo, MA) and run on 0.8% agarose gel to visualize extracted DNA.
ITS amplification and sequence analysis
Universal eukaryotic ITS primers,
UN up 18S 42 5’ CGTAACAAGGTTTCCGTAGGTGAAC 3’ and
UN lo 28S 1220 5’ GTTGTTACACACTCCTTAGCGGAT 3’ were used to amplify combined
ITS and LSU regions (Bakkeren et al., 2000 ; Levesque & de Cock,2004; Bala et al., 2010;
Robideau et al., 2011) genomic DNA from an isolate of Saprolegnia sp. received from Dr. Dave
Straus was used as positive control (named in this study as Sap. sp.(AR)). For the negative control, deionized water was used instead of genomic DNA. Taq DNA polymerase from NEB
(provided in Taq 5X master mix), MA was used in all PCR reactions. The modified PCR program was as follow:
PCR reaction conditions:
1) 95 ºC- 3mins --- initial denaturation
2) 95ºC – 1min
17 3) 53 ºC – 45 seconds
4) 68 ºC – 2mins --- step 2- 4 35 cycles
5) 68 ºC – 8mins --- final extension
6) 4 ºC - until the tubes are put in the -20ºC freezer for later use.
PCR products were run on 0.8% agarose gel. Upon observing bands on gel, PCR products were purified using Qiagen PCR clean and concentrator (Qiagen, MD). The purified products were then sequenced by ATGC Sequencing, Cincinnati, Ohio. Sequences were analyzed using Fungi DB database (Farr & Rossman, 2017, Fungal Databases, U.S. National
Fungus Collections, ARS, USDA) to identify the genus of the pathogen.
Phylogenetic Analysis
In order to determine the evolutionary relationships between the isolated pathogen and other oomycetes from the respective genus, phylogenetic analysis was performed using the
Molecular Evolutionary Genetic Analysis 7 (MEGA7) software to construct two separate phylogenetic trees for each of the two genera. Reference numbers for ITS sequences were found on TreeBase database (Donoghue et al., 1994;Sanderson et al., 1993, 1994; Piel et al., 1996;
Morel, 1996; Piel et al., 2000) and BOLD database (Ratnasingham & Hebert, 2007) for
Aphanomyces sp. and on published literatures, Steciow et al., 2014 ; Sandoval-Sierra et al., 2013 for Saprolegnia sp. A total of 40 sequences of Aphanomyces sp. and Saprolegnia sp. sequences were used. The sequences were aligned using MAFFT version 7 software (MAFFT 7.310, 2017) then uploaded to MEGA7. The Maximum Likelihood method was used with 1000 bootstraps for assessing the accuracy of the tree.
18 Aim 3: Chitinase Assay
Preparation of Colloidal Chitin
Colloidal chitin is a fine pulp made out of powdered crab shell (Ocean Crest Seafood,
Inc., MA). It was prepared following the protocol by (Murthy& Bleakley, 2012) with some modifications. First, crab shell flakes were washed with di- ionized water and manually ground using a mortar and pestle.
It was then sieved through two layers of 130mm polypropelene buchner filter. Forty grams of sieved crab shell flakes was measured and treated with 300 ml of 12M HCl in a 1000ml beaker. HCl was added slowly with continuous stirring with the use of a glass pipette for 5 mins, followed by stirring for 1min at an interval of every 5 mins for 2 hours in a chemical fume hood at 25 ºC to dissolve the crab shell and to obtain smoother textured crab particles. Chitin- HCl mixture was passed through 8 layers of cheesecloth to remove large chitin chunks. One hundred ml of clear filtrate was treated with two liters of ice-cold deionized water to allow precipitation of colloidal chitin. It was then incubated overnight under static conditions at 4ºC to improve precipitation of colloidal chitin. This was then passed through 2 layers of coffee filter paper
(Rochline industries, WI) in a buchner funnel and vacuum was applied. Two liters of tap water at pH 7.5 was passed through the colloidal chitin pulp. Colloidal chitin was collected on to separate clean filter paper after several washes with 2L of water at pH 7.5 Colloidal chitin was then autoclaved and stored at 4 ºC.
The effects of chitin on growth and asexual reproduction of isolated Aphanomyces sp.
Measuring surface area of mycelia:
As preliminary data to follow subsequent experimental methods of chitinase assay, the pathogen’s ability to utilize chitin was assessed by measuring surface area and dry weight of
19 mycelia. The pathogen’s ability to carry out asexual reproduction in the presence of different amounts of chitin was assessed by observing the effects of different chitin percentages on the pathogen’s sporangia formation and zoospore release.
Different percentages of chitin (1%- 4%) were incorporated in Yeast Peptone Sulfate
(YPS) media. To prepare 1%, 2%, 3% and 4% moist colloidal chitin plates, colloidal chitin was added to YPS media containing 68ug/ml chloramphenicol and 68ug/ml streptomycin. Twenty ml of YPS media containing colloidal chitin was poured into a petri dish. After the media was solidified, a layer of cellophane membrane was placed on each of the premade chitin plate. A plug from the edges of the 5-day-old plates was placed in the middle of each plate on cellophane membrane. The measurement of the average surface area of the mycelia, wet and dry weight of mycelia were included in data collection. Ten replicates were performed for the induction of zoospores. The plates were incubated in the dark at room temperature. Pictures were taken daily, starting at 24 hours of post plug transfer very day for 4 days until at least mycelia of one plate reached the edge of the plate. Surface area of each plate covered by mycelia was measured using
Image J software (Image J 1.x) and R language (R Core Team, R foundation for statistical computing 2013, Vienna, Austria) were used to analyze these data.
Wet and Dry weight of the mycelia:
A scientific scale with a readability of 0.1 milligram (Mettler A 30) was used to measure the wet weight and dry weight of mycelia. To obtain the dry weight, incubated plates at 37 ºC and measured the weight every two days for 8 days. Dry weight was noted when the weight of the mycelia on two consecutive days remained the same. To confirm the dry weight, the mycelia were incubated further at 70ºC incubator for 24 hours and measured the weight again every day until the weight was stable and that was the final dry weight of the mycelia. R program was used
20 to analyze this set of data.
Density of the mycelia:
With the obtained surface area of the mycelia and dry weight of mycelia as described above, the average density of the mycelia was calculated by dividing the average dry weight of mycelia by average surface area of the mycelia. R program was used to analyze this set of data.
Zoospore production and quantification of zoospores:
Mycelia from three to five day-old plates were flooded with water collected from crayfish tank located within the department of biological sciences to cover the whole plate completely
(roughly 15ml). These plates were then incubated at room temperature for 15 minutes. The water was then discarded and then re-flooded with water collected from crayfish tank. These steps were repeated for three times over 45 minutes. Then the plates were flooded with water collected from crayfish tank (15ml) and incubated at 10ºC for 18 hours. After 18 hours of incubation, the plates were observed under microscope to see sporangia formation and/or swimming zoospores.
If zoospores were not detected, water was discarded and the plates were flooded again with autoclaved deionized water (Unestam et al., 1969) and incubated further at room temperature and re-observed for zoospores every 15 minutes. Washing steps were continued until sporangia were formed and zoospores were released. Once zoospores were seen, the water containing zoospores from the plates was slowly decanted into a falcon tube and pipette 20 µl of zoospore suspension onto the hemocytometer to count the number of zoospores. In order to get an accurate count, each sample was counted for at least 10 replicates. R program was used to analyze zoospore counts. Additionally, morphology of sporangia was also observed.
21 pH indicator Assay
As a preliminary method to detect the chitinase activity, changing the pH of the media can be used to detect N-acetyl glucosamine. In the presence of chitinase, chitin is broken down to
N-acetyl glucosamine (NAG) which is of pH 7-8.5. This makes the media basic. In order to detect this resulting pH, bromothymol blue (Sigma-Aldrich, MO) can be used.
Bromothymol blue is a weak acid. In its protonated form, it appears yellow and in its deprotonated form it appears blue. It appears in green in neutral pH. Thus, it is yellow color in the pH ranging from 0 - 6. From pH 6.4 – 7.5 its color is in the range of light green to a dark green respectively. In the pH above 7.5, it is blue color.
To notice the color change due to the shift in pH, YPS with no chitin and YPS with 1.5% chitin plate media at pH 4.2, 4.7. 5.2 and 7.1 were made. (Finely ground shrimp cuticle powder prepared as described above was used as chitin for the chitinase assay from this experiment onwards). 68ug/ml chloramphenicol and 68ug/ml streptomycin were added before plating. 30ml of each media was taken, 750ul (25ug/ul) of bromothymol blue was added to it and plated.
Transferred plugs of Aphanomyces sp. and Saprolegnia sp. on to plates of each media, and 100ul of sterile water was inoculated on both types of media at all pH as negative control. Four replicates were conducted per each treatment. Incubated in the dark at room temperature and observed if there was color change on the plates.
3, 5- Dinitrosalicylic Acid Assay
The 3, 5-dinitrosalicylic acid (DNS) assay was used to assess the chitinase activity of
Aphanomyces sp. and Saprolegnia sp. The purpose of this experiment was to indirectly measure the Aphanomyces sp. and Saprolegnia sp. chitinase activity by measuring the amount of reducing sugars released as a result of breaking down of chitin in the media.
22 Chitinase breaks down chitin to liberate reducing sugars such as chitobiose and N-Acetyl glucosamine (NAG). N-Acetyl glucosamine reduces 3, 5-dinitrosalicylic acid to 3-amino, 5- nitrosalicylic acid (ANS), which strongly absorbs light at 540nm.The chitinase activity can be assessed by measuring the amount of reducing sugars released by taking absorbance reading at
540nm.
Construction of the standard curve using N-Acetyl glucosamine
Before performing DNS assay, the DNS reagent was tested by constructing a standard curve for N-Acetyl glucosamine. This could also be used in the future to interpret chitinase activity by locating the concentration of N-Acetyl glucosamine corresponding to a particular absorbance value at 540nm on the standard curve.
N-Acetyl glucosamine stock (20mg/ml) was used to make series of dilutions of N-Acetyl glucosamine at 0.05mg/ml, 0.1ug/ml, 0.15ug/ml, 0.2ug/ml, 0.25ug/ml, 0.3ug /ml.
0.5ml of each of the dilution was taken and 0.5ml of DNS was added to it. Then it was heated at 95ºC for 10 minutes and absorbance was measured at 540nm. A graph for absorbance at 540nm (Y axis) against respective concentration of N- Acetyl glucosamine (X axis) was plotted.
Assessing the growth capability of Aphanomyces sp. and Saprolegnia sp. on YPS media with different strength and composition
This method was used as preliminary testing to assess the growth capabilities of
Aphanomyces sp. and Saprolegnia sp. in the presence of various strengths of basic YPS media and in the presence of limiting carbon and nitrogen sources to see if their growth could be challenged by such limitations. Chitinase activity was detected indirectly by measuring N-Acetyl glucosamine liberated from chitin. For that, there should be limited /no other reducing sugars in
23 the media to avoid any errors/ false positive results that could occur if additional reducing sugars were present in the media.
YPS plates were prepared (four replicates from each for each pathogen) with varying composition of each component and media with added chitin: (All media contained 60ug/ml streptomycin and 60ug/ml chloramphenicol)
Full strength YPS (Reference)
1/4 strength YPS
1/10 strength YPS
YPS without Dextrose
YPS without Dextrose, with 1.5% chitin
1.5% chitin + agar
Agar only
A plug of each pathogen was transferred onto its respective plates. Incubated in the dark at room temperature. The growth of mycelia was measured every day for at least three days to see which minimal media limited the growth of the pathogen.
Performing Dinitrosalicylic Acid Assay
Based on the results from growth capability assay mentioned above, the pathogens used agar as carbon and nitrogen source. So chitin + water liquid media was chosen for DNS assay to completely eliminate other carbon and nitrogen sources and to see if chitin alone can be used as the sole carbon and nitrogen source.
Aphanomyces sp. and Saprolegnia sp. each were grown in 15ml of sterile water containing 1.5% chitin in 250ml flasks with 60ug/ml streptomycin and 60ug/ml chloramphenicol (12 replicates each) as treatment group. Chitin was the only carbon source in
24 the media, which should release chitobiose and NAG upon putative chitinase activity by the pathogens. Growth in water only without chitin was used as control.
The cultures were incubated in a shaking incubator at 100rpm at 25ºC for seven days.
1.5ml of each sample (treatment and control) was taken daily and put into separate 1.5ml eppendorf tubes. These tubes were then spun at 9000g for 30 seconds to get rid of any debris including chitin, mycelial parts. From these tubes, 1ml of the resultant supernatant was taken into glass test tubes and 1ml of DNS reagent (Sigma Aldrich, MO) was added to that. Then the tubes were heated at 95ºC for 10 minutes. The tubes were then set aside to cool down to room temperature. The absorbance was measured at 540nm using uv vis Spectrophotometer
(Spectronic 20 Genesys).
Treatment samples were blanked with water +1.5% chitin with antibiotics chloramphenicol and streptomycin with no pathogen grown in it. Negative control was blanked with water with antibiotics chloramphenicol and streptomycin with no pathogen grown in it.
25 CHAPTER III. RESULTS
Aim 1: Isolation of crayfish pathogen from infected crayfish
Following the transfer of surface sterilized crayfish cuticle on to YPS media containing chloramphenicol and streptomycin, mycelial growth with two different morphologies were seen around the crayfish cuticle after two to three days following the transfer. The two types of growth were named as Growth #1 and Growth #2.
Growth #1 showed dense white cotton wool-like mycelia (Figure 3.1) and Growth #2
(Figure 3.2) showed thin cotton-wool like white mycelia. Growth #1 showed slower growth which took five to six days to cover the whole plate compared to that of Growth #2 which took two days to cover the plate.
Figure 3.1: Growth #1 (after three days) (Later identified as Aphanomyces sp.). Its morphology was dense white cotton wool-like mycelia that covered 7.07 cm2of the plate.
26
Figure 3.2: Growth #2 (after three days) (Later identified as Saprolegnia sp.). Its morphology was thin cotton-wool like white mycelia that covered 27.42 cm2of the plate.
Aim 2: Molecular Identification of the organisms using ITS region
Genomic DNA isolation
Genomic DNA was isolated from four replicates each with hyphal mats of above mentioned Growth #1 and Growth #2. Concentrations and purity values were taken using
NanoDrop for Growth #1 & Growth #2 samples. NanoDrop concentrations ng/ul and purity values for Growth #1 and Growth #2 are given on Table 3.1.
27 Table 3.1: Concentrations and purity values of genomic DNA isolated from four replicates each of Growth #1 & Growth #2
Purity Sample # ng/ul (260:280) 1(#1) 38.8 1.88
2 (#1) 29.2 1.84
3 (#1) 32.1 1.86
4 (#1) 30.2 1.85
1 (#2) 41.4 1.87
2 (#2) 34.4 1.85
3 (#2) 31.6 1.82
4 (#2) 32.7 1.84 Isolated genomic DNA were then run on 0.8% agarose gel to visualize. Figure 3.3 is the image of visualized genomic DNA from four replicates each of Growth #1(indicated as #1) and
Growth #2 (indicated as #2) on 0.8% agarose gel.
28
Figure 3.3: Genomic DNA from Growth #1 & Growth #2 visualized on 0.8% agarose gel
Lane 1: 1kb ladder (Quick- Load 1kb ladder- NEB, MA)
Lane 2: Genomic DNA #1 from Growth #1 (77.6ng loaded)
Lane 3: Genomic DNA #2 from Growth #1 (87.6ng loaded)
Lane 4: Genomic DNA #3 from Growth #1 (64.2ng loaded)
Lane 5: Genomic DNA #4 from Growth #1 (60.4ng loaded)
Lane 6: Genomic DNA #1 from Growth #2 (82.8ng loaded)
Lane 7: Genomic DNA #2 from Growth #2 (68.8ng loaded)
Lane 8: Genomic DNA #3 from Growth #2 (63.2ng loaded)
Lane 9: Genomic DNA #4 from Growth #2 (65.4ng loaded)
29 PCR amplification of ITS region and sequence analysis
The extracted genomic DNA from Growth #1 and Growth #2 were used in PCR to amplify the ITS region. Once the amplification was complete, PCR products from Growth #1 and Growth #2 were visualized on 0.8% agarose gel. These are shown on Figure 3.4 and Figure
3.5 respectively. The amplified ITS region from Growth #1 was approximately 1.7kb. The amplified ITS region for Growth #2 was approximately 2kb. Saprolegnia sp. (AR) ITS region was used as positive control and was amplified under the same PCR conditions. The amplification of ITS region of Saprolegnia sp. (AR) was approximately 2kb. The negative control for PCR reaction was the same PCR reaction mix without genomic DNA.
30
Figure 3.4: PCR products of ITS region for Growth #1
Lane 1: 1kb ladder (Quick- Load 1kb ladder- NEB, MA)
Lane 2 - Lane 5: PCR products of ITS region for Growth #1 from different extractions of the same species.
Lane 6: (+) Control PCR product of ITS region for Saprolegnia sp. (AR)
Lane 7: (-) Control with no genomic DNA
31
Figure 3.5: PCR products of ITS region for Growth #2
Lane 1: 1kb ladder (Quick- Load 1kb ladder- NEB, MA)
Lane 2- Lane 7: PCR products of ITS region for Growth #2 from different extractions of the same species.
Lane 8: (+) Control PCR product of ITS region for Saprolegnia sp. (AR)
Lane 9: (-) Control with no genomic DNA
Following the PCR reactions, all four PCR amplicons from Growth #1 were pulled together and named as Growth #1 Sample #1. From PCR reactions from Growth #2 the reactions loaded in lanes 2,4,5 & 7 as shown in figure 3.5 which appeared as brighter bands were mixed
32 together and named as Growth #2, Sample #1. PCR reactions from Growth #1 loaded in lane 3 was not mixed along with the others as it appeared as a fainter band. PCR reaction from Growth
#2 appeared as the brightest band and that was named as Growth #2, Sample #2. These PCR samples were cleaned separately using Qiagen QIAquick PCR purification kit (Qiagen, CA).
After clean- up, concentrations and purity values were taken using NanoDrop for Growth #1 &
Growth #2 samples. NanoDrop concentrations ng/ul and purity values are given on table 3.2
Table 3.2: Concentrations and purity values for clean PCR products from Growth #1 and Growth
#2
Sample name Concentration (ng/ul) Purity (260:280)
Growth #1 Sample #1 29 1.87
Growth #2 Sample #1 21.4 1.85
Growth #2 Sample #2 30.1 1.87
Purified PCR amplicons from Growth #1 (Growth #1, Sample #1) and purified PCR amplicons from Growth #2, Sample #2 were sent out to ACGT Inc., IL for sequencing with UN lo 28S 1220 primer.
Upon receiving the sequence results, sequence chromatograms were manually checked with the FASTA file one nucleotide at a time to check for any variations in the sequence due to sequencing errors such as missing bases or SNPs and single nucleotide mutations.
The chromatograms were not different from FASTA files for both Growth #1 and
Growth #2. Figure 3.6 is the sequence chromatogram for Growth #1 ITS sequence with reverse primer. Figure 3.7 is the sequence chromatogram for Growth #2 ITS sequence with reverse primer.
33
Figure 3.6: The sequence chromatogram of Growth #1 ITS sequence with reverse primer
(ACGT Inc., IL)
34
Figure 3.7: The sequence chromatogram of Growth #2 ITS sequence with reverse primer.
(ACGT Inc., IL)
Sequence Analysis
blastn results based on ITS sequence on FungiDB provided the following results as the identity of the organisms:
Growth #1 was identified as Aphanomyces sp. (Aphanomyces_astaci_strain_APO3, ribosomal RNA) with 88% identity with a score of 1003 bits and gaps of 4% (32 gaps out of
865) (FungiDB Accession number KI913351) Figure 3.8 is the sequence alignment on blastn for
Growth #1 on FungiDB.
35
Figure 3.8: Sequence alignment on blastn for Growth #1 on FungiDB as of 04/29/2017
36 Growth#2 was identified as Saprolegnia sp. (Saprolegnia_parasitica_CBS_223.65, ribosomal RNA) with 93% identity with a score of 1478 bits and gaps of 1% (14/1009).
(FungiDB Accession number KK583320). Figure 3. 9 is the sequence alignment on FungiDB blastn for ITS sequence of Growth #2
37
Figure 3.9: The sequence alignment on blastn for Growth #2 on FungiDB as of
04/29/2017
38 Phylogenetic Analysis
Forty ITSI sequences for each of the isolated pathogens Aphanomyces sp. and
Saprolegnia sp. were used to construct phylogenetic tree. Maximum likelihood method with
1000 bootstrap was used to estimate the accuracy of the tree. The phylogenetic tree for genus
Aphanomyces showed that the isolated pathogen (Growth 1 Aphanomyces sp.) branched out as a different species with less degree of homology to other species (Figure 3.10). The phylogenetic tree for genus Saprolegnia showed that the isolated pathogen (Growth 2 Saprolegnia sp.) showed higher degree of homology to Saprolegnia megasperma, an opportunistic aquatic oomycete found on excrement of aquatic birds and Saprolegnia monoica isolate which is an aquatic oomycetes found on decaying plant materials (Czeczuga et al., 2002). (Figure 3.11).
39
Figure 3.10. The phylogenetic tree for genus Aphanomyces showed that the isolated pathogen
(Growth1 Aphanomyces sp**) branched out as a different species with less degree of homology to other species.
40
Figure 3.11. The phylogenetic tree for genus Saprolegnia showed that the isolated pathogen
(Growth 2 Saprolegnia sp**) showed higher degree of homology to Saprolegnia megasperma, and Saprolegnia monoica isolate.
41 Aim 3: Chitinase Assay
The surface area of mycelial growth
The surface area of mycelia of Aphanomyces sp. on YPS media with varying percentages of chitin was measured as preliminary data to follow subsequent experimental methods of chitinase Assay.
Mycelia grown on 3% chitin showed the greatest average surface area over 4 days. The next greatest surface area was seen on 2% chitin. Mycelia grown on 4% chitin showed the third largest surface area. The fourth largest surface area was seen on 1% chitin and mycelia on 0% chitin showed the smallest surface area. Overall, the surface area of the mycelia increased as the chitin percentages were increasing up to 3%. At 4%, the surface area of mycelia was smaller than that at 2%. All treatments were significantly different compared to 0% (P<0.05).
42
Figure 3.12: The average surface area (cm2) from ten replicates of Aphanomyces sp. mycelia grown on YPS with varying percentages of chitin over four days. Asterisks at the edge of the treatments indicate a significant difference from 0%. *: P< 0.05. P values indicated there is a significant difference between 0% and all other treatments.
In order to observe the growth rate of mycelia on different percentages of chitin, the rate of mycelial growth in terms of their surface area was assessed. The mean difference of surface area of plates covered by mycelia between two consecutive days over 4 days were calculated.
For example, the mean difference of surface area between day 2 and day 1, day 3 and day 2, day
4 and day 3 were calculated. This would provide an assessment of the increase of mycelial surface area per day which would be informative to assess the differential growth rate of mycelia in the presence of different percentages of chitin. (Figure 3.13)
43
Figure 3.13: The increase of mycelial surface area (cm2 /day) of Aphanomyces sp. grown on
YPS with varying percentages of chitin over four days.
There is an increase in growth rate for mycelia grown on all percentages of chitin over four days. Mycelia on 0% has steady growth rate from day 1-day 3 and the growth rate has increased from day 3- day 4. Mycelia grown on 1% chitin has almost steady growth rate over four days. Mycelia grown on 3% chitin has the highest growth rate over four days. The next highest growth rate was seen for mycelia grown on 2% chitin while mycelia grown on 4% chitin showed increase of growth rate over four days but the rate was lower than that of 3% and 2%.
44 Overall, the growth rate has increased with the increasing percentage of chitin.
Dry weight of mycelia
The average dry weight of the Aphanomyces sp. mycelia grown on YPS media with varying percentages of chitin was obtained. (Figure 3.14). Mycelia grown on 3% chitin showed the highest dry weight. The next highest dry weight was for mycelia grown on 4% chitin.
Mycelia grown on 2% chitin had the third greatest dry weight. The fourth greatest dry weight was given by mycelia grown on 1% chitin and mycelia on 0% chitin showed the smallest dry weight. Overall, the dry weight of the mycelia increased as the chitin percentages increased up to 3%. At 4%, the surface area of mycelia was smaller than that at 3%. All treatments were significantly different compared to 0%.
% Chitin
Figure 3.14: The average dry weight (g) of Aphanomyces sp. mycelia grown on YPS with varying percentages of chitin. Asterisks above the bars of the treatments indicate a significant difference from 0%. *: P< 0.05.
45 The average dry weight of the mycelia has increased with increasing percentage of chitin while dry weight of mycelia grown on 4% chitin was less than that grown on 3% chitin. The P values indicated that there is a significant difference between 0% and all other treatments. Also, when tested with T-test, P values indicated that there is a significant difference between treatments 3 & 2, and 3 & 4 (data not shown).
Density of Mycelia
Average density of mycelia grown on different percentages of chitin (0%, 1%, 2%, 3% & 4%) was obtained as an assessment of the pathogen’s growth on varying percentages of chitin incorporated in the media (Figure 3.15).
46
% Chitin Figure 3.15: The average density of Aphanomyces sp. mycelia. Asterisks above the bars of the treatments indicate a significant difference from 0%. *: P< 0.05.
As the percentage of chitin incorporated in the media increased, the density of mycelia grown on them increased. The maximum density was for the mycelia grown on 4% chitin and the lowest density was for mycelia grown on 0% chitin. This indicated that in the presence of high chitin percentage, the thickness of mycelia was higher.
47 Timing for sporangia formation and zoospore release in the presence of varying percentages of chitin
The timing for sporangia formation and zoospore release was recorded for Aphanomyces sp. mycelia grown on YPS with varying percentages of chitin (Table 3.3).
Table 3.3: Timing (hours) of sporangia formation and zoospore release for Aphanomyces sp. grown on YPS with varying percentages of chitin
Chitin Percentage Time to form sporangia (h) Time to release zoospores (h)
0% 18h 21.5h
1% 18h 22.5h
2% 18h 24h
3% 24h 26h
4% 28h 30h
Compared to the control (YPS with no chitin), the timing for sporangia formation was longer for mycelia grown on YPS with 3% and 4% chitin. For mycelia grown on YPS with 0%,
1% and 2% chitin, sporangia were observed following 18 hours of incubation. The timing to release zoospores increased as the percentage of chitin increased with longest time reported for mycelia grown on YPS with 3% and 4% chitin. When tested in T-test, P values indicated that there is a significant difference in time for sporangia formation and zoospore release between 0%
& 3%, and 0% & 4%.
The zoospore counts for Aphanomyces sp.
The number of zoospores were counted from Aphanomyces sp. mycelia grown on YPS with varying chitin percentages (Figure 3.16). The zoospore count increased with increasing percentages of chitin in the media. The highest number of zoospores were seen when mycelia
48 grown on YPS with 4% chitin. The next highest was seen on YPS with 3% chitin. The third highest zoospore count was produced by mycelia grown on YPS with 2% chitin. Mycelia grown on YPS with 1%chitin had the fourth highest count zoospore count and mycelia grown on YPS with 0 % chitin gave the lowest zoospore count.
Figure 3.16: Zoospore count of Aphanomyces sp. growing in the presence or absence of chitin.
Data was collected from ten replicates. Asterisks above the bars of the treatments indicate a significant difference from 0%. *: P< 0.05. P values indicated that there is a significant difference between 0% and all other treatments.
Observing the morphology of sporangia in the presence of varying percentages of chitin
Aphanomyces sp. sporangia showed different morphology when grown on different percentage of chitin (Figure3.17A-3.17E). The length of sporangia increases with increasing percentage of chitin with 3% and 4% having the most elongated sporangia.
49
Figure 3.17A: Morphology of sporangia of Aphanomyces sp. grown on YPS media with no chitin.
Figure 3.17B: Morphology of sporangia of Aphanomyces sp. grown on YPS media containing
1% chitin.
Figure 3.17C: Morphology of sporangia of Aphanomyces sp. grown on YPS media containing
2% chitin.
50
Figure 3.17D: Morphology of sporangia of Aphanomyces sp. grown on YPS media containing
3% chitin.
Figure 3.17E: Morphology of sporangia of Aphanomyces sp. grown on YPS media containing
4% chitin.
Figure 3.17A- 3.17E Sporangial morphology of Aphanomyces sp. grown on 0% - 4% chitin. The length /size of sporangia increased with increasing percentage of chitin with 3% and
4% having the most elongated sporangia. pH indicator Assay
YPS media at pH 4.2, 4.7, 5.2 and 7.1 with pH indicator bromothymol blue with/ without chitin were made. When bromothymol blue pH indicator was added to YPS media with 1.5% chitin and YPS media without chitin, the color of both types of media at pH 4.2, 4.7 and 5.2 was bright yellow (Figure 3.18A) . When bromothymol blue pH indicator was added to YPS media with 1.5% chitin and YPS media without chitin, the initial color of both types of media at pH 7.1 was blue green (Figure 3.18B).
51
Figure 3.18A: In the presence of bromothymol blue, the color of YPS media with/ without 1.5% chitin media at pH 4.2, 4.7 and 5.2 was bright yellow.
52 Figure 3. 18B: In the presence of bromothymol blue, the color of YPS media with/ without 1.5% chitin media at pH 7.1 was blue green.
Upon adding bromothymol blue pH indicator to YPS media with 1.5% chitin and YPS media without chitin, the color of both types of media at pH 4.2, 4.7 and 5.2 was bright yellow
(Figure 3.18A) while the initial color of both types of media at pH 7.1 was blue green (Figure 3.
18B). pH indicator plate media where Aphanaomyces sp. was grown showed the following colors: pH 4.2, 4.7 and 5.2 (both YPS with no chitin and YPS + 1.5% chitin) which were initially yellow, remained yellow as the pathogen grew(Figure 3.18C-3.18E) indicating that the pH of both types of media was below 6.4. pH 7.1 which was initially blue green turned yellow as the pathogen grew. (Figure 3.18F) indicating the pH of the media turned below 6.4 as the pathogen grew.
Figure 3.18C: In the presence of bromothymol blue, Aphanomyces sp. grown on YPS media at pH 4.2 after four days A: no chitin, B: chitin.
53
Figure 3.18D: In the presence of bromothymol blue, Aphanomyces sp. grown on YPS media at pH 4.7 after four days C: no chitin, D: chitin.
Figure 3.18E: In the presence of bromothymol blue, Aphanomyces sp. grown on YPS media with at pH 5.2 after four days E: no chitin, F: chitin.
54
Figure 3.18F: In the presence of bromothymol blue, Aphanomyces sp. grown on YPS media at pH 7.1 after four days. G: no chitin, H: chitin.
Saprolegnia sp. grown in the presence of pH indicator showed the following colors:
On plates with pH 4.2, 4.7 and 5.2 (both YPS with no chitin and YPS + 1.5% chitin) which were initially yellow remained yellow as the pathogen grew indicating the pH of the media was below 6.4 as the pathogen grew. Non chitin YPS Plates at pH 7.1 which was initially blue green turned to bright yellow indicating that the pathogen produces a substance that lowers the pH of the media. (Figure 3.18G- 3.18I) YPS + 1.5% chitin plates at pH 7.1 with initial blue green color turned to a yellowish blue green color indicating the balancing out of the overall pH indicating a less production of acidic substance as the pathogen grew (Figure 3.18J)
Figure 3.18G: In the presence of bromothymolblue, Saprolegnia sp. grown on YPS media at pH
4.2 after two days I: no chitin, J: chitin.
55
Figure 3.18H: In the presence of bromothymolblue, Saprolegnia sp. grown on YPS media at pH
4.7 after two days K: no chitin, L: chitin.
Figure 3.18I: In the presence of bromothymolblue, Saprolegnia sp. grown on YPS media at pH
5.2 after two days M: no chitin, N: chitin.
56
Figure 3.18J: In the presence of bromothymolblue, Saprolegnia sp. grown on YPS media at pH
7.1 after two days O: no chitin, P: chitin.
DNS Assay
N-Acetyl glucosamine standard curve:
A standard curve for N- Acetyl glucosamine was constructed. It can also be used in the future study to estimate chitinase activity (Figure 3.19).
57
Figure 3.19: Standard curve for N- Acetyl glucosamine (NAG) using 0.05ug/ml- 0.30 ug /ml of
NAG. Five replicates were tested for each concentration of NAG and the replicated values for each concentration varied only slightly. When these values were plotted using R, the graphical output above showed them as a single point due to the values being close to each other.
Using the standard graph (Figure 3.19) the concentration of N-Acetyl glucosamine corresponding to a particular absorbance value can be determined. If chitinase activity was seen in the pathogens, and if N- Acetyl glucosamine is the only molecule in the media that reduces
DNS, the concentration of N- Acetyl glucosamine liberated by chitinase can be used to express the chitinase activity.
58 Assessing the growth capability on YPS media with varying nutrient composition
Upon placing mycelial plugs of both Aphanomyces sp. and Saprolegnia sp. on YPS media with varying composition, the growth of both pathogens on all seven media was observed.
On all seven media, the growth of Saprolegnia sp. was faster compared to Aphanomyces sp. but the density of the mycelia was lower than that of the Aphanomyces sp. The morphology of
Saprolegnia sp. was thin cotton wool like strings and the morphology of Aphanomyces sp. was thicker with cotton wool like appearance. A 28.27cm2 plate of just water agar was covered by
Saprolegnia sp. within two days indicating its fast growth even on a minimal media. A 28.27cm2 plate with just water agar was covered by Aphanomyces sp. within eight days indicating slower growth but its ability to strive on minimal media. The growth of both pathogens on water agar suggested that the pathogens could strive in nutrient depleted media.
Performing DNS Assay
Previous experiment using water agar showed that pathogens might use agar as carbon and nitrogen source for their growth. In this DNS assay, Aphanomyces sp. and Saprolegnia sp. were grown in water containing antibiotics with and without 1.5% chitin.
When Aphanomyces sp. was grown in water containing antibiotics, it gave pink color over the seven days and showed higher absorbance at 540nm in DNS assay compared to the media with water +1.5% chitin + antibiotics in which Aphanomyces sp. was grown indicating the production of a substance in control media leading to false positive results. (Figure 3.20) P values indicated that there is a significant difference between the two media in which
Aphanomyces sp. was grown.
From Day 1 (after 24 hours of inoculation) to Day 3 (after 72 hours of inoculation), the average absorbance for Aphanomyces sp. grown in 1.5% chitin water with antibiotics has
59 increased. The average absorbance has dropped from Day 4 onwards, with Day 6 (after 144 hours of inoculation) and Day 7 (after 168 hours of inoculation) having almost similar steady average absorbance. (Figure 3.20) indicating a differential reduction of DNS in the culture media over seven days.
The average absorbance at 540nm for the Water + antibiotic media in which
Aphanomyces sp. was grown changed slightly from Day 1(after 24 hours of inoculation)- Day 7
(after 168 hours of inoculation)(Figure 3.20).
60
Figure 3.20: DNS assay measured by average absorbance at 540nm for Aphanomyces sp. &
Saprolegnia sp. grown in water+ antibiotics (A water, S water) & 1.5% chitin + water + antibiotics (A chitin, S chitin) over 7 days. A= Aphanomyces sp., S= Saprolegnia sp.
Water + antibiotic only media in which Saprolegnia sp. was grown showed colorless over the seven days but showed higher absorbance in DNS assay compared to media where with water + 1.5% chitin+ antibiotic in which Saprolegnia sp. was grown (Figure 3.20) indicating the production of a substance in control media leading to false positive results. P values indicated that there is a significant difference between the two media.
61 The average absorbance for the media with water+1.5% chitin + antibiotics in which
Saprolegnia sp. was grown increased from day 1 (after 24 hours of inoculation) to day 3 (after 72 hours of inoculation) and dropped from day 4 (after 96 hours of inoculation)- day 7 (after 168 hours of inoculation). (Figure 3.20) indicating a differential reduction of DNS in the culture media over 7 days.
The average absorbance for the water +antibiotic media in which Saprolegnia sp. was grown increased in a small amount from Day 1 (after 24 hours of inoculation)- Day 7 (after 168 hours of inoculation) but it was almost the same (Figure 3.20). There was a significant difference between day 1 and day 7 when comparing the P values.
Comparing the average absorbance in water+ antibiotic media in which Aphanomyces sp. grew showed relatively higher absorbance at 540nm compared to Saprolegnia sp. grown in the same media. (Figure 3.21) indicating more reduction of DNS in the media where Aphnomyces sp grew. P values indicated that there was a significant difference between Aphanomyces sp. &
Saprolegnia sp.
The average absorbance in water +1.5% chitin with antibiotics in which Aphanomyces sp. grew showed higher absorbance at 540nm compared to the average absorbance in water + 1.5% chitin with antibiotics in which Saprolegnia sp. grew. (Figure 3.21) P values of absorbance indicated that Aphanomyces sp. grown in 1.5%chitin + water+ antibiotics was significantly different from Saprolegnia sp. grown in 1.5%chitin + water+ antibiotics.
62
Figure 3.21: Average absorbance at 540 nm for Aphanomyces sp. and Saprolegnia sp. grown in water+ antibiotics (A W, S W ) & 1.5% chitin + water + antibiotics (A C, S C) over 7 days. Red
Asterisk indicates that Aphanomyces sp. grown in water + antibiotics is significantly different from Saprolegnia sp. grown in water + antibiotics. Black asterisk indicates that Aphanomyces sp. grown in 1.5%chitin + water + antibiotics is significantly different from Saprolegnia sp. grown in 1.5%chitin + water+ antibiotics. *: P< 0.05, *: P< 0.05
In order to determine if control media with no antibiotics (water only) would not give false positive results in the control for both Aphanomyces sp. and Saprolegnia sp. the mycelial plugs from each organism was added to 15ml of sterile water (No chitin, no antibiotics) in 250ml
63 flask and incubated in a shaking incubator at 100 rpm at 25°C for seven days. DNS assay was performed daily and no pigment was observed in the cultures.
However, the average absorbance showed that even without antibiotics, the absorbance was still high giving a false positive result indicating that the pathogen could produces secondary metabolites or some other unknown substance due to stress in the nutrient deprived media. This absorbance was lower compared to the absorbance by the cultures in which water and antibiotics was used. (Figure 22) Aphanomyces sp. showed higher absorbance compared to Saprolegnia sp.
This result showed that the pathogens gave false positive results in control media regardless of the presence of antibiotics.
64
Figure 22. Average absorbance of the culture media with water without antibiotics was still higher but lower than culture media with water + antibiotics. In both cases, Aphanomyces sp. showed higher absorbance compared to Saprolegnia sp. Red Asterisk indicates that
Aphanomyces sp. grown in water + antibiotics is significantly different from Saprolegnia sp grown in water + antibiotics. Black asterisk indicates that Aphanomyces sp. grown in water with no antibiotics is significantly different from Saprolegnia sp. grown in water with no antibiotics.
*: P< 0.05, *: P< 0.05
65 In the respective methods described above, in which R language was used to analyze data, significant difference between two chosen samples were determined as needed. To determine the P value, two hypotheses were formulated. There is no significant difference between the two groups that need to be compared was the null hypothesis. There is a significant difference between the two groups that need to be compared was the alternative hypothesis. A two tail T- test for two groups that need to be compared with set up significance at 95% was performed to test the null hypothesis. The given P value in the T-test was then observed. The null hypothesis was rejected and the alternative hypothesis was accepted if the P value was less than
0.05 while stating that there is a significant difference between the two groups.
66 CHAPTER IV. DISCUSSION & CONCLUSION
Discussion
Crayfish plague can be caused by several oomycete species. These include Aphanomyces astaci, A. laevis, A. frigidophilus, A. repetans, Saprolegnia ferax, and S. australis. (Söderhäll et al.,1991; Diéguez-Uribeondo et al., 1994; Royo et al., 2004; Ballesteros et al., 2006; Filipova et al., 2013).
In this study, two oomycete pathogens were isolated from infected marbled crayfish.
Based on the ITS sequence analysis of isolated pathogens following the blast results on fungiDB, these pathogens were identified as Aphanomyces sp. with 88% identity and Saprolegnia sp. with
93% identity, respectively.
Phylogenetic analysis showed that isolated organism namely Growth #1 clustered as a different species in genus Aphanomyces and isolated organism namely Growth #2 clustered as a different species in genus Saprolegnia. Growth #2 showed a close homology to S. mgasperma and S. monoica isolates.
However, due to low identity of ITS, sequencing of additional loci such as COXI is required for a reliable identification. COXI sequences are shorter and easier to align compared to
ITS sequences (Robideau et al., 2011). Due to the oxidative environment in the mitochondria,
COXI is more prone to get damaged (mutated). Thus, the rate of nucleotide change within COXI over evolutionary time is faster than the rate of change within ITS region. Therefore, COXI can be used as molecular markers to distinguish among recently diverged groups of organisms such as closely related species (Hwang & Kim, 1999).
Chitnase is one of the virulence factors of crayfish pathogens (Andersson & Cerenius,
2002).It enables them to penetrate the crayfish cuticle by breaking down chitin in the cuticle. It
67 was therefore hypothesized that isolated oomycete pathogens that infect crayfish produce chitinases that enable the penetration of the chitinous cuticle of the crayfish. If the crayfish pathogen produces chitinase and breaks down chitin to liberate N- Acetyl glucosamine which is a monoscharide, the pathogen might be able to utilize chitin as a carbon and nitrogen source. If this is the case, the pathogen might show different levels of growth in the presence of different chitin percentages. In order to asses this, surface area of mycelia and dry weight of mycelia were measured when Aphanomyces sp. was grown on YPS containing different percentages of chitin.
The results for surface area of mycelia and dry weight of mycelia showed that with increasing chitin percentage from 1%-3%, there was a positive effect on the pathogen’s utilization in growth in terms of dry weight and then levels off at 4%.This method for chitin agar plate assay used in this study is a modified method to assess oomycetes chitinase activity adopted from a method used to isolate and study chitinolytic ability of Aeromonas spp. in Kuddus & Ahmad,
2013.
The trend seen on the surface area of the mycelia grown on YPS with different percentages of chitin could be explained based on the concentration of the nutrient in the media.
Deacetylase and deaminase produced by the pathogen could break down N- Acetyl glucosamine which was liberated by chitinase activity into glucosamine and acetic acid. Glucosamine is further broken down to glucose and ammonia (Konopka, 2012). These nutrients can be utilized by the pathogen in its growth, therefore increasing its growth rate. When there are excess nutrients, transporters could be saturated with the nutrients that further increase of nutrients would not have an effect on how much of them will be taken in by cells. This was seen when chitin was added to the YPS media at 4%.
68 When discussing about the reaction between enzyme and substrate, the factors affecting the rate of reaction should be revised. The rate of reaction increases with increasing substrate concentration. When the catalytic site of the enzyme is empty, it can bind to substrate efficiently.
As the concentration of substrate increases, the enzyme becomes saturated with the substrate and the rate of reaction does not increase with increasing amount of substrate. Thus, adding more substrate will not affect the rate of the reaction to any significant level. Due to these factors, the pathogen shows optimum growth with a bigger surface area in the presence of 3% chitin and there is a less growth (less surface area) in the presence of 4% chitin compared to 3% chitin as
4% provides more than the required amount of carbon and nitrogen. The glucose uptake is not increased with the increased glucose, the genes involved in metabolism, trichloroacetic acid cycle, oxidative phosporilation, are not expressed with glucose abundant conditions (Wu et al.,
2004).This limits/ decrease the growth of mycelia. With this condition, beyond 3% of chitin, we see a drop in mycelia growth in the presence of 4% chitin. Even if the substrate concentration is higher, still, the catalytic sites on the enzyme is limited. So, the increase in substrate has no effect on the rate of reaction after a certain limit. So the rate of breaking down of chitinase is constant after a certain concentration of the substrate and the growth of mycelia is not increased with the increasing chitin beyond 3%.
Compared to no chitin added agar plates, there was a significant increase in dry weight of the mycelia in the presence of 1%-3% because the growth was proportional to the increased chitin. But as noted above, the 4% chitin did not increase the growth of mycelia and it was less than 2% and 3%. But the dry weight was only less than 3% but greater than 2%. This could be due to the fact that even the surface area of the mycelia was less, still the mycelia grew upward
(the density is higher) confined to less surface area utilizing the optimum amount of substrate it
69 could use for growth without spreading vertically. This could make the dry weight less than 3% but greater than 2%. The analysis for the density of mycelia indicated that the mycelial density was higher with increasing percentage of chitin which means the thickness of mycelia grown in the presence of increased chitin was higher. So the highest density was reported for mycelia grown on 4% chitin while mycelia grown on 0% chitin had the lowest density.
The effect of chitin on the pathogen’s sporangia formation and zoospore release was observed as a determinant of the pathogen’s ability to carry out asexual reproduction in the presence of chitin. In asexual reproduction, crayfish pathogens have to penetrate the cuticle of the crayfish exposing their sporangia to the outside aqueous environment. Studying the relationship between chitin and asexual reproduction of the pathogen is important as it would give an idea of the effects of chitin on the penetration of mycelia through the chitinous cuticle during sporulation of crayfish pathogens. The mycelia grown on 0%-2% chitin plates showed sporangia after 18hour incubation and zoospore release after 21.5 hours- 24 hours after incubation period while mycelia grown on 3%-4% showed late sporangia formation after 24-28 hours and late zoospore release after 26 hours-30 hours after incubation period. Because the depletion of nutrients on 0%-2% chitin plates was faster than depletion of nutrients on 3%-4% chitin as they contained more chitin that the mycelia could still use which didn’t stimulate early sporangia formation. Therefore, there was a delay in sporangia formation (asexual reproduction).
It could also be possible that chitin gave a signals to delay sporangia formation. Overall, depending on the amount (percentage) of chitin, the timing of the release of zoospores increased as the nutrient level (chitin) increased.
It was shown that the zoospore count can be affected by the amount of chitin. Zoospore count increased as the chitin percentages increased indicating the utilization of chitin by the
70 pathogen. Although 3% and 4% showed much delayed sporangia formation they had more time and nutrients to make dense mycelia and elongated /bigger sporangia over time than other treatments and control. This could be explained by observing the sporangial morphology of
Aphanomyces sp. The length/ size of the sporangia increased with increasing percentage of chitin with the pathogen grown on 3% and 4% chitin had developed the most elongated sporangia. The number of zoospores produced could be higher with increased size of sporangia (Delmas et al.,
2014). This could be the reason for higher zoospore count observed.
The above relationships seen between Aphanomyces sp. and chitin suggested that the growth of the pathogen did respond to chitin. This could be due to its chitinase activity that broke down chitin to liberate N-Acetyl glucosamine which could be detected by pH indicator assay and
DNS assay.
Chitinase activity of Trichoderma isolates has been detected using colloidal chitin media with pH indicator bromocresol purple. At pH 4.7, chitin media with bromocresol purple is yellow. When Trichoderma was inoculated on the plate, it broke down chitin and liberated N-
Acetyl glucosamine as it produced chitinase. N- Acetyl glucosamine made the media basic changing the color of the yellow media to purple indicating chitinase activity around the organism (Agrawal & Kotasthane, 2012). Based on this experiment and result, bromothymol blue pH indicator was used as a simple method to detect chitinase activity of both isolated pathogens Aphanomyces sp. & Saprolegnia sp.
In the pH indicator plate assay to detect chitinase activity by detecting liberated N-Acetyl glucosamine that could result in increasing pH of the media, yellow color on pH indicator plates with without chitin on which Aphanomyces sp. was grown indicated that the pathogen produced unknown substances that decreased pH of the media even if there was (if any) resultant of N-
71 Acetyl glucosamine so that the overall pH could be less than 6.4. So it could be that the amount of chitinase might be too low to be detected by this method. However, this result showed that as the pathogen grew, it lowered the pH of the media or produced a substance that was of low pH.
Observing the growth of Saprolegnia sp. on pH indicator plates, there was some substance that was produced by the pathogen that lowered the pH (less than 6.3) but in the presence of chitin, the acidic substance could be produced at low level. So looking at the pH 4.2-
7.1, chitin less media remained yellow on plates with pH 4.2- 5.2. Pathogen that grew on chitin plates could have had chitinase activity that made the media basic but it could have been balanced out by the pH of the surrounding media and the overall pH could be below 6.3 so the media remained yellow. On pH 7.1 media which contained chitin, where there was less acidic substance was produced, as the NAG is at pH 7- 8.5, the pH of the resultant media was above 6.8 and showed a blue/green color.
The reason for the difference in color between Aphanomyces sp. and Saprolegnia sp. could be that Aphanomyces sp. might be producing a substance that is of very low pH that surpasses the basicity of the media arising from N- Acetyl glucosamine (if the chitinase activity is present.) Saprolegnia sp. might be producing an acidic substance but it could not be too acidic as the substance produced by Aphanomyces sp. and the production of acidic substance from
Saprolegnia sp. could be low in the presence of chitin.
The growth assay for both Aphanomyces sp. and Saprolegnia sp. on different strength of
YPS media with/without chitin and media with just agar and water was performed to decide which minimal media would be suitable to use in DNS assay. The growth of Aphanomyces sp. &
Saprolegnia sp. in all minimal media including in the presence of just agar and water suggested that the pathogens could utilize even the minimal amount of nutrients. Agar consists of agarose
72 and agaropectin both of which are polysaccharide polymers. Both pathogens could break down and utilize these polysaccharide polymers and facilitate their growth. This result suggested that the pathogens might grow in water + 1.5% chitin liquid media which could be a good minimal media for DNS assay to assess chitinase activity. In this 1.5% chitin +water media, pathogens would utilize chitin as the sole carbon and nitrogen source. If there is chitinase activity in the pathogens, it would break down chitin to liberate N- acetyl glucosamine (NAG) which is a reducing sugar that would reduce 3, 5- Dinitro salicylic acid (DNS) to 3-Amino-5-nitro salicylic acid (ANS).
The expectation in the DNS assay was that the treatment groups with 1.5% chitin +water
+antibiotics should show higher absorbance at 540nm, because if chitinase was produced by the pathogen, it would break down chitin in the media to give reducing sugars such as Chtobiose and NAG which would reduce DNS to 3-amino,5-nitrosalicylic acid (ANS) upon heating.
The control groups which consists of only water + antibiotics should not give positive result when treated with DNS since there was no chitin in it. In the DNS assay performed for
Aphanomyces sp. the reason for observing higher absorbance at 540nm for control (water + antibiotics) media could be due to absorbance by the pigment (secondary metabolite) that has been produced by the pathogen in the absence of a carbon source. In some fungal species, a pigment called Bikaverin which is a polyketide is produced in response to lack of nitrogen, sugars, other nutrients and in the low pH (Limon et al., 2010) These pigments are made to protect them from environmental stress such as UV (Medent- sev et al., 2005). So in oomycetes, pigments similar to those could be produced in response to stress/ harsh environmental conditions.
73 The reason for Saprolegnia sp. to show higher absorbance in control (water + antibiotics) media could be due to a secondary metabolite such as polyketides produced by the pathogen in the absence of a carbon source and as a response to stress from the nutrient deficient environment that contained just water and antibiotics. Probably these secondary metabolites could have reduced DNS to ANS and given characteristic brick red color. So, in both cases of
Aphanomyces Sp. and Saprolegnia Sp., the control showed false positive because there was no reducing sugar released from chitin but pigments or another reducing agent like an unknown polyketide produced by the pathogen could have caused the color change thus interfere with the absorbance of NAG at 540nm.
It could also be possible that the antibiotics in the media might have reacted with DNS to reduce DNS to ANS to give characteristic color. This is further discussed later in this chapter.
In addition to these possibilities, there could be side reactions that might have taken place between DNS and other by products produced from breaking down of chitinous cuticle in the treatment samples that could give false positive results. This is also discussed later in this chapter. Due to these false positive results, it was not possible to provide evidence for chitinase activity in either Aphanomyces sp. or Saprolegnia sp. based on DNS assay.
The shrimp cuticle contains chitin, proteins, lipids, esters and CaCo3 (Rodde et al., 2008)
Oomycetes that infect crayfish release chitinase, protease, esterase and lipase as they penetrate the cuticle of crayfish.
Esterase hydrolyze esters to release an alcohol and acid. Lipase is a subclass of esterase released from the pathogen that breaks down lipids into mono glycerides and two fatty acids.
Protease produced by the pathogen hydrolyzes peptide bonds in polypeptide chains and releases amino acid. Oomycetes utilize these amino acid as carbon and nitrogen sources in their growth.
74 Amino acids are divided into two groups, glucogenic amino acids and ketogenic amino acids based on their potential for gluconeogenesis. Glucogenic amino acids can be converted into precursors of gluconeogenesis such as pyruvate or intermediates in Krebs cycle. Ketogenic amino acids are converted to acetyl CoA which is important in fatty acid synthesis. In this manner, amino acids released from proteolysis can be utilized by oomycete as a carbon source and the amino group released from amino acid can be utilized as nitrogen source. This could explain the observed growth of mycelia upon breaking down of proteins present in cuticle. The alcohol released from esterase activity might have effects on DNS assay. Alcohol will affect the reaction between DNS and reducing sugar or it might have effects on the absorption of the colored product ANS by altering the solvent cage polarity and the stability of the excited stage.
(Numan & Ford, 2015).There could be reactions between glycerols / monoglycerides, fatty acids released from lipase activity and DNS that could give false positive/ negative results. (By reducing DNS to ANS or lowering the reaction of N-acetyl glucosamine with DNS). It is also possible that the antibiotics in the media could react with other molecules in the media affecting the outcome of DNS assay. All these factors could contribute to the false positive results in treatment samples where chitin was present.
If there was chitinase activity, that could help us explain the different absorbance values resulting from different concentrations of NAG from one to seven days. If that was the case, the trend seen in the average absorbance for Aphanomyces sp. & Saprolegnia sp. grown in 1.5% chitin + water+ antibiotics over seven days (Figure 22) could be because there is a differential expression of chitinases. There are three chitinase genes in A. astaci: CHI1, CHI2 and CHI3
(Hochwimmer et al., 2009). This means, the different types of chitinases can be expressed at its maximum level at different time points. For example, when A. astaci was grown in chitin-less
75 peptone- glucose liquid medium (PG1) at 18°C, pH 6.3, the maximum CHI3 mRNA was shown after 24 hours and 48 hours. The maximum CHI2 mRNA was showed after 48 hours.
(Hochwimmer et al., 2009).
CHI 1 is expressed at high level in vegetative mycelia (Andersson et al., 2002) and showed high levels of mRNA between 9 – 24 hours. For Aphanomyces sp. and Saprolegnia sp. grown in 1.5% chitin media, the maximum absorbance was seen after 72 hours indicating overall concentration of NAG was at maximum after 72 hours. This could be because the maximum expression of chitinase was seen after 48 hours and that chitnase broke down chitin to liberate maximum NAG which was detected by absorbance reading after 72 hours. (This could be because maximum expressed chitinase takes time to act on chitin to break it down, so the maximum NAG accumulated could be seen when tested after 72 hours) The absorbance leveled off after 72 hours indicating the expression of chitinase decreased after 48 hours. This results could be used to show that the concentration of resultant N- Acetyl glucosamine from break down of chitin could have inhibitory effects on chitinase activity. Which means as NAG was accumulated, it could have prevented further breaking down of chitin. In a different study, when
Aphanomyces astaci was grown in liquid media containing chitin, at 9 hours, 1% N- Acetyl glucosamine resulting from breaking down of chitin inhibited the expression of CHI1. When N-
Acetyl glucosamine was added to crude CHI1 solution, its activity was inhibited but could be restored after removal of N- acetyl glucosamine from the media by dialysis. (Andersson et al.,
2002). These findings could reveal that chitinases could be expressed at maximum level after 48 hours and that explains the higher concentration of NAG (assuming NAG was released) when tested after three days. This could result in low /inhibited expression of chitinases. At the same time, NAG, amino acids, lipids in the media could be utilized and there is a depletion of NAG in
76 the media after three days.
The results obtained from chitinase assay indicated that chitnase produced by the isolated pathogens Aphanomyces sp. & Saprolegnia sp. could not be detected by the methods such as pH indicator assay and DNS assay used in the lab. A common method used to detect chitinase is to use chitinase assay kit by Sigma- Aldrich (CS0980). This kit detects chitinase using p- nitrophenol. The chitin substrate is linked to p-nitrophenol. The reaction is performed in acidic condition. When chitinase is added, it hydrolyzes chitin which releases p-nitrophenol (4- nitrophenol). Ionization of p-nitrophenol by addition of a basic solution makes yellow p- nitrophenylate ion which can be measured colorimetrically at 405nm.
Another method to detect the presence of chitinase is through purification of crude chitinase using gel filtration or ion-exchange chromatography. This method is mentioned in
Farag et al., 2016. With this method it is possible to detect the presence of chitinases along with other proteins and the isolated proteins can then be sequenced.
These methods can eliminate the false positive results given by the control treatment as these are specific and sensitive detection method for chitinase.
Conclusion
Two oomycete pathogens were isolated from infected marbled crayfish and identified as
Aphanomyces sp. & Saprolegnia sp. based on ITS region. This study showed that there is a positive relationship between growth of Aphanomyces sp. and the amount of chitin present in the growth media. An increase in mycelial growth was seen with increasing percentage of chitin up to a certain limit beyond which the growth leveled off. The study also showed that timeline for
Aphanomyces sp. mycelia to develop into sporangia and zoospore release increased with the amount of chitin incorporated in the media. Aphanomyces sp. produced higher zoospore count
77 with increasing amount of chitin. The length /size of sporangia increased with increasing percentage of chitin. It was also shown that both organisms Aphanomyces sp. and Saprolegnia sp. could grow in minimal media consisted of only water and agar. The pH indicator assay, although did not directly show that there is chitinase activity in Aphanomyces sp. and
Saprolegnia sp. however, it indicated that there is an acidic substance made by the pathogens.
Saprolegnia sp. might produce chitinase lowering the effect/production of the acidic substance.
Growth assay showed that both Aphanomyces sp. and Saprolegnia sp. were able to grow on minimal media supplemented with water + agar. They were also able to grow in liquid media supplemented with chitin and water indicating both organisms could utilize chitin as a sole carbon and nitrogen source. This indicated that there are enzymes released from the pathogens that break down chitinous cuticle. DNS assay showed that there are unidentified substances such as secondary metabolites and/or pigments produced from Saprolegnia sp. and Aphanomyces sp. in nutrient deprived media which interfered with the DNS assay. In DNS assay, both pathogens grown in media provided with chitin and water showed highest absorbance after 72 hours indicating the possibility of their maximum production of chitinase and other enzymes within in
48-72 hours. Based on the average absorbance readings, Aphanomyces sp. might have produced significantly higher amount of enzymes to break down chitinous cuticle compared to
Saprolegnia sp. With these observations, it is possible to state that although it was shown that chitin could have an effect on the growth of the pathogen and asexual reproduction, further testing is needed to show their chitinase production.
78 REFERENCES
Agrawal, T. & Kotasthane, A., (2012). Chitinolytic assay of indigenous Trichoderma isolates
collected from different geographical locations of Chhattisgarh in Central India. Springer,
1(1), 73
Aguilera-Muñoz, F & Valenzuela, V., Gallardo-Escárate, C., (2008). Authentication of
commercial Chilean Mollusks using ribosomal internal transcribed spacer (ITS) as species
specific DNA marker. SciELO, 72(2), 178-187
Akhan, S., Bektas, Y., Berber, S., & Kalayci, G. (2014). Population structure and genetic
analysis of narrow-clawed crayfish (Astacus leptodactylus) populations in Turkey. Genetica,
142(5), 381-395.
Alderman, D., Polglase, J., (1986). Aphanomyces astaci: Isolation and culture. Journal of fish
diseases, 9(5), 367-379
Andersson, M. G., & Cerenius, L. (2002). Analysis of chitinase expression in the crayfish
plague fungus Aphanomyces astaci. Diseases of Aquatic Organisms, 51(2), 139-147.
Aspan, A., Soderhall, K., (1991). Purification of prophenoloxidase from crayfish blood cells and
its activation by an endogeneous serine proteinase. Insect Biochem. 21, 363–373.
Badreddine, I., Lafitte, C., Heux, L., Skandalis, N., Spanou, Z., Martinez, Y., et al. (2008). Cell
wall chitosaccharides are essential components and exposed patterns of the phytopathogenic
oomycete Aphanomyces euteiches. Eukaryotic Cell, 7(11), 1980-1993.
Balci, Y., Balci, S., Blair, J. E., Park, S., Kang, S., & Macdonald, W. L. (2008). Phytophthora
quercetorum sp. A novel species isolated from eastern and north-central
79 Ballesteros I., Martín M.P. & Diéguez-Uribeondo J., 2006. First isolation of Aphanomyces
frigidophilus (Saprolegniales) in Europe. Mycotaxon, 95, 335–340.USA oak forest soils.
Mycological Research, 112(8), 906-916.
Bilodeau, G. J., Martin, F. N., Coffey, M. D., & Blomquist, C. L. (2014). Development of a
multiplex assay for genus-and species-specific detection of Phytophthora based on
differences in mitochondrial gene order. Phytopathology, 104(7), 733-748.
Carris,L., Little,C.R., Stiles,C.M.,(2012). Introduction to Fungi. American Phytopathological
Society, 3(8), 318-326
Cerenius, L. & Söderhäll, K., (1985).Repeated zoospore emergence as a possible adaptation to
parasitism in Aphanomyces. Exp. Micol., 9, 9-63
Cerenius,L., Söderhäll,K., Persson,M., Axajon,R., (1988). The crayfish plague fungus
Aphanomyces astaci diagnosis, isolation, and pathobiology. Freshwater crayfish, 7(5), 131-
144
Cerenius, L., Bangyeekhun, E., Keyser, P., Söderhäll, I., & Söderhäll, K. (2003). Host
prophenoloxidase expression in freshwater crayfish is linked to increased resistance to the
crayfish plague fungus, Aphanomyces astaci. Cellular Microbiology, 5(5), 353-357.
Chen, J., Shen, C., & Liu, C. (2010). N-acetylglucosamine: Production and applications. Marine
Drugs, 8(9), 2493-2516.
Chernin, L. S., Winson, M. K., Thompson, J. M., Haran, S., Bycroft, B. W., Chet, I., et al.
(1998). Chitinolytic activity in Chromobacterium violaceum: Substrate analysis and
regulation by quorum sensing. Journal of Bacteriology, 180(17), 4435-4441.
Czeczuga, B., Kozłowska, M., Godlewska, A., (2002). Zoosporic aquatic fungi growing on dead
specimens of 29 freshwater crustacean species. Limnologica, 32(2), 180-193.
80 Delmas, C., Mazet, I., Jolivet, J.,Delière, L., Delmotte, F., (2014). Simultaneous quantification of
sporangia and zoospores in a biotrophic oomycete with an automatic particle analyzer:
Disentangling dispersal and infection potentials. Journal of microbiological methods, 107,
169-175.
Diéguez-Uribeondo, J., Temino, C., & Múzquiz, J. (1997). The crayfish plague fungus
(Aphanomyces astaci) in Spanish. Bulletin Français De La Pêche Et De La Pisciculture,
(347), 753-763.
Diéguez-Uribeondo, J., Cerenius, L., & Söderhäll, K. (1994). Repeated zoospore emergence in
Saprolegnia parasitica. Mycological Research, 98(7), 810-815.
Diéguez-Uribeondo, J. & Söderhäll, K. (1999). Evidences for the origin of an outbreak of
Aphanomycosis in Spain. Freshwater crayfish, 12, 313-318.
Evans, L., Egerton, B., (2002). Pathogens, parasites and commensals. Biology of Freshwater
Crayfish. Aquaculture Annual Review of Fish Diseases, 206, 57-135
Eye, L. L., Sneh, B., & Lockwood, J. (1978). Factors affecting zoospore production by
Phytophthora megasperma var. sojae. Phytopathology, 68(1766), 1768.
Farag, A., Abd-Elnabey, H., Hassan, A., El-Shenawy M., (2016). Purification, characterization
and antimicrobial activity of chitinase from marine-derived Aspergillus terreus. The
Egyptian journal of aquatic research, 42(2), 185-192.
Filipová, L., Petrusek, A., Matasová, K., Delaunay, K., Grandjean, F., (2013). Prevalence of the
crayfish plague pathogen Aphanomyces astaci in populations of the signal
crayfish Pacifastacus leniusculus in France: Evaluating the threat to native crayfish. Plos,
8(7), 331-342.
81 Funkhouser, J. D., & Aronson, N. N. (2007). Chitinase family GH18: Evolutionary insights from
the genomic history of a diverse protein family. BMC Evolutionary Biology, 7(1), 1.
Guerriero, G., Avino, M., Zhou, Q., Fugelstad, J., Clergeot, P., & Bulone, V. (2010). Chitin
synthases from saprolegnia are involved in tip growth and represent a potential target for
anti-oomycete drugs. Plos, 6(8), e1001070.
Häll, L., & Unestam, T. (1980). The effect of fungicides on survival of the crayfish plague
fungus, Aphanomyces astaci, oomycete, growing on fish scales. Mycopathologia, 72(3),
131-134.
Hochwimmer, G., Tober, R., Bibars-Reiter, R., Licek, E., & Steinborn, R. (2009). Identification
of two GH18 chitinase family genes and their use as targets for detection of the crayfish-
plague oomycete Aphanomyces astaci. BMC Microbiology, 9(1), 1.
Hwang, U., & Kim, W., (1999). General properties and phylogenetic utilities of nuclear
ribosomal DNA and mitochondrial DNA commonly used in molecular systematics. The
Korean journal of parasitology, 37(4), 215–228.
Islam, T., (2010) Morphology and behavior of the successive generations of secondary zoospores
of the damping –off pathogen Aphanomyces cochlioides Journal of Plant Pathology. 92 (2),
471-478.
Kim, K. S., & Judelson, H. S. (2003). Sporangium-specific gene expression in the oomycete
phytopathogen Phytophthora infestans. Eukaryotic Cell, 2(6), 1376-1385.
Konopka, J., (2012). N-Acetylglucosamine Functions in Cell Signaling. Scientifica, 12(3), 106-
121.
82 Krugner-Higby, L., Haak, D., Johnson, P. T., Shields, J. D., Jones III, W. M., Reece, K. S., et al.
(2010). Ulcerative disease outbreak in crayfish Orconectes propinquus linked to
saprolegnia australis in big muskellunge lake, Wisconsin. Diseases of Aquatic Organisms,
91(1), 57-66.
Kuddus, M., & Ahmad, I. (2013). Isolation of novel chitinolytic bacteria and production
optimization of extracellular chitinase. Journal of Genetic Engineering and Biotechnology,
11(1), 39-46.
Kusters, J. G., van Vliet, A. H., & Kuipers, E. J. (2006). Pathogenesis of Helicobacter pylori
infection. Clinical Microbiology Reviews, 19(3), 449-490.
Leger, R., Joshi, L., Bidochka,M., Rizzo,N., Roberts, D., (1996). Characterization and
Ultrastructural Localization of Chitinases from Metarhizium anisopliae, M. flavoviride, and
Beauveria bassiana during Fungal Invasion of Host (Manduca sexta) Cuticle. Applied and
environmental microbiology, 907-912
Limón, M., Rodríguez-Ortiz, R., Avalos, J., (2010). Bikaverin production and applications.
Applied microbiology and biotechnology, 87(1), 21-29.
Link, V., Powelson, M., Johnson,K.,(2002). Oomycetes. American Phytopathological Society,
8(4), 238-251.
Lohtander, K., Pasonen, H., Aalto, M. K., Palva, T., Pappinen, A., & Rikkinen, J. (2008).
Phylogeny of chitinases and its implications for estimating horizontal gene transfer from
chitinase-transgenic silver birch (Betula pendula). Environmental Biosafety Research,
7(04), 227-239.
83 Lohtander, K., Pasonen, H., Aalto, M. K., Palva, T., Pappinen, A., & Rikkinen, J. (2008).
Phylogeny of chitinases and its implications for estimating horizontal gene transfer from
chitinase-transgenic silver birch (Betula pendula). Environmental Biosafety Research,
7(04), 227-239.
Longshaw, M. (2011). Diseases of crayfish: A review. Journal of Invertebrate Pathology, 106(1),
54-70.
Lucas,J.,Hayter,J.,&Crute, I., (1995).The Downy Mildews: Host specificity & pathogenesis in
plant diseases. Permagon, 217-234.
Makkonen, J., Jussila, J., & Kokko, H. (2012). The diversity of the pathogenic oomycete
(Aphanomyces astaci) chitinase genes within the genotypes indicate adaptation to its hosts.
Fungal Genetics and Biology, 49(8), 635-642.
Marren, P., (1986). The lethal harvest of crayfish plague. New scientist, 109(1493), 46-50
Martin, F. N., & Tooley, P. W. (2003). Phylogenetic relationships among phytophthora species
inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II
genes. Mycologia, 95(2), 269-284.
Medentsev, A., Arinbasarova, A., Akimenko, V., (2005). Biosynthesis of naphthoquinone
pigments by fungi of the genus Fusarium. Prikl biochem microbiol 41, 573– 577.
Morris, P. F., Schlosser, L. R., Onasch, K. D., Wittenschlaeger, T., Austin, R., & Provart, N.
(2009). Multiple horizontal gene transfer events and domain fusions have created novel
regulatory and metabolic networks in the oomycete genome. Plos One, 4(7)
Murthy, N. & Bleakley, B. (2012) Simplified method of preparing colloidal chitin used for
screening of chitinase-producing microorganisms. The internet journal of microbiology,
10(2), 214- 219.
84 Numan, N., & Ford, J., (2015). Effect of ethyl alcohol on the Dinitrosalicylic acid assay for
reducing sugars. Journal of chemistry, 4(3), 31-34
Oditmann,B., S. Bausewein, L. Hölzle, R. Hoffmann & M. Wittenbrink. 2001. Identification of
the crayfish plague fungus Aphanomyces astaci by polymerase chain reaction and restriction
enzyme analysis. Veterinary Microbiology 85: 183-194.e6133.
Paoletti, M. G., Norberto, L., Cozzarini, E., & Musumeci, S. Role of chitinases in human
stomach for chitin digestion: AMCase in the gastric digestion of chitin in gastric
pathologies.
Punja, Z. K., & Zhang, Y. Y. (1993). Plant chitinases and their roles in resistance to fungal
diseases. Journal of Nematology, 25(4), 526-540.
Ramı́rez, M. G., Avelizapa, L. R., Avelizapa, N. R., & Camarillo, R. C. (2004). Colloidal chitin
stained with remazol brilliant blue R®, a useful substrate to select chitinolytic
microorganisms and to evaluate chitinases. Journal of Microbiological Methods, 56(2), 213-
219.
Robideau, G. P., De, C., Artur, W., Coffey, M. D., Voglmyr, H., Brouwer, H., et al. (2011).
DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed
spacer. Molecular Ecology Resources, 11(6), 1002-1011.
Rodde, R., Einbu, A., Varum, K., (2008). A seasonal study of the chemical composition and
chitin quality of shrimp shells obtained from northern shrimp (Pandalus
borealis). Carbohydrate Polymers, 71(3), 388-393.
Royo, F., Andersson, G., Bangyeekhun, E., Muzquiz, J., Soderhall, K., Cerenius, L., (2004).
Physiological & genetic characterization of some new Aphanomyces strains isolated from
freshwater crayfish. Vet. Microbiol., 104;103-112
85 Sensson, E., & Unestam, T. (1975). Differectial induction of zoospore encystment and
germination in Aphanomyces astaci, oomycetes. Physiologia Plantarum, 35(3), 210-216.
Schechter, M., Vencato, M., Jordan,K., Schneider,S., Schneider,D., Collmer,A.(2006). Multiple
approaches to a complete inventory of Pseudomonas syringae pv. tomato DC3000 type III
secretion system effector proteins. Molecular Plant-Microbe Interactions 19: 1180–1192.
Schrimpf, A., Schmidt, T., Schulz, R., (2014). Invasive Chinese mitten crab (Eriocheir sinensis)
transmits crayfish plague pathogen Aphanomyces astaci. Regional Euro-Asian Biological
Invasion Center, 9(2), 203-209
Schickler, H., Haran, S., Oppenheim, A., Chet, I., (1998) Induction of the Trichoderma
harzianum chitinolytic system is triggered by the chitin monomer N-acetyl glucosamine.
Mycol Res, 102:1224–1226.
Smith, V.J., Söderhäll, K., (1983). Induction of degranulation and lysis of haemocytes in the
freshwater crayfish, Astacus astacus, by components of the prophenoloxidase activating
system in vitro. Cell Tissue Res. 233, 295–303
Söderhäll, K., Svensson, E., & Unestam, T., (1978). Chitinase and protease activities in
germinating zoospore cysts of a parasitic fungus, Aphanomyces astaci, Oomycetes.
Mycopathologia 64: 9–11.
Strand, D. (2013). Environmental DNA monitoring of the alien crayfish plague pathogen
Aphanomyces astaci, in freshwater systems.
Sutton, L. M., & Starzyk, M. J. (1972). Procedure and analysis of a useful method in determining
mycelial dry weights from agar plates. Applied Microbiology, 24(6), 1011-1012.
86 Tuffs, S., & Oidtmann, B. (2011). A comparative study of molecular diagnostic methods
designed to detect the crayfish plague pathogen, Aphanomyces astaci. Veterinary
Microbiology, 153(3), 343-353.
Unestam, T., & Svensson, E. (1971). Physiological variation in strains of Aphanomyces astaci.
Physiologia Plantarum, 25(3), 414-416.
Unestam, T., & Weiss, D. (1970). The host-parasite relationship between freshwater crayfish and
the crayfish disease fungus Aphanomyces astaci: Responses to infection by a susceptible
and a resistant species. Microbiology, 60(1), 77-90.
Unestam, T. (1966). Studies on the crayfish plague fungus Aphanomyces astaci. Physiologia
Plantarum, 19(4), 1110-1119.
Unestam, T. (1968). Some properties of unpurified chitinase from the crayfish plague
fungus,Aphanomyces astaci. Physiologia Plantarum, 21(1), 137-147.
Unestam, T. (1969). On the adaptation of Aphanomyces astac,as a parasite. Physiologia
Plantarum, 22(2), 221-235.
Unestam, T. (1969). On the physiology of zoospore production in Aphanomyces astaci.
Physiologia Plantarum, 22(2), 236-246.
Unestam, T., & Gleason, F. H. (1968). Comparative physiology of respiration in aquatic fungi
and saprolegniales, especially Aphanomyces astaci. Physiologia Plantarum, 21(3), 573-588.
Van de Peer, Y., Chapelle, S., De Wachter R., (1996). A quantitative map of nucleotide
substitution rates in bacterial rRNA. PMC, Nucleic acid research, 24(17):3381-91
Vrålstad, T., Knutsen, A. K., Tengs, T., & Holst-Jensen, A. (2009). A quantitative TaqMan®
MGB real-time polymerase chain reaction based assay for detection of the causative agent
of crayfish plague Aphanomyces astaci. Veterinary Microbiology, 137(1), 146-155.
87 Vrålstad, T., Knutsen, A. K., Tengs, T., & Holst-Jensen, A. (2009). A quantitative TaqMan®
MGB real-time polymerase chain reaction based assay for detection of the causative agent
of crayfish plague Aphanomyces astaci. Veterinary Microbiology, 137(1), 146-155.
Wage, A. S., Vardund, T., Lund, V., & Kapperud, G. (1999). Detection of small numbers of
Campylobacter jejuni and Campylobacter coli cells in environmental water, sewage, and
food samples by a seminested PCR assay. Applied and Environmental Microbiology, 65(4),
1636-1643.
Williams, M., Magarey, P., & Sivasithamparam, K. (2007). Influence of environmental factors
on germination of Plasmopara viticola sporangia sourced from Mediterrania & Western
Australia. Phytopathologia Mediterranea, 46(2), 225-229.
Wu, J., Zhang, N., Hayes, A., Panoutsopoulou, K., & Oliver, S. G. (2004). Global analysis of
nutrient control of gene expression in Saccharomyces cerevisiae during growth and
starvation. Proceedings of the National Academy of Sciences of the United States of
America, 101(9), 3148-3153.
Yang, L., Tan, Z., Wang, D., Xue, L., Guan,M., Huang, T., Li, R., (2014). Species identification
through mitochondrial rRNA genetic analysis. Scientific reports, 11(2), 238-249
Zelaya- Molina, L., Ortega, M., Dorrance, A., (2011). Easy and efficient protocol for oomycete
DNA extraction suitable for population genetic analysis. Biotechnology letters, 33(4), 715–
720