Mapping the Transglycosylation Relevant Sites of Cold-Adapted -D

International Journal of Molecular Sciences

Article Mapping the Transglycosylation Relevant Sites of Cold-Adapted β-d-Galactosidase from Arthrobacter sp. 32cB

Maria Rutkiewicz 1,2,* , Marta Wanarska 3 and Anna Bujacz 1 1 Institute of Molecular and Industrial Biotechnology, Faculty of Biotechnology and Food Sciences, Lodz University of Technology, Stefanowskiego 4/10, 90-924 Lodz, Poland; [email protected] 2 Macromolecular Structure and Interaction, Max Delbrück Center for Molecular Medicine, Robert-Rössle-Straße 10, 13125 Berlin, Germany 3 Department of Molecular Biotechnology and Microbiology, Faculty of Chemistry, Gdansk University of Technology, Narutowicza 11/12, 80-233 Gdansk, Poland; [email protected] * Correspondence: [email protected]

Received: 30 June 2020; Accepted: 24 July 2020; Published: 28 July 2020

Abstract: β-Galactosidase from Arthrobacter sp. 32cB (ArthβDG) is a cold-adapted enzyme able to catalyze hydrolysis of β-d-galactosides and transglycosylation reaction, where galactosyl moiety is being transferred onto an acceptor larger than a water molecule. Mutants of ArthβDG: D207A and E517Q were designed to determine the significance of specific residues and to enable formation of complexes with lactulose and sucrose and to shed light onto the structural basis of the transglycosylation reaction. The catalytic assays proved loss of function mutation E517 into glutamine and a significant drop of activity for mutation of D207 into alanine. Solving crystal structures of two new mutants, and new complex structures of previously presented mutant E441Q enables description of introduced changes within active site of enzyme and determining the importance of mutated residues for active site size and character. Furthermore, usage of mutants with diminished and abolished enzymatic activity enabled solving six complex structures with galactose, lactulose or sucrose bounds. As a result, not only the galactose binding sites were mapped on the enzyme’s surface but also the mode of lactulose, product of transglycosylation reaction, and binding within the enzyme’s active site were determined and the glucopyranose binding site in the distal of active site was discovered. The latter two especially show structural details of transglycosylation, providing valuable information that may be used for engineering of ArthβDG or other analogous galactosidases belonging to GH2 family.

Keywords: β-d-Galactosidase; cold-adapted; transglycosylation; lactulose; sucrose; complex structures; crystal structures; mutants

1. Introduction β-d-Galactosidases (βDGs), enzymes catalyzing hydrolysis of β-d-galactosides, belong to five different glycosyl hydrolase (GH) families: GH1, GH2, GH35, GH42, and GH59, as the classification was made based on protein fold not its primary activity. Their common feature is the presence of a TIM barrel fold catalytic domain; however, they differ in the number of surrounding domains possessing β architecture [1]. β-d-Galactosidases belonging to the GH2 family are large proteins, usually ~100 kDa, of which the active forms are: tetramers [2–4], hexamers [5], and as recently discovered dimers [6,7]. Their catalytic site can be divided into a galactose binding subsite and a platform for weak binding of different moieties [8]. Their primary mode of action is to catalyze the hydrolysis of lactose to d-galactose

Int. J. Mol. Sci. 2020, 21, 5354; doi:10.3390/ijms21155354 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, 5354 2 of 19 and d-glucose. Some of GH2 β-d-galactosidases are able to catalyze transglycosylation reactions when the galactosyl moiety is transferred onto an acceptor larger than a water molecule. The best studied example is lacZ β-d-galactosidase from Escherichia coli, which produces allolactose, disaccharide composed of d-galactose, and d-glucose moieties linked through a β-(1 6)-glycosidic bond, if excess → of galactose occurs [9,10]. Prebiotics are non-digestible food ingredients that support development and functioning of human organisms through selective assistance of growth or activity of one or a number of bacteria species in the lower intestine [11–13]. Ones that are used to enrich a daily diet are chosen to stimulate the growth of bacteria from Bifidobacteria or Lactobacilli families [14–17]. The importance of prebiotics, especially galactooligosaccharides, as an additive to infant formula has been widely tested. They support the colonization of intestines by beneficial bacteria. In consequence, they strengthen immunity by prevention of bacterial adhesion at an early stage of infection [18–25]. Morerover, some oligosaccharides are a rich source of sialic acid, indispensable for proper development of the brain [26,27]. Prebiotics are also important in adults’ nutrition, as they may support absorption of minerals [28–30], support recovery after influenza, reduce stress-related digestive problems [31], support lipid metabolism, and also counteract the development of tumors. They augment prevention in liver encephalopathy, glycemia/insulinemia, and also have a positive effect on immunomodulation [12,32]. Even though prebiotics such as galactooligosaccharides (GOS) and heterooligosaccharides (HOS) have been successfully synthesized, their production in the course of enzymatic catalysis proved to be more beneficial due to the higher specificity of product and milder reaction conditions. For this purpose, glycosyltransferases (EC 2.4) or glycosidic hydrolases (EC 3.2.1) are used—enzymes that have the ability to catalyze the transfer of a galactosyl moiety to a sugar acceptor. Nowadays, both for lactose removal and GOS/HOS synthesis, the β-d-galactosidase from Kluyveromyces lactis is predominantly used [33–36]. Introduction of new enzyme into food production must be preceded by a number of studies that will not only ensure its high efficiency but will also ensure the consumers’ safety. Enzyme immobilization may be the way to ensure that it will not induce allergic reactions in humans. Nonetheless, an implementation of cold-adapted enzymes would reduce the overall process temperature bringing numerous benefits [37,38]. Lowering the temperature of the process eliminates need for heating. Therefore, not only are costs being cut, but the process becomes more environmentally friendly. Furthermore, final product quality may be improved, as conducting enzymatic reactions at low temperature in food processing prevents the loss of valuable substances and formation of undesired products of heat conversions. What is more, cold-adapted enzymes are perfect candidates to perform catalysis in organic solvent environment which is especially interesting for the pharma industry. This broad range of benefits that can be achieved by implementation of cold-adapted enzymes provides rationale for the efforts to engineer enhanced activity cold-adapted enzymes tailored for an exact industrial applications [39,40]. The natural way of research is to provide as a first step structural information that can be further used for knowledge base enzyme engineering. However, due to the difficulty of cold-adapted enzymes’ crystallization the amount of crystal structures available in Protein Data Bank is surprisingly low. Only structures of 11 cold-adapted glycosyl hydrolases are deposited there: α-amylase from Alteromonas haloplanctis [41], endo-1,4-beta-glucanase from Eisenia fetida [42], psychrophilic endo-beta-1,4-xylanase [43], β-1,4-d-mannanase from Cryptopygus antarcticus [44], chitinase from Moritella marina [45], endo-beta-1,4-xylanase from Aegilops speltoides subsp. speltoides [43], β-glucosidase from Exiguobacterium antarcticum B7 [46], xylanase from Pseudoalteromonas haloplanktis [47], β-galactosidase from Rahnella sp. R3 [48], β-d-galactosidase from Paracoccus sp. 32d [6], and further discussed here β-d-galactosidase from Arthrobacter sp. 32 cB [7]. Hence, detailed information on the structure of β-d-galactoside processing cold-adapted enzyme that could be used for prebiotics production at the industrial scale is still in demand. The modification of transglycosylase activity specificity and efficiency may be achieved by controlling reaction equilibrium or by enzyme engineering. Studies concentrated on introducing mutations into subsites of GHs showed that the modulation of Int. J. Mol. Sci. 2020, 21, 5354 3 of 19 hydrolysis and transglycosylation activities can be achieved by means of knowledge-based enzyme engineering. However, the role of individual amino acids in the active site must be discovered as basis for successful design of an enzyme with specific, desired activities [49]. Psychrophilic β-d-galactosidase from Arthrobacter sp. 32cB is an interesting candidate for industrial use, as it can hydrolyze lactose at rate comparable to mesophilic βDG from Kluyveromyces lactis. Furthermore, it exhibits additional transglycosylation activity, it catalyzes synthesis of GOS and HOS, for example: lactulose and alkyl glycosides. [50] Architecture of its five domains [7], structural details of hydrolysis of lactose catalyzed by this enzyme [51], and its structural features responsible for the enzyme’s cold adaptation [52] were investigated and discussed previously. Upon the solution of native structure, E441 and E517 were assigned as catalytic residues based on superposition of ArthβDG structure with lacZ E. coli β-d-galactosidase [7]. The role of residue E441 was previously proven: a loss-of-function mutant E441Q was designed, a biochemical activity assay was performed, and the protein was crystallized. The introduction of point mutation E441Q did not disrupt the structure of protein, yet no catalytic activity was exhibited anymore. The complex structures ArthβDG_LACs and ArthβDG_LACd, with natural substrate-lactose bound in shallow and deep mode revealed residues directly involved in the binding of galactosyl group in two modes [51]. Especially interesting was the D207 residue, as it contributes in the deep binding of substrate by stabilizing O4 hydroxyl group but also creates a bottom of the active site limiting its size. The question of the effect of point mutation of the other catalytic residue, E517, has not been answered before. Similarly, structural elements implicated in the enzyme’s secondary activity, transglycosylation, remain elusive. This is why, two new mutants, ArthβDG_D207A and ArthβDG_E517Q, were designed to elucidate the impact of these two residues on protein’s structure and activity. Furthermore, here we attempted to shed a light on the structural side of transglycosylation catalyzed by cold-adapted GH2 ArthβDG through usage of the loss and depletion of the function mutants for crystallization and formation of complexes with selected reaction substrates or products, especially lactulose.

2. Results and Discussion

2.1. Activity of ArthβDG Mutants The hydrolytic activity of ArthβDG_D207A and ArthβDG_E517Q was measured using ONPG as a substrate. The ArthβDG_E517Q exhibited no catalytic activity, whereas activity of mutant ArthβDG_D207A was severely depleted (Table1).

Table 1. Activity of ArthβDG, ArthβDG_D207A, and ArthβDG_E517Q in hydrolysis reaction. The activity

was measured with ONPG as a substrate at 28 ◦C and pH 8.0.

Protein Speciﬁc Activity (U/mg) ArthβDG 212.01 3.90 ± ArthβDG_D207A 0.70 0.01 ± ArthβDG_E517Q 0

The results of the activity assays show that the hydrolytic activity of the enzyme was aﬀected not only when catalytic residues were mutated but also when the mutation of the amino acids that play a key role in building the active site was introduced. As expected of the mutation of the catalytic residue, E517 into glutamine caused loss of function of the enzyme. The mutation of the residue involved in the stabilization of galactosyl moiety within active site, D207, diminished the enzyme’s activity. Such a drastic drop of activity related to the mutation of one of the residues contributing to binding and positioning of the substrate in the active site of enzyme suggests that the net of interactions within the ArthβDG’s active center was in a very delicate balance. This cold-adapted enzyme was already characterized by a high turnover rate, and losing contacts within its active site cripples its activity instead of further enhancement. Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 4 of 18 enzyme was already characterized by a high turnover rate, and losing contacts within its active site cripplesInt. J. Mol. its Sci. activity2020, 21, 5354instead of further enhancement. 4 of 19

2.2. Thermofluor Shift Assay 2.2. Thermofluor Shift Assay Results of the TSA (thermofluor shift assay) of ArthβDG_D207A did not exhibit significant differencesResults compared of the TSA with (thermofluor ones obtained shift for assay) wild‐type of Arth proteinβDG_D207A ArthβDG did [52]. not The exhibit highest significant melting temperaturedifferences compared (44 °C) was with obtained ones obtained in conditions for wild-type containing protein 50 mMArth sodiumβDG phosphate [52]. The highest pH 6.0. melting Similar stabilitytemperature was obtained (44 ◦C) wasfor protein obtained samples in conditions in buffers, containing such as PIPES, 50 mM HEPES, sodium MES phosphateBIS‐TRIS propane, pH 6.0. ADA,Similar and stability MOPS, was within obtained a pH range for protein 6.0–6.7, samples independently, in buffers, on such addition as PIPES, of 250 HEPES, mM NaCl. MES Using BIS-TRIS the samepropane, set of ADA, buffers and in MOPS, the pH within ranges a 5.0–6.0 pH range and 6.0–6.7,7.0–8.0 the independently, melting temperature on addition was of on 250 average mM NaCl. 3 °C lower.Using theAlso, same the setstabilization of buffers ineffect the of pH previously ranges 5.0–6.0 established and 7.0–8.0 for Arth theβ meltingDG crystallization temperature solution was on (37%average Tascimate 3 ◦C lower.TM pH Also, 8.0) augments the stabilization stability eff ectof Arth of previouslyβDG_D207A established by 7 °C compared for ArthβDG to 50 crystallization mM sodium TM phosphatesolution (37% pH Tascimate 6.0 (Figure S1).pH 8.0) augments stability of ArthβDG_D207A by 7 ◦C compared to 50 mM sodiumMutation phosphate of catalytic pH 6.0 (Figure residue S1). E517 into glutamine resulted in the elevation of the melting temperatureMutation of ofthe catalytic mutant in residue respect E517 to Arth intoβDG glutamine by 3.5–5 resulted°C, depending in the on elevation the investigated of the melting buffer solution.temperature In the of thecase mutant of 50 mM in respect sodium to phosphateArthβDG bypH 3.5–5 6.0, it◦ C,attained depending 49 °C, on which the investigated means that it bu wasffer highersolution. by In4.5 the °C case compared of 50 mM to wild sodium‐type phosphate protein. The pH trend 6.0, it of attained increasing 49 ◦ theC, which melting means temperature that it was of thehigher mutant by 4.5 Arth◦Cβ comparedDG_D207A to by wild-type approximately protein. 4 The°C was trend maintained of increasing for all the tested melting buffers temperature in the pH of rangethe mutant 6.0–7.0.Arth In βtheDG_D207A pH ranges by 5.0–6.0 approximately and 7.0–8.0, 4 ◦ theC was melting maintained temperature for all was tested elevated buffers on in average the pH byrange 3 °C 6.0–7.0. compared In the to Arth pH rangesβDG. Nonetheless, 5.0–6.0 and 7.0–8.0, the impact the melting of crystallization temperature solution was elevated on protein on stability average compareby 3 ◦C compared to 50 mM to sodiumArthβDG. phosphate Nonetheless, pH 6.0 the was impact higher of than crystallization in the case solution of Arth onβDG_N440D, protein stability by 5 °Ccompare (Figure to S2). 50 mM sodium phosphate pH 6.0 was higher than in the case of ArthβDG_N440D, by 5 ◦C (FigureThe S2). results of TSA showed that the introduced mutation did not lead to a dramatic drop of mutant’sThe melting results of temperature TSA showed that that would the be introduced expected mutationif mutations did would not lead have to a adestabilizing dramatic drop effect of onmutant’s the protein’s melting structure. temperature It also that showed would bethat expected they exhibited if mutations similar would features have to a destabilizingwild‐type protein; effect thus,on the crystallization protein’s structure. was attempted It also showed in conditions that they exhibitedpreviously similar established features for to wild wild-type‐type protein;protein withoutthus, crystallization initial screening. was attempted Such an inapproach conditions allowed previously us to established obtain mutants’ for wild-type crystal proteinalmost withoutreadily withoutinitial screening. need for Suchmuch an of approach a protein allowedsample. us to obtain mutants’ crystal almost readily without need for much of a protein sample. 2.3. ArthβDG Mutants 2.3. ArthβDG Mutants The structures of ArthβDG mutants: ArthβDG_D207A and ArthβDG_E517Q, were solved The structures of ArthβDG mutants: ArthβDG_D207A and ArthβDG_E517Q, were solved proving proving that the point mutations within the active site of ArthβDG have no destabilizing effect on that the point mutations within the active site of ArthβDG have no destabilizing effect on protein’s protein’s structure. In the case of ArthβDG_E517Q, only a slight change in character of the active site structure. In the case of ArthβDG_E517Q, only a slight change in character of the active site was was observed (Figure 1C)—similar to previously studied loss of function mutant ArthβDG_E441Q observed (Figure1C)—similar to previously studied loss of function mutant ArthβDG_E441Q [51]. [51].

Figure 1. RepresentationRepresentation of surface and charge distribution within the active site of ArthβDG ( A) and itsits mutants: ArthβDG_D207A ( (BB)) and ArthβDG_E517QDG_E517Q ( (CC).). The The residues residues under scrutiny scrutiny are shown as stick and mutations are indicated with yellow. The charge distribution was calculated using the APBS [53] [53] plugin to PyMOL.

Int. J. Mol. Sci. 2020, 21, 5354 5 of 19 Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 5 of 18

In the case of mutant ArthβDG_D207A, where a larger side chain was substituted with alanine residue, the change in active site size and shapeshape waswas introducedintroduced (Figure(Figure1 1B).B).

2.4. Influence Inﬂuence of Mutations within Active Site on Binding of Galactosyl Residue The functional dimer of ArthβDG has two independent active sites. Each of them is located on the top of TIM TIM-barrel‐barrel Domain 3 and is constituted of residues from both subunits of the dimer. It can be described as a deep acidic funnel with an antechamber. The galactosyl moiety is stabilized in the deep binding by a net net of of hydrogen hydrogen interactions interactions between O6 and H520 (2.8 Å), D587 (3.0 Å), D207 (2.6 Å) and sodium ion (2.4 Å); O4 and D207 (2.6 Å); O3 and E517 (2.6 Å); O2 and M481 (3.3 Å) and Q441 (2.6 Å) (Figure2 2).).

Figure 2. Interactions stabilizing galactose molecule in the active site of ArthβDG_E441Q/gal complex Figure 2. Interactions stabilizing galactose molecule in the active site of ArthβDG_E441Q/gal complex structure (A). Naming convention of galactose’s oxygen atoms presented for easier interpretation (B). structure (A). Naming convention of galactose’s oxygen atoms presented for easier interpretation (B). This interaction pattern between the galactosyl moiety bound in the deep mode in the enzyme’s This interaction pattern between the galactosyl moiety bound in the deep mode in the enzyme’s active site remains uninterrupted. Single-point mutations of residues E441 and E517 introduced active site remains uninterrupted. Single‐point mutations of residues E441 and E517 introduced in in the enzyme’s active site were not suﬃcient to change spatial arrangement of galactosyl moiety the enzyme’s active site were not sufficient to change spatial arrangement of galactosyl moiety bound bound in the deep binding mode but were enough to abolish the enzyme’s activity. Even though in the deep binding mode but were enough to abolish the enzyme’s activity. Even though the mutant the mutant ArthβDG_D207A retained partial activity of the wild-type enzyme, no crystal structure ArthβDG_D207A retained partial activity of the wild‐type enzyme, no crystal structure of its complex of its complex with galactose bound within the binding site was obtained. The complex structure with galactose bound within the binding site was obtained. The complex structure ArthβDG_D207A/gal showed a galactose bound only in G1 and G2 sites (galactose binding sites ArthβDG_D207A/gal showed a galactose bound only in G1 and G2 sites (galactose binding sites described in detail in part 2.5). Lack of even a residual electron density that could be attributed to described in detail in part 2.5). Lack of even a residual electron density that could be attributed to galactose molecule presence in the active sites was consistent for more than 15 datasets obtained galactose molecule presence in the active sites was consistent for more than 15 datasets obtained under diﬀerent soaking conditions in triplicates. This may indicate that even though D207 is not a under different soaking conditions in triplicates. This may indicate that even though D207 is not a catalytic residue, its presence is essential for the enzyme function. D207 assures a correct position of catalytic residue, its presence is essential for the enzyme function. D207 assures a correct position of the substrate by retaining the net of interactions and ensuring proper shape of the active site (Figure3). the substrate by retaining the net of interactions and ensuring proper shape of the active site (Figure 3).

Int. J. Mol. Sci. 2020, 21, 5354 6 of 19

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 6 of 18

FigureFigure 3.3. The representation of the shape ofof activeactive site of ArthArthβDG_E441QDG_E441Q/gal/gal complex structure (A) andand superpositionsuperposition ofof galactosegalactose moleculemolecule onon thethe structurestructure ofof ArthArthββDG_D207ADG_D207A ((BB)) showingshowing thatthat thisthis mutationmutation introduceintroduce changeschanges inin thethe shapeshape ofof activeactive site,site, making making it it less less selective selective for for galactosyl galactosyl moiety. moiety.

CombiningCombining thethe structuralstructural datadata withwith resultsresults ofof activityactivity assaysassays suggestssuggests thatthat thethe mutationmutation ofof D207D207 eeffectsﬀects thethe enzyme’senzyme’s activityactivity by disturbing the hydroxyl group O4 stabilization of galactosyl moiety. moiety. ItIt isis causedcaused byby thethe cumulativecumulative eeffectﬀect ofof changechange inin thethe shapeshape ofof activeactive sitesite (Figure(Figure1 1)) and and removing removing possiblepossible stabilizingstabilizing contactscontacts betweenbetween carboxylcarboxyl groupgroup of of D207 D207 and and hydroxyl hydroxyl O4 O4 of of galactosyl galactosyl moiety. moiety.

2.5.2.5. Galactose Binds on the Enzyme’s SurfaceSurface DeterminingDetermining the crystalcrystal structurestructure ofof ArthArthββDG_E441QDG_E441Q/gal/gal complex at atomic resolution, 1.5 Å, resultedresulted inin discoveringdiscovering sixsix galactosegalactose binding sites at thethe surfacesurface of thethe proteinprotein (Figure(Figure4 4A).A). Five Five of of thesethese (G2–G6)(G2–G6) havehave aa potentialpotential toto bindbind largerlarger galactosides,galactosides, e.g.,e.g., lactose.lactose. The question,question, whywhy suchsuch aa largelarge enzymeenzyme waswas developeddeveloped andand retainedretained byby extremophilicextremophilic bacteriabacteria forfor catalysiscatalysis ofof relativelyrelatively simplesimple reactions,reactions, remains remains open. open. However However such such a strategy,a strategy, to elevateto elevate the accessibilitythe accessibility of a substrateof a substrate by its by weak its bindingweak binding on the on enzyme’s the enzyme’s surface, surface, may bemay one be of one explanation of explanation together together with with the maximization the maximization of the of energythe energy gain gain from from the surfacethe surface residue–solvent residue–solvent interactions interactions [52]. [52]. Previously obtained biochemical data showed that d-galactose, one of the products of enzyme’s hydrolytic activity, has an inhibitory eﬀect on protein’s activity. Its presence at 50 mM concentration results in the reduction of the enzyme’s activity by half [50]. The analysis of atomic resolution ArthβDG_E441Q/gal complex revealed that galactose binding site G1 is a possible allosteric site of enzyme. What is worth noting, is the addition of galactose was used for soaking of multiple ArthβDG complex structures to inhibit the activity of enzyme and, thus, enabled complex formation. Structural analysis of these complex structures showed that the galactose molecule was present at the G1 site for all of them, namely, previously published ArthβDG_E441Q/LACd [51] and, discussed here, ArthβDG_E517Q/lact and ArthβDG_ E441Q/lact. It should be stated that such a complex could not be successfully obtained without galactose addition. The G1 site is located in the cleft formed at the junction of tree domains: Domain 2, 3, and 4 (Figure4A). It is highly selective toward galactose molecules as residues N360, I361, and K357, constituting its bottom, shape it in such a way that binding of galactosyl moiety is highly preferred. The correct conformation of hydroxyl groups O2, O3, O4, and O6 is necessary for monosaccharide molecule to enter and bind within G1 site. Its limited size prevents basically any molecule larger than galactose from entering (Figure4B).

Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 6 of 18

Figure 3. The representation of the shape of active site of ArthβDG_E441Q/gal complex structure (A) and superposition of galactose molecule on the structure of ArthβDG_D207A (B) showing that this mutation introduce changes in the shape of active site, making it less selective for galactosyl moiety.

Combining the structural data with results of activity assays suggests that the mutation of D207 effects the enzyme’s activity by disturbing the hydroxyl group O4 stabilization of galactosyl moiety. It is caused by the cumulative effect of change in the shape of active site (Figure 1) and removing possible stabilizing contacts between carboxyl group of D207 and hydroxyl O4 of galactosyl moiety.

2.5. Galactose Binds on the Enzyme’s Surface Determining the crystal structure of ArthβDG_E441Q/gal complex at atomic resolution, 1.5 Å, resulted in discovering six galactose binding sites at the surface of the protein (Figure 4A). Five of these (G2–G6) have a potential to bind larger galactosides, e.g., lactose. The question, why such a large enzyme was developed and retained by extremophilic bacteria for catalysis of relatively simple reactions, remains open. However such a strategy, to elevate the accessibility of a substrate by its weakInt. J.binding Mol. Sci. 2020on the, 21, enzyme’s 5354 surface, may be one of explanation together with the maximization7 of of 19 the energy gain from the surface residue–solvent interactions [52].

Figure 4. Galactose (violet) binding sites G1–G6 on the surface of ArthβDG (A); structure of ArthβDG_E441Q in complex with galactose (B). The galactose molecule (violet) interacting with main chain atoms at G1 site; galactose hydroxyl group O2 interacts with oxygen K357 (2.8 Å), oxygen I361 (2.9 Å); O3 with oxygen I361 (3.4 Å), nitrogen N360 (3.5 Å) and oxygen K357 (2.7 Å); O4 with N360 (2.8 Å).

2.6. ArthβDG Mutants in Complexes with Lactulose Crystal structures of loss of function ArthβDG_E441Q and ArthβDG_E517Q mutants in complexes with lactulose were determined both at 2.0 Å resolution. Lactulose molecule, a heterooligosaccharide composed of d-galactose and d-fructose linked through a β-(1 4)-glycosidic bond and is one of the → products of transglycosylation reaction catalyzed by ArthβDG. It was bound in a deep mode in both structures (Figure5A). The galactosyl moiety is stabilized by a net of interaction characteristic for binding of this group by ArthβDG, and described in detail in Section 2.4. Fructose moiety of lactulose was stabilized relatively weakly in the position. In the case of a complex ArthβDG_E441Q/lact (Figure5C), there was only one hydrogen bond between hydroxyl group O30 of lactulose and N110 (3.2 Å). Whereas, in the case of ArthβDG_E517Q/lact (Figure5D) there were two hydrogen bonds stabilizing fructose moiety: between O30 of lactulose and N110 (3.3 Å) and O6’ and E441 (3.0 Å). What is interesting, regardless of the relatively weak stabilization of the fructose moiety of lactulose, it creates more interactions within the active site of ArthβDG than glucosyl moiety of lactose, natural substrate [51]. The hydrogen bonds, forming between sugar moiety and the amino acids at the entrance to the active site, are crucial for sugar ring stabilization indispensable for it to become a galactosyl group acceptor. Such a delicate net of interactions suggests that residues E441, N110, and possibly N440 play important roles regarding transglycosylation activity of ArthβDG. Insight into these two complex structures enables description of positioning and binding of fructose moiety, which may act as galactosyl group acceptor, in the catalytic center of ArthβDG mutants: ArthβDG_D207A and ArthβDG_E517Q. As both these mutations are distal to space occupied by fructose moiety, one may assume that similar interactions are in place in the case of wild-type enzyme. Int. J. Mol. Sci. 2020, 21, 5354 8 of 19

However, the substantially higher activity of wild-type enzyme makes it impossible to capture lactulose moleculeInt. J. Mol. boundSci. 2020 in, 21 its, x FOR active PEER site. REVIEW 8 of 18

FigureFigure 5. 5.The The position position of of lactulose lactulose binding binding by by the the loss loss of of function function mutants mutants (A ().A).2F 2Fo-Fo‐cFelectron-densityc electron‐density mapmap at at the the 2 2σ σlevel level for for the the lactulose lactulose molecule molecule in inArth ArthβDG_E517QβDG_E517Q/lact/lact complex complex (B ().B). Lactulose Lactulose bound bound inin the the active active site site of ofArth ArthβDG_E441QβDG_E441Q/lact/lact ( C(C) and) andArth ArthβDG_E517QβDG_E517Q/lact/lact ( D(D)) crystal crystal structures structures with with hydrogenhydrogen bonds bonds marked marked with with dashed dashed lines. lines.

2.7.2.7. Mapping Mapping the the Binding Binding Potential Potential of of the the Distal Distal Region Region of of Active Active Site Site

TwoTwo structures structures of theof mutants’the mutants’ complexes complexes with sucrose,with sucrose, a common a common sugar composed sugar composed of d-galoctose of D‐ and d-fructose linked through a β-(1 2)-glycosidic bond, were determined with resolution 1.7 Å for galoctose and D‐fructose linked through→ a β‐(1→2)‐glycosidic bond, were determined with resolution Arth1.7 βÅDG_E441Q for ArthβDG_E441Q/suc/suc and 2.2 Å and for Arth2.2 Åβ DG_D207Afor ArthβDG_D207A/sucr./sucr. In both cases, In both sucrose cases, wassucrose bound was in bound the samein the place same outside place outside of the active of the site active of enzyme, site of enzyme, revealing revealing a glucopyranose a glucopyranose binding binding site in its site distal in its regiondistal (Figure region 6(FigureA). 6A). In ArthβDG_D207A/sucr complex (Figure6D), the sucrose molecule was stabilized predominantly by bonds between the glucosyl moiety interacting with residues E398, E467, E468, and G443. Fructosyl moiety was stabilized by only two hydrogen bonds created between hydroxyl O6’ and side chain oxygen of E398 (2.5 Å) and the same hydroxyl group O6’ with nitrogen of W402 indole ring (3.1 Å). Sucrose molecule in complex structure of ArthβDG_E441Q/sucr moved a little toward the active site of enzyme (Figure6C), and its hydroxyl 03 interacted via hydrogen bond with the mutated catalytic residue Q441 (3.1 Å). Nonetheless, it is stabilized by a similar net of interactions involving residues E398, E467, G443, and additionally E398. Hydroxyl group O30 of fructosyl moiety was stabilized by a single hydrogen bond with indole ring nitrogen of W470. Superposition of ArthβDG_E441Q/sucr with complex structure of the same mutant with lactose bound in deep mode, ArthβDG_E441Q/LACd (PDB ID: 6SEA [51]) shows that the distance between anomeric carbon atom of galactosyl moiety bound in deep mode and hydroxyl group O4 of sucrose

Int. J. Mol. Sci. 2020, 21, 5354 9 of 19 was 6.4 Å (Figure7). This insight into sucrose binding in the distal region of active site shows how the glycosyl moiety is positioned in the vicinity of the active site, so it can become galactosyl group acceptor. Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 9 of 18

Figure 6. Location of sucrose molecule in the distal region of the active site in ArthβDG_E441Q/sucrDG_E441Q/sucr o c σ complex ( A). 2Fo‐-FF c electronelectron-density‐density map map at at the the 2 2 σ levellevel for for the saccharose molecule in ArthβDG_E441Q/sucrDG_E441Q/sucr complex complex (B (B).). Sucrose Sucrose bound bound in inthe the active active site site of Arth of ArthβDG_βDG_ E441Q/sucr E441Q/ sucr(C) and (C) Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 10 of 18 Arthand βArthDG_β DG_D207A/sucr D207A/ sucr(D) crystal (D) crystal structures structures with with hydrogen hydrogen bonds bonds marked marked with with dashed dashed lines. lines.

In ArthβDG_D207A/sucr complex (Figure 6D), the sucrose molecule was stabilized predominantly by bonds between the glucosyl moiety interacting with residues E398, E467, E468, and G443. Fructosyl moiety was stabilized by only two hydrogen bonds created between hydroxyl O6’ and side chain oxygen of E398 (2.5 Å) and the same hydroxyl group O6’ with nitrogen of W402 indole ring (3.1 Å). Sucrose molecule in complex structure of ArthβDG_E441Q/sucr moved a little toward the active site of enzyme (Figure 6C), and its hydroxyl 03 interacted via hydrogen bond with the mutated catalytic residue Q441 (3.1 Å). Nonetheless, it is stabilized by a similar net of interactions involving residues E398, E467, G443, and additionally E398. Hydroxyl group O3’ of fructosyl moiety was stabilized by a single hydrogen bond with indole ring nitrogen of W470. Superposition of ArthβDG_E441Q/sucr with complex structure of the same mutant with lactose bound in deep mode, ArthβDG_E441Q/LACd (PDB ID: 6SEA [51]) shows that the distance between anomeric carbon atom of galactosyl moiety bound in deep mode and hydroxyl group O4 of sucrose was 6.4 Å (Figure 7). This insight into sucrose binding in the distal region of active site shows how the glycosyl moiety is positioned in the vicinity of the active site, so it can become galactosyl group acceptor.

FigureFigure 7.7. Superposition of ArthβDG_E441QDG_E441Q/sucr/sucr (yellow(yellow/orange)/orange) withwith complexcomplex structurestructure ofof thethe samesame mutantmutant withwith lactoselactose boundbound in deep mode (pale greengreen/green),/green), ArthβDG_E441QDG_E441Q/LACd/LACd (PDB ID: 6SEA), showingshowing thethe positioningpositioning ofof sucrosesucrose molecule molecule toward toward galactosyl galactosyl moiety. moiety.

3. Summary Results of activity assays and analysis of a number of complex structures of new mutants of ArthβDG, ArthβDG_D207A and ArthβDG_E517Q, resulted in a better understanding of the importance of residues D207, E441, and E517 in the native enzyme. The inactive mutant E517Q was designed specially to enable binding of transglycosylation product—lactulose, in the active site of enzyme and thus elucidating the mode of its binding. Especially surprising was the gravity of mutation of D207 to alanine, which is part of Domain 1. It is situated on the top of a part of Domain 1, which inserts itself in a space between the top of Domain 3 TIM‐barrel and highly flexible C‐ terminal region of Domain 3, and constitutes bottom of the active site, which means that its mutation to alanine has a significant impact on active site volume. As such, not only a stabilizing interaction between D207 and O4 hydroxyl of galactosyl moiety is lost but also the transfer of substrate from shallow to deep binding site of the enzyme is disrupted. Furthermore, the structures of ArthβDG_D207A and ArthβDG_E517Q in complex with lactulose, which can be produced by ArthβDG in course of transglycosylation reaction, were, to best of our knowledge, the first crystal structures of galactosidase with this heterooligosaccharide, thus, providing a sought for insight in how a galactosyl group acceptor (larger than water) may approach and be accommodated (Figure 8). Such a detailed structural knowledge on the binding of lactulose pinpoints the residues that play role in the production of lactulose by ArthβDG, especially: N110. It also shows the region, where some additional hydrogen bonds, stabilizing fructosyl moiety, can be introduced to shift the reaction toward formation of lactulose instead of simple hydrolysis of glucose.

Int. J. Mol. Sci. 2020, 21, 5354 10 of 19

3. Summary Results of activity assays and analysis of a number of complex structures of new mutants of ArthβDG, ArthβDG_D207A and ArthβDG_E517Q, resulted in a better understanding of the importance of residues D207, E441, and E517 in the native enzyme. The inactive mutant E517Q was designed specially to enable binding of transglycosylation product—lactulose, in the active site of enzyme and thus elucidating the mode of its binding. Especially surprising was the gravity of mutation of D207 to alanine, which is part of Domain 1. It is situated on the top of a part of Domain 1, which inserts itself in a space between the top of Domain 3 TIM-barrel and highly flexible C-terminal region of Domain 3, and constitutes bottom of the active site, which means that its mutation to alanine has a significant impact on active site volume. As such, not only a stabilizing interaction between D207 and O4 hydroxyl of galactosyl moiety is lost but also the transfer of substrate from shallow to deep binding site of the enzyme is disrupted. Furthermore, the structures of ArthβDG_D207A and ArthβDG_E517Q in complex with lactulose, which can be produced by ArthβDG in course of transglycosylation reaction, were, to best of our knowledge, the first crystal structures of galactosidase with this heterooligosaccharide, thus, providing a sought for insight in how a galactosyl group acceptor (larger than water) may approach and be accommodated (Figure8). Such a detailed structural knowledge on the binding of lactulose pinpoints the residues that play role in the production of lactulose by ArthβDG, especially: N110. It also shows the region, where some additional hydrogen bonds, stabilizing fructosyl moiety, can be introduced to shift the reaction toward formation of lactulose instead of simple hydrolysis of glucose. Int. J. Mol. Sci. 2020, 21, x FOR PEER REVIEW 11 of 18

Figure 8. The visualization of proximal region (weak binding platform) and distal region of active site Figure 8. The visualization of proximal region (weak binding platform) and distal region of (with glycosyl binding site) in superposed complex structures of ArthβDG_E441Q/sucr, active site (with glycosyl binding site) in superposed complex structures of ArthβDG_E441Q/sucr, ArthβDG_E441Q/LACd, and ArthβDG_E517Q/lact. ArthβDG_E441Q/LACd, and ArthβDG_E517Q/lact. More valuable structural information that concerns transglycosylation activity of the enzyme Morewas obtained valuable with structural a solution information of the complex that structures concerns with transglycosylation sucrose, ArthβDG_D207A/sucr activity of the and enzyme was obtainedArthβDG_E441Q/sucr. with a solution They revealed of the complex a glucopyranose structures binding with site sucrose, in the distalArth regionβDG_D207A of active/ sucrsite, and ArthβshowingDG_E441Q how/ asucr. galactosyl They group revealed acceptor a glucopyranose that comprises binding of glucosyl site moiety in the can distal approach region the of active site, showingsite. Once how again, a galactosyl these structures group acceptor elucidate that the region, comprises mutation of glucosyl in which moiety can lead can to larger approach galactosyl the active site. Oncegroup again, acceptor these being structures available elucidateinstead of water the region, residue. mutation in which can lead to larger galactosyl group acceptorThe results being of available this work insteadcan serve of as water a basis residue. for knowledge‐based enzyme engineering of this Thecold‐ resultsadapted of enzyme. this work Especially, can serve to asshift a basis its activity for knowledge-based toward transglycosylation enzyme engineering reaction and of this improving product homogeneity. It was shown that the retention of the shape and volume of the cold-adapted enzyme. Especially, to shift its activity toward transglycosylation reaction and improving galactosyl binding site is necessary for the enzyme’s activity. Hence, mutations, if any introduced in product homogeneity. It was shown that the retention of the shape and volume of the galactosyl this region should be designed in such a way not to change the size of deep binding site, as its enlargement not only does not enhance the enzyme’s transglycosylation activity but is has a negative effect on it. It is the authors’ believe that mutations should rather be introduced in the proximal in distal regions of the active site. Especially, promoting binding of galactosyl group acceptor on the weak binding platform may prove successful in the future attempts. Furthermore, since the architecture of the active site of galactosidases from GH2 family is highly conserved, the knowledge about the mode of binding of potential galactosyl group acceptors (larger than water) within ArthβDG and its mutant structures, can be to a certain degree transferred onto other enzymes belonging to this group, among others commonly used in the food industry β‐D‐ galactosidase from Kluyveromyces lactis.

4. Materials and Methods

4.1. Site‐Directed Mutagenesis of Gene Encoding ArthβDG The gene encoding the ArthβDG enzyme within the pBAD‐Bgal32cB plasmid [50] has been mutated using the Q5 Site‐Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s protocol. For this purpose, two pairs of mutagenic primers were designed and synthesized (Genomed, Warsaw, Poland). Primers For207AspAla 5’ GTGGAGGACCAGGCCATGTGGTGGCTT 3’ and Rev207AspAla 5’ GTAGCTGGCGGCCGAGAACTGGGCGA 3’ were used to introduce a point mutation A/C at 620 nucleotide position in the gene resulting in the D207A substitution in the ArthβDG amino acid

Int. J. Mol. Sci. 2020, 21, 5354 11 of 19 binding site is necessary for the enzyme’s activity. Hence, mutations, if any introduced in this region should be designed in such a way not to change the size of deep binding site, as its enlargement not only does not enhance the enzyme’s transglycosylation activity but is has a negative eﬀect on it. It is the authors’ believe that mutations should rather be introduced in the proximal in distal regions of the active site. Especially, promoting binding of galactosyl group acceptor on the weak binding platform may prove successful in the future attempts. Furthermore, since the architecture of the active site of galactosidases from GH2 family is highly conserved, the knowledge about the mode of binding of potential galactosyl group acceptors (larger than water) within ArthβDG and its mutant structures, can be to a certain degree transferred onto other enzymes belonging to this group, among others commonly used in the food industry β-d-galactosidase from Kluyveromyces lactis.

4. Materials and Methods

4.1. Site-Directed Mutagenesis of Gene Encoding ArthβDG The gene encoding the ArthβDG enzyme within the pBAD-Bgal32cB plasmid [50] has been mutated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s protocol. For this purpose, two pairs of mutagenic primers were designed and synthesized (Genomed, Warsaw, Poland). Primers For207AspAla 50 GTGGAGGACCAGGCCATGTGGTGGCTT 30 and Rev207AspAla 50 GTAGCTGGCGGCCGAGAACTGGGCGA 30 were used to introduce a point mutation A/C at 620 nucleotide position in the gene resulting in the D207A substitution in the ArthβDG amino acid sequence. Primers F32cBmut517 50 TGGGTAACGGCCCCGGTGGAATGAGCGAAT 30 and R32cBmut517 50 TGGCATGCACATATTGGCAGAGGACAAAGGGCA 30 were used to introduce a point mutation G/C at 1549 nucleotide position in the gene resulting in the E517Q substitution in the ArthβDG amino acid sequence. Thermocycling conditions for PCRs were as follows: initial denaturation of pBAD-Bgal32cB plasmid at 98 ◦C for 30 s; then 25 cycles of PCR products ampliﬁcation consisting of 10 s of DNA denaturation at 98 ◦C, 15 s of mutagenic primers annealing at 66 ◦C for For207AspAla and Rev207AspAla, or 69 ◦C for F32cBmut517 and R32cBmut517, and 3 min 20 s of PCR product extension at 72 ◦C; and the ﬁnal extension at 72 ◦C for 7 min. The obtained PCR products were treated with KLD Enzyme Mix (Kinase, Ligase, and DpnI) at 22 ◦C for 5 min, and then used to transform NEB 5-alpha chemically competent E.coli cells (the lacZ deletion mutant, D (lacZ) M15). Transformants were spread onto selection Luria-Bertani agar plates (10 g/L of peptone K, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar) supplemented with ampicillin (100 µg/mL), X-gal (40 µg/mL) and l-arabinose (200 µg/mL), and incubated overnight at 37 ◦C and then for a few hours at room temperature. Six colonies of E. coli + pBAD-Bgal32cB_D207A (light blue colonies with weak β-d-galactosidase activity) and E. coli + pBAD-Bgal32cB_E517Q (white colonies without enzymatic activity) were selected for further studies. Recombinant pBAD-Bgal32cB_D207A and pBAD-Bgal32cB_E517Q plasmids were isolated using the Plasmid Mini Kit (A&A Biotechnology, Gdynia, Poland) and sequenced (Genomed, Warsaw, Poland).

4.2. Production of ArthβDG, ArthβDG_D207A and ArthβDG_E517Q Proteins Expression of recombinant ArthβDG, ArthβDG_D207A, and ArthβDG_E517Q mutants were performed in the E. coli LMG 194 cells (Invitrogen, Carlsbad, CA, USA) transformed with pBAD-Bgal32cB, pBAD-Bgal32cB_D207A and pBAD-Bgal32cB_E517Q plasmids, respectively, as previously described for wild-type protein [50] and ArthβDG_E441Q mutant [51]. Recombinant proteins were purified by a three-step chromatography comprising of ion-exchange and size-exclusion stages according to protocol developed for wild-type protein, ArthβDG [7]. The chromatography buffer was change to storage buffer (0.05 M HEPES pH 7.0) and the samples were Int. J. Mol. Sci. 2020, 21, 5354 12 of 19 concentrated to 20 mg/mL using 50 kDa cutoff membrane Vivaspin filters (Sartorius, Göttingen, Germany) prior to crystallization.

4.3. Determination of ArthβDG, ArthβDG_D207A and ArthβDG_E517Q Activity The activity of ArthβDG as well as ArthβDG_D207A and ArthβDG_E517Q mutants was determined using ONPG as a substrate. 0.8 mL of ONPG solution (1 mg/mL in 20 mM potassium phosphate buﬀer pH 8.0) was preincubated at 28 ◦C for 5 min, then 0.2 mL of protein sample was added, and the reaction mixture was incubated for 1 or 10 min at 28 ◦C for the substrate hydrolysis. The reaction was terminated by the addition of 0.3 mL of 1 M Na2CO3 and the absorbance was measured at 410 nm. One unit of β-d-galactosidase activity was deﬁned as the quantity of enzyme releasing of 1 µmol 2-nitrophenol per min under reaction conditions.

4.4. Thermofluor Shift Assay Samples of ArthβDG_D207A and ArthβDG_E517Q were prepared at concentration of 0.3 mg/mL each and premixed with SYPRO. The CFX96 TouchTM (BioRad, Hercules, CA, USA) thermal cycles was used for TSA experiment. The applied temperature increment was 1 ◦C per 30 s, and the tested temperature ranged from 4 ◦C to 95 ◦C. The assay was performed for 24 buffers covering pH range from 4.0 to 10.0 and 24 corresponding buffers with addition of 250 mM NaCl [54].

4.5. Crystallization of ArthβDG Mutants and Obtaining Their Complexes’ Crystallization of ArthβDG_D207A, ArthβDG_E441Q and ArthβDG_E517Q was performed by diffusion hanging-drop method using TacsimateTM Hampton Research (Aliso Viejo, CA, USA) at concentration range from 27% to 45% and pH range from 4.0 to 9.0 [7]. This crystallization matrix was previously used for growing crystals of wild-type enzyme. Furthermore, the cross-seeding using seeds made of ArthβDG crystals was applied to speed up the process of obtaining diffraction quality crystals. The seed stock of crushed microcrystals diluted 10,000 times in 35% TacsimateTM pH 7.0 was premixed in 1:40 (v/v) ratio with 20 mg/mL purified protein according to previously established protocol [51]. The monocrystals suitable for diffraction experiment were obtained in a pH range of 6.4–8.8 and TacsimateTM concentration varying from 24% to 40%. The complex ArthβDG_E517Q/gal was obtained after 24 h soaking of protein crystals with addition of globotriose and ArthβDG_D207A/gal by soaking with addition of mixture of galactose and fructose. A 24h-soaking was successful in the case of complexes ArthβDG_D207A/lact and ArthβDG_E517Q/lact, where the crystals were soaked with addition of a mixture of lactulose and galactose. The complexes of ArthβDG_E441Q and ArthβDG_D207A with saccharose were obtained by same time soaking with addition of saccharose alone. All the crystals were cryo-protected with 60% TacsimateTM of pH corresponding to crystallization conditions prior to being flash-frozen before diffraction experiment.

4.6. Data Collection, Structure Solving, and Reﬁnement High-resolution diffraction data were collected using state-of-the-art BESSY II beamlines 14.1 and 14.2, Berlin, Germany [55]. The diffraction images were collected with fine slicing 0.1◦. The diffraction data were processed using XDSapp [56], to avoid alternative indexing, possible in space group P3121, the log file for processing ArthβDG data was used as an input. Pair refinement was performed to determine optimal cutoff resolution for each data set. Crystal structures were solved by isomorphous replacement using rigid body refinement procedure, where the structure of ArthβDG (PDB ID: 6ETZ) was used as a model. Structure solving and further refinement was performed using the PHENIX.REFINE program [57,58] data reduction and refinement statistics are collected in Table2 for ArthβDG_E517Q, Table3 for ArthβDG_E441Q, and Table4 for ArthβDG_D207A. Int. J. Mol. Sci. 2020, 21, 5354 13 of 19

Table 2. Data reduction and reﬁnement statistics of ArthβDG_E517Q mutant’s crystal structures.

ArthβDG_E517Q ArthβDG_E517Q/gal ArthβDG_E517Q/lact Crystal Structure PDB ID: 6ZJP PDB ID: 6ZJQ PDB ID: 6ZJR Diffraction source BL 14.2 BESSY, Berlin, Germany BL 14.2 BESSY, Berlin, Germany BL 14.1 BESSY, Berlin, Germany Wavelength (Å) 0.918400 0.918400 0.918400 Temperature (K) 100 K 100 K 100 K Detector PILATUS 3S 2M PILATUS 3S 2M PILATUS 3S 2M Rotation range per image (◦) 0.1 0.1 0.1 Total rotation range (◦) 100 180 180 Exposure time per image (s) 0.2 0.2 0.2 Space group P 31 2 1 P 31 2 1 P 31 2 1 a, b, c (Å) 138.0 138.0 127.2 138.6 138.6 127.7 137.4 137.4 127.3 α, β, γ (◦) 90 90 120 90 90 120 90 90 120 Mosaicity (◦) 0.13 0.09 0.09 Resolution range (Å) 43.6–1.8 (1.9–1.8) 42.8–1.7 (1.8–1.7) 46.7–2.0 (2.1–2.0) Number of unique reflections 118,415 (11695) 155,098 (15193) 93,953 (9191) Completeness (%) 99.08 (98.40) 99.85 (98.78) 99.76 (99.06) Redundancy 5.1 10.2 10.1 I/σ(I) 12.39 (1.52) 13.5 (0.6) 12.54 (0.78) Rmeas (%) 7.5 (81.7) 13.6 (380.9) 15.6 (257.7) Overall B factor: 31.06 28.08 38.62 Wilson plot/refinement (Å2) No. of reflections: 118,262/2096 155,074/2099 93,830/2097 working/test set R/Rfree 0.1691/0.1946 0.1729/0.2008 0.1881/0.2131 No. of non-H atoms: 7613/7/1050 7624/151/621 7702/79/528 Protein/Ligand/Water R.m.s. deviations: 0.005/0.74 0.010/1.00 0.006/0.79 Bonds (Å)/Angles (◦) Ramachandran plot: 97.06/2.94 97.06/2.94 96.96/3.04 Most favored/allowed (%) Values in parenthesis are given for highest resolution shell. Int. J. Mol. Sci. 2020, 21, 5354 14 of 19

Table 3. Data reduction and reﬁnement statistics of ArthβDG_E441Q mutant’s crystal structures.

ArthβDG_E441Q/gal ArthβDG_E441Q/lact ArthβDG_E441Q/sucr Crystal Structure PDB ID: 6ZJS PDB ID: 6ZJT PDB ID: 6ZJU Diffraction source BL 14.2 BESSY, Berlin, Germany BL 14.2 BESSY, Berlin, Germany BL 14.2 BESSY, Berlin, Germany Wavelength (Å) 0.918400 0.918400 0.918400 Temperature (K) 100 K 100 K 100 K Detector PILATUS 3S 2M PILATUS 3S 2M PILATUS 3S 2M Rotation range per image (◦) 0.1 0.1 0.1 Total rotation range (◦) 180 100 180 Exposure time per image (s) 0.2 0.2 0.3 Space group P 31 2 1 P 31 2 1 P 31 2 1 a, b, c (Å) 138.4 138.4 127.8 139.0 139.0 127.7 138.2 138.2 127.6 α, β, γ (◦) 90 90 120 90 90 120 90 90 120 Mosaicity (◦) 0.03 0.11 0.18 Resolution range (Å) 45.3–1.7 (1.8–1.7) 43.8–2.0 (2.1–2.0) 43.7–1.7 (1.8–1.7) Number of unique reflections 224,735 (22177) 100,340 (9948) 141,152 (13911) Completeness (%) 99.91 (99.29) 99.49 (99.26) 99.87 (99.42) Redundancy 10,1 5.6 10.1 I/σ(I) 10,1 (0,6) 12.14 (0.80) 14.42 (0.56) Rmeas (%) 13,0 (350,5) 7.9 (175.3) 13.6 (425.6) Overall B factor: 25.29 45.01 30.65 Wilson plot/refinement (Å2) Number of reflections: 224,710/2358 100,137/2096 141,107/2099 working/test set R/Rfree 0.1550/0.1706 0.2100/0.2362 0.1786/0.1941 Number of non-H atoms: 7662/205/721 7615/80/337 7627/99/751 Protein/Ligand/Water R.m.s. deviations: 0.008/0.99 0.009/0.92 0.011/1.17 Bonds (Å)/Angles (◦) Ramachandran plot: 97.87/2.12 96.96/2.94 97.16/2.84 Most favored/allowed (%) Values in parenthesis are given for highest resolution shell. Int. J. Mol. Sci. 2020, 21, 5354 15 of 19

Table 4. Data reduction and reﬁnement statistics of ArthβDG_D207A mutant’s crystal structures.

ArthβDG_D207A ArthβDG_D207A/gal ArthβDG_D207A/sucr Crystal Structure PDB ID: 6ZJV PDB ID: 6ZJW PDB ID: 6ZJX Diffraction source BL 14.2 BESSY, Berlin, Germany BL 14.2 BESSY, Berlin, Germany BL 14.2 BESSY, Berlin, Germany Wavelength (Å) 0.918400 0.918400 0.918400 Temperature (K) 100 K 100 K 100 K Detector PILATUS 3S 2M PILATUS 3S 2M PILATUS 3S 2M Rotation range per image (◦) 0.1 0.1 0.1 Total rotation range (◦) 360 100 180 Exposure time per image (s) 0.2 0.2 0.2 Space group P 31 2 1 P 31 2 1 P 31 2 1 a, b, c (Å) 139.5 139.5 127.9 139.3 139.3 127.8 137.6 137.6 126.8 α, β, γ (◦) 90 90 120 90 90 120 90 90 120 Mosaicity (◦) 0.17 0.30 0.14 Resolution range (Å) 47.1–2.2 (2.3–2.2) 40.2–2.1 (2.2–2.1) 46.6–2.2 (2.3–2.2) Number of unique reflections 68,432 (6677) 81,059 (7962) 69,828 (6808) Completeness (%) 99.25 (97.39) 99.35 (98.55) 99.72 (98.12) Redundancy 20.0 5.4 10.0 I/σ(I) 21.38 (1.52) 5.18 (0.54) 12.58 (1.28) Rmeas (%) 11.4 (184.8) 19.9 (200.6) 14.8 (168.7) Overall B factor: 50.40 46.09 42.43 Wilson plot/refinement (Å2) Number of reflections: 68,233/1094 80,908/2083 69,783/1116 working/test set R/Rfree 0.2361/0.2623 0.2258/0.2608 0.1971/0.2238 Number of non-H atoms: 7690/7/142 7620/24/303 7622/58/530 Protein/Ligand/Water R.m.s. deviations: 0.005/0.84 0.003/0.66 0.004/0.66 Bonds (Å)/Angles (◦) Ramachandran plot: 97.26/2.74 96.56/3.44 96.96/3.04 Most favored/allowed (%) Values in parenthesis are given for highest resolution shell. Int. J. Mol. Sci. 2020, 21, 5354 16 of 19

4.7. Databases The here reported crystal structures and their associated structure factor amplitudes were deposited with the Protein Data Bank under the accession codes: 6ZJP, 6ZJQ, 6ZJR, 6ZJS, 6ZJT, 6ZJU, 6ZJV, 6ZJW AND 6ZJX respectively.

Supplementary Materials: The following are available online at http://www.mdpi.com/1422-0067/21/15/5354/s1, Figure S1: Selected TSA data and analysis for ArthβDG_D207A mutant, Figure S2: Selected TSA data and analysis for ArthβDG_E517Q mutant. Author Contributions: M.R. purified enzymes, performed crystallization, synchrotron diffraction data collection, data processing, structure solving and refinement. M.R. and A.B. carried out structural analysis and mostly wrote the paper. M.W. designed and performed site-direct mutagenesis experiments resulting in genes encoding mutants, performed protein expression in E. coli, determined the purification protocol, and determined the activity of enzymes. A.B. coordinated the project. All authors have read and agreed to the published version of the manuscript. Funding: This research was supported by National Science Centre of Poland: 2016/21/B/ST5/00555 Opus 11 grant (A.B.) and 2018/28/T/ST5/00233 Etiuda 6 scholarship (M.R.). Acknowledgments: We thank Helmholtz-Zentrum Berlin für Materialien und Energie for the allocation of synchrotron radiation beamtime at BL 14.1 and BL 14.2, where the X-ray data were collected. We gratefully acknowledge the support of the Joint Berlin MX-Laboratory, especially Manfred S. Weiss, which made this work possible. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Abbreviations

ArthβDG β-d-galactosidase from Arthrobacter sp. 32cB ArthβDG_D207A β-d-galactosidase from Arthrobacter sp. 32cB mutant D207A ArthβDG_E441Q β-d-galactosidase from Arthrobacter sp. 32cB mutant E441Q ArthβDG_E517Q β-d-galactosidase from Arthrobacter sp. 32cB mutant E517Q Gal galactose GOS galactooligosaccharides GH2 glycosyl hydrolase 2 family HOS heterooligosaccharides Lacd lactose bound in deep mode Lact lactulose ONPG o-nitrophenyl-β-d-galactopyranoside Sucr sucrose TSA thermoﬂuor shift assay

References

1. Talens-Perales, D.; Górska, A.; Huson, D.H.; Polaina, J.; Marín-Navarro, J. Analysis of Domain Architecture and Phylogenetics of Family 2 Glycoside Hydrolases (GH2). PLoS ONE 2016, 11, e0168035. [CrossRef] [PubMed] 2. Białkowska, A.M.; Cie´sliński,H.; Nowakowska, K.M.; Kur, J.; Turkiewicz, M. A new β-galactosidase with a low temperature optimum isolated from the Antarctic Arthrobacter sp. 20B: Gene cloning, purification and characterization. Arch. Microbiol. 2009, 191, 825–835. [CrossRef][PubMed] 3. Juers, D.H.; Matthews, B.W.; Huber, R.E. LacZ β-galactosidase: Structure and function of an enzyme of historical and molecular biological importance. Protein Sci. 2012, 21, 1792–1807. [CrossRef][PubMed] 4. Rodríguez, A.P.; Fernandez-Leiro, R.; González-Siso, M.-I.; Cerdán, M.E.; Becerra, M.; Sanz-Aparicio, J. Structural basis of specificity in tetrameric Kluyveromyces lactis β-galactosidase. J. Struct. Biol. 2012, 177, 392–401. [CrossRef] Int. J. Mol. Sci. 2020, 21, 5354 17 of 19

5. Skalova, T.; Dohnálek, J.; Spiwok, V.; Lipovová, P.; Vondráˇcková, E.; Petroková, H.; Dušková, J.; Strnad, H.; Králová, B.; Hašek, J. Cold-active β-Galactosidase from Arthrobacter sp. C2-2 Forms Compact 660kDa Hexamers: Crystal Structure at 1.9Å Resolution. J. Mol. Biol. 2005, 353, 282–294. [CrossRef] 6. Rutkiewicz-Krotewicz, M.; Pietrzyk-Brzezinska, A.J.; Sekula, B.; Cie´sliński, H.; Wierzbicka-Wo´s, A.; Kur, J.; Bujacz, A. Structural studies of a cold-adapted dimeric β-D-galactosidase from Paracoccus sp. 32d. Acta Crystallogr. Sect. D Struct. Biol. 2016, 72, 1049–1061. [CrossRef] 7. Rutkiewicz, M.; Pietrzyk, A.J.; Wanarska, M.; Cie´sliński,H.; Bujacz, A. In Situ Random Microseeding and Streak Seeding Used for Growth of Crystals of Cold-Adapted β-d-Galactosidases: Crystal Structure of βDG from Arthrobacter sp. 32cB. Crystals 2018, 8, 13. [CrossRef] 8. Brás, N.F.; Fernandes, P.A.; Ramos, M.J. QM/MM Studies on the β-Galactosidase Catalytic Mechanism: Hydrolysis and Transglycosylation Reactions. J. Chem. Theory Comput. 2010, 6, 421–433. [CrossRef] 9. Juers, D.H.; Rob, B.; Dugdale, M.L.; Rahimzadeh, N.; Giang, C.; Lee, M.; Matthews, B.W.; Huber, R.E. Direct and indirect roles of His-418 in metal binding and in the activity of β-galactosidase (E. coli). Protein Sci. 2009, 18, 1281–1292. [CrossRef] 10. Juers, D.H.; Heightman, T.D.; Vasella, A.; McCarter, J.D.; MacKenzie, L.; Withers, S.G.; Matthews, B.W. A structural view of the action of Escherichia coli (lacZ) beta-galactosidase. Biochemistry 2001, 40, 14781–14794. [CrossRef] 11. Roberfroid, M.B. Prebiotics and probiotics: Are they functional foods? Am. J. Clin. Nutr. 2000, 71, 1682S–1687S. [CrossRef][PubMed] 12. Swennen, K.; Courtin, C.; Delcour, J. Non-digestible Oligosaccharides with Prebiotic Properties. Crit. Rev. Food Sci. Nutr. 2006, 46, 459–471. [CrossRef][PubMed] 13. Torres, D.; Gonçalves, M.; Teixeira, J.; Rodrigues, L.R. Galacto-Oligosaccharides: Production, Properties, Applications, and Significance as Prebiotics. Compr. Rev. Food Sci. Food Saf. 2010, 9, 438–454. [CrossRef] 14. Gänzle, M.G. Enzymatic synthesis of galacto-oligosaccharides and other lactose derivatives (hetero-oligosaccharides) from lactose. Int. Dairy J. 2012, 22, 116–122. [CrossRef] 15. Roberfroid, M.; Gibson, G.R.; Hoyles, L.; McCartney, A.L.; Rastall, R.; Rowland, I.; Wolvers, D.; Watzl, B.; Szajewska, H.; Stahl, B.; et al. Prebiotic effects: Metabolic and health benefits. Br. J. Nutr. 2010, 104 (Suppl. S2), S1–S63. [CrossRef][PubMed] 16. Macfarlane, G.; Steed, H.; Macfarlane, S. Bacterial metabolism and health-related effects of galacto-oligosaccharides and other prebiotics. J. Appl. Microbiol. 2007, 104, 305–344. [CrossRef] 17. Bujacz, A.; J˛edrzejczak-Krzepkowska,M.; Bielecki, S.; Redzynia, I.; Bujacz, G.D. Crystal structures of the apo form of β-fructofuranosidase from Bifidobacterium longum and its complex with fructose. FEBS J. 2011, 278, 1728–1744. [CrossRef] 18. Oliveira, L.D.; Wilbey, R.A.; Grandison, A.S.; Roseiro, L.B.; Roseiro, M.L.D.B.W. Milk oligosaccharides: A review. Int. J. Dairy Technol. 2015, 68, 305–321. [CrossRef] 19. Lee, L.Y.; Bharani, R.; Biswas, A.; Lee, J.; Tran, L.-A.; Pecquet, S.; Steenhout, P. Normal growth of infants receiving an infant formula containing Lactobacillus reuteri, galacto-oligosaccharides, and fructo-oligosaccharide: A randomized controlled trial. Matern. Health Neonatol. Perinatol. 2015, 1, 9–19. [CrossRef] 20. Nguyen, T.T.; Bhandari, B.; Cichero, J.; Prakash, S. A comprehensive review on in vitro digestion of infant formula. Food Res. Int. 2015, 76, 373–386. [CrossRef] 21. Musilova, S.; Rada, V.; Vlkova, E.; Bunešová, V. Beneficial effects of human milk oligosaccharides on gut microbiota. Benef. Microbes 2014, 5, 273–283. [CrossRef] 22. Chierici, R.; Fanaro, S.; Saccomandi, D.; Vigi, V. Advances in the modulation of the microbial ecology of the gut in early infancy. Acta Paediatr. 2003, 92, 56–63. [CrossRef][PubMed] 23. Orrhage, C.N.K.; Orrhage, K.; Nord, C. Factors controlling the bacterial colonization of the intestine in breastfed infants. Acta Paediatr. 1999, 88, 47–57. [CrossRef][PubMed] 24. Kunz, C.; Rudloff, S. Biological functions of oligosaccharides in human milk. Acta Paediatr. 1993, 82, 903–912. [CrossRef] 25. Li, M.; Monaco, M.H.; Wang, M.; Comstock, S.S.; Kuhlenschmidt, T.B.; Fahey, G.C., Jr.; Miller, M.J.; Kuhlenschmidt, M.S.; Donovan, S.M. Human milk oligosaccharides shorten rotavirus-induced diarrhea and modulate piglet mucosal immunity and colonic microbiota. ISME J. 2014, 8, 1609–1620. [CrossRef] Int. J. Mol. Sci. 2020, 21, 5354 18 of 19

26. McVeagh, P.; Brand-Miller, J. Human milk oligosaccharides: Only the breast. J. Paediatr. Child Heal. 1997, 33, 281–286. [CrossRef][PubMed] 27. Bruggencate, S.J.T.; Bovee-Oudenhoven, I.M.; Feitsma, A.L.; Van Hoffen, E.; Schoterman, M.H. Functional role and mechanisms of sialyllactose and other sialylated milk oligosaccharides. Nutr. Rev. 2014, 72, 377–389. [CrossRef][PubMed] 28. Wallace, T.C.; Marzorati, M.; Spence, L.; Weaver, C.M.; Williamson, P.S. New Frontiers in Fibers: Innovative and Emerging Research on the Gut Microbiome and Bone Health. J. Am. Coll. Nutr. 2017, 36, 218–222. [CrossRef][PubMed] 29. Whisner, C.M.; Martin, B.R.; Schoterman, M.H.C.; Nakatsu, C.H.; McCabe, L.D.; McCabe, G.P.; Wastney, M.E.; Heuvel, E.V.D.; Weaver, C.M. Galacto-oligosaccharides increase calcium absorption and gut bifidobacteria in young girls: A double-blind cross-over trial. Br. J. Nutr. 2013, 110, 1292–1303. [CrossRef] 30. Weaver, C.M.; Martin, B.R.; Nakatsu, C.H.; Armstrong, A.P.; Clavijo, A.; McCabe, L.D.; McCabe, G.P.; Duignan, S.; Schoterman, M.H.C.; Heuvel, E.V.D. Galactooligosaccharides Improve Mineral Absorption and Bone Properties in Growing Rats through Gut Fermentation. J. Agric. Food Chem. 2011, 59, 6501–6510. [CrossRef] 31. Hughes, C.; Davoodi-Semiromi, Y.; Colee, J.C.; Culpepper, T.; Dahl, W.J.; Mai, V.; Christman, M.; Langkamp-Henken, B. Galactooligosaccharide supplementation reduces stress-induced gastrointestinal dysfunction and days of cold or flu: A randomized, double-blind, controlled trial in healthy university students. Am. J. Clin. Nutr. 2011, 93, 1305–1311. [CrossRef][PubMed] 32. Mussatto, S.I.; Mancilha, I.M. Non-digestible oligosaccharides: A review. Carbohydr. Polym. 2007, 68, 587–597. [CrossRef] 33. Kim, C.S.; Ji, E.-S.; Oh, D.-K. Expression and characterization of Kluyveromyces lactis β-galactosidase in Escherichia coli. Biotechnol. Lett. 2003, 25, 1769–1774. [CrossRef][PubMed] 34. Colinas, B.R.; De Abreu, M.A.; Fernandez-Arrojo, L.; De Beer, R.; Poveda, A.; Jiménez-Barbero, J.; Haltrich, D.; Olmo, A.O.B.; Lobato, M.F.; Plou, F.J. Production of Galacto-oligosaccharides by the β-Galactosidase from Kluyveromyces lactis: Comparative Analysis of Permeabilized Cells versus Soluble Enzyme. J. Agric. Food Chem. 2011, 59, 10477–10484. [CrossRef][PubMed] 35. Wojciechowska, A.; Klewicki, R.; Sójka, M.; Klewicka, E. Synthesis of the Galactosyl Derivative of Gluconic Acid with the Transglycosylation Activity of β-Galactosidase. Food Technol. Biotechnol. 2017, 55, 258–265. [CrossRef] 36. Yin, H.; Bultema, J.B.; Dijkhuizen, L.; Van Van Leeuwen, S. Reaction kinetics and galactooligosaccharide product profiles of the β-galactosidases from Bacillus circulans, Kluyveromyces lactis and Aspergillus oryzae. Food Chem. 2017, 225, 230–238. [CrossRef] 37. Cavicchioli, R.; Siddiqui, K.S.; Andrews, D.; Sowers, K.R. Low-temperature extremophiles and their applications. Curr. Opin. Biotechnol. 2002, 13, 253–261. [CrossRef] 38. Cavicchioli, R.; Charlton, T.; Ertan, H.; Omar, S.M.; Siddiqui, K.S.; Williams, T.J. Biotechnological uses of enzymes from psychrophiles. Microb. Biotechnol. 2011, 4, 449–460. [CrossRef] 39. Gerday, C. Psychrophily and Catalysis. Biology 2013, 2, 719–741. [CrossRef] 40. Turkiewicz, M. Drobnoustroje psychrofilne i ich biotechnologiczny potencjał. Kosm. Probl. Nauk Biotechnol. 2006, 55, 307–320. 41. Aghajari, N.; Haser, R.; Feller, G.; Gerday, C. Crystallization and preliminary X-ray diffraction studies of α-amylase from the antarctic psychrophile Alteromonas haloplanctis A23. Protein Sci. 1996, 5, 2128–2129. [CrossRef][PubMed] 42. Arimori, T.; Ito, A.; Nakazawa, M.; Ueda, M.; Tamada, T. Crystal structure of endo-1,4-β-glucanase fromEisenia fetida. J. Synchrotron Radiat. 2013, 20, 884–889. [CrossRef][PubMed] 43. Zheng, Y.; Li, Y.; Liu, W.; Chen, C.-C.; Ko, T.-P.; He, M.; Xu, Z.; Liu, M.; Luo, H.; Guo, R.-T.; et al. Structural insight into potential cold adaptation mechanism through a psychrophilic glycoside hydrolase family 10 endo-β-1,4-xylanase. J. Struct. Biol. 2016, 193, 206–211. [CrossRef][PubMed] 44. Kim, M.-K.; An, Y.J.; Song, J.M.; Jeong, C.-S.; Kang, M.H.; Kwon, K.K.; Lee, Y.-H.; Cha, S.-S. Structure-based investigation into the functional roles of the extended loop and substrate-recognition sites in an endo-β-1,4-d-mannanase from the Antarctic springtail, Cryptopygus antarcticus. Proteins: Struct. Funct. Bioinform. 2014, 82, 3217–3223. [CrossRef] Int. J. Mol. Sci. 2020, 21, 5354 19 of 19

45. Malecki, P.; Raczynska, J.E.; Vorgias, C.E.; Rypniewski, W.R. Structure of a complete four-domain chitinase from Moritella marina, a marine psychrophilic bacterium. Acta Crystallogr. Sect. D Biol. Crystallogr 2013, 69, 821–829. [CrossRef] 46. Zanphorlin, L.M.; De Giuseppe, P.O.; Honorato, R.; Tonoli, C.C.C.; Fattori, J.; Crespim, E.; De Oliveira, P.S.L.; Ruller, R.; Murakami, M. Oligomerization as a strategy for cold adaptation: Structure and dynamics of the GH1 β-glucosidase from Exiguobacterium antarcticum B7. Sci. Rep. 2016, 6, 23776. [CrossRef] 47. Van Petegem, F.; Collins, T.; Meuwis, M.-A.; Gerday, C.; Feller, G.; Van Beeumen, J. The Structure of a Cold-adapted Family 8 Xylanase at 1.3 Å Resolution. J. Biol. Chem. 2002, 278, 7531–7539. [CrossRef] 48. Fan, Y.; Yi, J.; Hua, X.; Feng, Y.; Yang, R.; Zhang, Y. Structure analysis of a glycosides hydrolase family 42 cold-adapted β-galactosidase from Rahnella sp. R3. RSC Adv. 2016, 6, 37362–37369. [CrossRef] 49. Manas, N.H.A.; Illias, R.M.; Mahadi, N.M. Strategy in manipulating transglycosylation activity of glycosyl hydrolase for oligosaccharide production. Crit. Rev. Biotechnol. 2017, 38, 1–22. 50. Pawlak-Szukalska, A.; Wanarska, M.; Popinigis, A.T.; Kur, J. A novel cold-active β-d-galactosidase with transglycosylation activity from the Antarctic Arthrobacter sp. 32cB—Gene cloning, purification and characterization. Process. Biochem. 2014, 49, 2122–2133. [CrossRef] 51. Rutkiewicz, M.; Bujacz, A.; Wanarska, M.; Wierzbicka-Wos, A.; Cie´sliński,H. Active Site Architecture and Reaction Mechanism Determination of Cold Adapted β-d-galactosidase from Arthrobacter sp. 32cB. Int. J. Mol. Sci. 2019, 20, 4301. [CrossRef][PubMed] 52. Rutkiewicz, M.; Bujacz, A.; Bujacz, G. Structural features of cold-adapted dimeric GH2 β-D-galactosidase from Arthrobacter sp. 32cB. Biochim. Biophys. Acta (BBA) Proteins Proteom. 2019, 1867, 776–786. [CrossRef] [PubMed] 53. Jurrus, E.; Engel, D.; Star, K.; Monson, K.; Brandi, J.; Felberg, L.E.; Brookes, D.H.; Wilson, L.; Chen, J.; Liles, K.; et al. Improvements to the APBS biomolecular solvation software suite. Protein Sci. 2017, 27, 112–128. [CrossRef][PubMed] 54. Reinhard, L.; Mayerhofer, H.; Geerlof, A.; Mueller-Dieckmann, J.; Weiss, M.S. Optimization of protein buffer cocktails using Thermofluor. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2013, 69, 209–214. [CrossRef] 55. Mueller, U.; Forster, R.; Hellmig, M.; Huschmann, F.U.; Kastner, A.; Malecki, P.; Pühringer, S.; Röwer, M.; Sparta, K.; Steffien, M.; et al. The macromolecular crystallography beamlines at BESSY II of the Helmholtz-Zentrum Berlin: Current status and perspectives. Eur. Phys. J. Plus 2015, 130, 141. [CrossRef] 56. Sparta, K.; Krug, M.; Heinemann, U.; Mueller, U.; Weiss, M.S. XDSAPP2.0. J. Appl. Crystallogr. 2016, 49, 1085–1092. [CrossRef] 57. Adams, P.D.; Afonine, P.V.; Bunkóczi, G.; Chen, V.B.; Davis, I.W.; Echols, N.; Headd, J.J.; Hung, L.-W.; Kapral, G.J.; Grosse-Kunstleve, R.W.; et al. PHENIX: A comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. Sect. D Biol. Crystallogr. 2010, 66, 213–2211. [CrossRef] 58. Moriarty, N.W.; Tronrud, D.E.; Adams, P.D.; Karplus, P.A. A new default restraint library for the protein backbone inPhenix: A conformation-dependent geometry goes mainstream. Acta Crystallogr. Sect. D Struct. Biol. 2016, 72, 176–179. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).