sign in sign up
<<
Home , Ecteinascidia turbinata, Lissoclinum patella, Molgula, Molgula manhattensis, Prochloron, Tunicate

Sea Squirt Symbionts! Or what I did on my summer vacation… Leah Blasiak 2011 Microbial Diversity Course

Abstract Microbial symbionts of (sea squirts) have been recognized for their capacity to produce novel bioactive compounds. However, little is known about most -associated microbial communities, even in the embryology intestinalis. In this project I explored 3 local tunicate species (, manhattensis, and vexillum) to identify potential symbiotic . Tunicate-specific bacterial communities were observed for all three species and their tissue specific location was determined by CARD-.

Introduction Tunicates and other marine are prolific sources of novel natural products for drug discovery (reviewed in Blunt, 2010). Many of these compounds are biosynthesized by a microbial symbiont of the , rather than produced by the animal itself (Schmidt, 2010). For example, the anti- drug patellamide, originally isolated from the colonial ascidian patella, is now known to be produced by an obligate cyanobacterial symbiont, didemni (Schmidt, 2005). Research on such microbial symbionts has focused on their potential for overcoming the “supply problem.” Chemical synthesis of natural products is often challenging and expensive, and isolation of sufficient quantities of drug for clinical trials from wild sources may be impossible or environmentally costly. Culture of the microbial symbiont or heterologous expression of the biosynthetic genes offers a relatively economical solution. Although the microbial origin of many tunicate compounds is now well established, relatively little is known about the extent of such symbiotic associations in tunicates and their biological function.

Tunicates (or sea squirts) present an interesting system in which to study bacterial/eukaryotic as they are deep-branching members of the Chordata (Passamaneck, 2005 and Buchsbaum, 1948). They possess a and dorsal neural tube in their larval stage but lose the notochord during . Most adult tunicates are sessile filter feeders. The name tunicate comes from the thick outer coating or “tunic” of adult , which contains . Tunicates group into two main morphotypes, solitary and colonial. Solitary animals, including Ciona and Molgula species, resemble a bag of jelly with an incurrent and excurrent siphon at the top. The colonial animals, such as Didemnum, grow in spreading mats with many tiny animals or “” contained within the same tunic.

For this project, I chose to focus on three locally available tunicate species with unique features and some indication in the literature of a possible bacterial symbiosis. Ciona intestinalis is a well-studied model organism in embryology and development and has a sequenced . Like many tunicates C. intestinalis accumulates mM in its as protein-bound V(IV) [VO2+] (Trivedi, 2003). There is one report in the literature of a potential symbiosis with a possible cyanobacterial symbiont in the C. intestinalis tunic (De Leo, 1980), as well as one electron microscopy study that mentions numerous bacterial cells in the “ground substance” of the tunic (De Leo, 1981).

Molgula manhattensis and were selected based on intriguing early results from 16S clone libraries produced in Stefan Sievert’s lab at Woods hole (Tait, 2007). The Sievert lab found only one phylotype of spiroplasma-like sequences in the 16S rDNA libraries of M. manhattensis gonad that had similarity to sequences from the colonial tunicate turbinata (Herdman) (Moss, 2003). Spiroplasma, which group within the Mollicutes, are often pathogens of insects and one strain is known to cause “trembling disease” in Chinese mitten crab, Eriocheir sinensis. In neither tunicate has the cellular location of this consistently found spiroplasma phylotype been determined, and its role as pathogen or commensal is unknown. The renal sac of M. manhattensis is also known to contain a very unusual apicomplexan symbiont , , which contains within it an intracellular bacterial endosymbiont (Saffo, 2010).

D. vexillum is a highly invasive colonial tunicate that causes substantial damage by overgrowing marine surfaces and sessile animals. Several colonial tunicates are known to contain symbiotic or alphaproteobacteria in their tunics (Martinez-Garcia, 2007 and Hirose, 2006). The Sievert lab constructed a 16S rDNA library from the tunic surface of D. vexillum that contained two dominant alpha-proteobacterial phylotypes with no close cultured relatives (Tait, 2007). One study (Yokobori, 2006) refers to D. vexillum (formerly Didemnum sp. A) as a “photsymbiotic” species, although no reference or data is given. The D. vexillum from Eel pond does not have the green color characteristic of a typical Prochloron –containing tunicate.

Tunicates are a fascinating system in which to search for bacterial symbiosis and ask questions about microbial/eukaryotic interactions. As , they represent a outgroup and some representatives like C. intestinalis have well-studied development and immunology. The (unfortunate) invasiveness of D. vexillum presents the potential to examine the biogeography of symbiosis. Further, the available 16S rDNA data from D. vexillum and M. manhattensis indicates that these tunicates are a potential source of as-yet-uncultured bacterial diversity. The role of bacterial communities play in shaping eukaryotic is still largely unknown, and symbiosis is more widespread than many eukaryotic biologists appreciate. What interactions allow for selection of a particular bacterial symbiont or community? What do the participants gain and lose from the symbiosis? How are symbiotic relationships established and maintained, and how do they evolve?

Methods

Tunicate sampling Samples of D. vexillum were collected by the Marine Resource Center (MRC) from Eel Pond. All selected D. vexillum specimens were growing over another tunicate, Steyla clava. The first three specimens were collected on 7/6/11 with an associated water sample. Specimens 4 and 5 were collected on 7/11/11, again with an associated water sample. C. intestinalis specimens were obtained from an MRC tank with associated water samples. Individuals 1-3 were collected on 7/6/11 and individuals 4 and 5 were obtained from the same tank on 7/18/11. All M. manhattensis specimens with an associated water sample were collected by from East Falmouth Harbor on 7/13/11. All specimens were stored at 4 deg until processing and dissected the same day as collection.

Dissections Dissections were greatly aided by the online reference http://webs.lander.edu/rsfox/invertebrates/ (Fox, 2004). Further help with Didemnum dissections and anatomy was obtained from Lauren Stefaniak, a Ph.D. student at the University of Connecticut Department of Marine Sciences.

All tissue specimens were rinsed 3 times in sterile ASW in large petri dishes. Samples for DNA extraction were flash frozen in liquid N2 and stored at -20deg C until use. Samples for FISH were prepared using treatments described in the following section on fixation. Images of dissections are shown in Figures 2 and 3.

Didemnum sample 1 (D1) Approximately 1cm2 sections of tunic and zooids were dissected away from the underlying Steleya and trimmed in a dish of sterile ASW. Two parts of the specimen were sampled- a flat portion of tunic and a long, thin hanging cylindrical growth. This specimen was relatively thin with generally flat growth of the tunic and small, closely spaced zooids.

Didemnum sample 2 and 3 (D2 and D3) These specimens were larger and had thicker tunics with a deeply wrinkled surface. Approximately 1cm2 sections of tunic and zooids were dissected away from the underlying Steyela and trimmed in a dish of sterile ASW.

Didemnum sample 4 and 5 (D4 and D5) These specimens were obtained to attempt a -free dissection and dissection of the tunic cuticle surface. This turned out to be extremely difficult and would require much finer dissection scissors and forceps. The cuticle was pulled from the surface of the animal by holding the tunic with one pair of forceps and stripping away the cuticle with a second forceps. The remaining stuck zooids were then removed one by one with forceps under a dissecting scope. I was unable to remove all the attached zooids in this manner, so I decided not to try a “cuticle only” or “tunic only” clone library. Instead, cross sections through the entire were prepared for fixation as for D1-3.

Ciona specimens 1 to 3 Ciona specimen 1 was used to learn the dissection technique. Ciona specimen 2 was dissected and preserved for FISH and DNA clone libraries. First, the tunic was cut open at the bottom with a scalpel and then opened with scissors from siphon to siphon. The tunic was dissected completely away from the intact mantle. A section of the tunic and cuticle from the middle, pigmented part of the animal was preserved for FISH and DNA (C2TC). A portion of the yellow upper tunic was also preserved (CYT). The mantle was removed and the gonad was dissected away and preserved for FISH (CG). A portion of the pharyngeal basket was dissected away, smashed under a cover slip, and moving cilia were observed by phase contrast microscopy. The gonad of specimen 3 was preserved for DNA extraction. Ciona specimens 4 and 5 These animals were obtained and dissected in order to 1) check for the presence of bacteria across multiple individuals, 2) obtain more sections for FISH with euk and other specific bacterial probes, and 3) obtain another gonad for FISH and to retry the 16S PCR from gonad tissue. The tunic was dissected completely away from the intact mantle. A section of the tunic and cuticle from the middle, pigmented part of the animal was preserved for FISH (C4 and C5). The gonad of specimen C5 was dissected away, cut in half and preserved for FISH and DNA extraction (C5G).

Molgula specimens 1 to 3 Three gonads from 3 M. manhattensis tunicates were successfully dissected. The 2nd specimen (M2) was very small and the gonad dissection was not completely clean. Preserved gonad 1 for FISH (M1G), gonad 2 frozen for DNA (M2G), and gonad 3 (the largest) was sliced in half with half fixed for FISH and the other half frozen for DNA extraction (M3G). Only the right hermaphroditic gonad was dissected as the left side was much more difficult to dissect away cleanly. On the first specimen it was possible to see the beating- like a waving curtain along the renal sac. Initially I confused the renal sac (transparent, with white crystals) for the pyloric sac (brownish with sparkly crystals) but the beating heart allowed me to orient to the right side of the animal. The proximity of the heart to the renal sac was a clear marker of the right side. Excellent dissection resource was: http://webs.lander.edu/rsfox/invertebrates/molgula.html (Fox, 2004). The exterior of these specimens was greatly encrusted with a wide variety of flora and fauna. The exterior tunic surface also varied in the number and arrangement of “papule” structures. Dissections were carried out in a petri dish of sterile ASW and after each procedure the tunicate was transferred to a fresh, sterile ASW bath. Each tunicate was carefully brushed of exterior debris. The overall shape was like a flattened sphere. The tunic was cut open with sharp scissors from one siphon to the other around the widest part of the sphere. The tunic was then stripped off to reveal the mantle and interior organs. Scissors were used to cut open the mantle and free the gonad. After separation from the animal the gonad was cleaned of remaining membrane and debris and then washed an additional 3x in sterile ASW.

Fixation and embedding A general protocol based on Ishi, 2004 is given below. An alternative protocol was also tested for Didemnum samples. Additional advice on fixation and sectioning was obtained from previous “Pink Berry” protocol used by Christina Moraru in the 2010 Microbial Diversity Course .

All incubations were performed in 1.5 mL eppendorf tubes. -4% PFA in ASW for 1-2 hrs at 4deg overnight -Wash 3 times in sterile ASW -15% sucrose in ASW 1 hr at RT (or until tissue section drops to bottom of tube) -20% sucrose in ASW as above -30% sucrose in ASW as above followed by storage at 4deg until embedding All samples were placed in grey “ice cube tray” molds and embedded in Tissue Tek OCT followed by flash freezing in liquid N2.

An alternative fixation procedure was tried for samples D1-3.

-4% PFA in ASW for 1-2 hrs at RT -Wash 3 times in sterile ASW

Followed by EITHER

Sucrose treatment as in general protocol

OR

Transfer to 50% EtOH (molecular grade 200 proof) in ASW at 4deg overnight and until embedding

Cryosectioning Frozen tissue tek blocks containing the fixed samples were sectioned on a Microm HM 505N cryomicrotome. Briefly, the frozen cube was affixed to a platform using more Tissue tek and allowed to cool for ~10 minutes. Initially 20 um sections were cut using the roll plate and picked up by touching gently with the room temperature slide. Polylysine coated slides were used to help keep sections attached during the FISH procedure. After 20 um sections were successful, 10 um sections were attempted. These were successful only for the square section of D1. Rectangular cross-sections were cut with the long axis perpendicular to the blade- this seemed to give the nicest sections as at least a portion of each slice remained unfolded on the slide. At least 8 sections were placed on each slide to account for possible loss of sections during the FISH washing steps. There were many issues with the EtOH fixed D1 (mainly wrinkling of sections and difficulty getting flat sections). The Ciona2 T+C sample was too large and broke in half during initial trimming. The tunic also tended to crack off and was missing from most sections obtained. Smaller samples are better!

Observations of sectioned samples Samples were observed by microscopy up to 40x on 7/11/11 and 7/12/11. The sucrose gradient protocol sample looked much better than the EtOH protocol sample. The EtOH samples had a “squished” appearance. There was little difference in autofluorescence between the two protocols. There was a large amount of autofluorescence at all wavelengths for all samples, but especially for Green with Ciona samples.

Catalyzed reporter deposition - Fluorescence in situ hybridization(CARD-FISH) Samples were all processed for FISH using the following protocol based on Ishii, 2004 and the course handbook except as noted. Samples were all processed as sections on polylysine coated slides. Samples from D1 and C2 were all processed with only lysozyme permeabilization. It appears that lysozyme permeabilization is sufficient for extracellular bacteria within tissue but I did not have time to optimize permeabilization. Double hybridization of ciona 5 tunic and cuticle and ciona 5 gonad were performed by repeating the protocol starting at inactivation. Embedding -Prepared sterile 0.4% Low melting agarose solution in MQ water (100 mL) – autoclaved -Reheat in microwave and allow to cool until can comfortably hold -Fill reservoir of clean spray bottle with still warm agarose solution and mist lightly over slides -Dry in blotting paper box at 35 or 46 deg C

Permeablization Proteinase K permeabilization -Prepare fresh Proteinase K sterile filtered buffer (1 mL 0.5 M EDTA pH 8, 1 mL 1 M Tris HCl pH 8, 1 mL 5 M NaCl, Fill to 10 mL with MQ water) -Add 5.6 uL Proteinase K stock ~26 mg/mL -Incubate 5 min at RT -Wash in MQ water (2 x 50 mL Falcons) Inactivation of Proteinase K -5 min in 0.01 M HCl ( 9 mL MQ water + 1 mL 0.1 M HCl)

-Wash in MQ water (2 x 50 mL Falcons)

Lysozyme permeabilization -Made fresh 20mg/mL lysozyme solution (5 mL, 1 mL per slide) in 0.1 M Tris pH 8, 0.05 M EDTA pH 8 (sterile filtered) -Placed ~500 uL of lysozyme solution on slide to cover sections. Placed slide in closed 50 mL Falcon tube on side at 37 deg for 1 hr. Important that sections stay covered and don’t dry out. -Rinsed twice in MQ water (sterile filtered) – used same 2 x 50 mL Falcons for all 5 slides Inactivation

-Placed slides in rect. Petri dishes and covered each with ~1 mL MeOH 0.15% H2O2 for 30 minutes. (10 mL MeOH + 50 uL 30% H2O2) -Rinsed twice in MQ water (sterile filtered) – used same 2 x 50 mL Falcons for all 5 slides -Rinsed once in 96% molecular grade EtOH and dried in blotting paper box at 37 deg

Hybridization Prepare buffers for washing fresh- 4 sets of 50 mL of washing buffer in 50 mL Falcon Washing buffer 0.5 mL 0.5 M EDTA 1 mL, 1 M Tris pH 8 X mL NaCl (for 35% use 700 uL, 1020 for 30%, 8900 uL for 0%) Fill up to 50 mL with MQ + 25 uL SDS 20%

-Place washing buffer to prewarm in water bath at 46 deg

-Hybridization buffer was 35% formamide for eub I-III probe, non338-probe, and all proteobacterial probes except delta probes (30%). Euk516 proke was used with 0% formamide along with control non338 at 0%.

-Make extra 35% formamide (or water % for that probe) in MQ water to wet tissues in hybridization chamber. In general use 500 uL per slide on one half of a kimwipe. i.e. For 5 slides, 500 uL each ~3 mL (1.05 mL = 1000uL + 50 uL formamide and 1.95mL MQ = 1000 + 950 uL)

Hybridization Buffer 3.6 mL 5 M NaCl, 0.4 mL 1 M Tris HCl pH 8, 20 uL SDS (20% w/v), formamide (7 mL for 35% and 7 mL MQ water), 2 mL Reagent (10%, Roche, Basel; prepared according to manufacturer’s instructions), 2 g Dextran sulphate, Heat buffer (40-60 deg C) and shake until dextran sulphate has completely dissolved.

-Prepare hybridization solution (300 uL HB + 1 ul probe working solution (50 ng/ul DNA).

-Place about 10 uL Hybridization buffer with probe per segment and place slide in Falcon “humidity chamber” (50 mL Falcon with wet kimwipe fold in 4 and sealed with parafilm).

-Hybridize for 2.5 hrs at 46 deg C

-Place slides in washing buffer- prerinse slide in one tube, then place two slides per tube with outsides facing away from each other. Keep at 46 deg for 15 min

-Transfer to 1x PBS RT as for washing buffer. Incubate at RT for 15 min

CARD (tyramide signal amplification)

-Make a fresh solution of 0.15% H2O2 in 1x PBS (10 mL 1 x PBS + 50 uL 30% H2O2)

Amplification buffer 4 mL 10X PBS, pH 7.4, 0.4 mL Blocking Reagent (10%, Roche, Basel; prepared according to manufacturer’s instructions), 16 mL 5 M NaCl, add sterile MQ water to 40 mL + 4 g dextran sulfate Heat buffer (40-60 deg C) and shake until dextran sulphate has completely dissolved.

-Mix amplification buffer with H2O2 soln in 100:1 ratio 1 mL AB + 10 uL 0.15% H2O2 -Add 1 uL labeled dye (used Alexa488(green) or Alexa594 (red)) -Put in square petri dishes at 46 deg for 30 min. -Wash in 1x PBS RT and incubate in the dark for 10 min -Wash in MQ 1x -Wash in 96% EtOH 2x and place in dark to dry at RT Mount with DAPI embedding solution – don’t use too much. In future I would DAPI stain separately from mounting solution to reduce background. 750 uL Citrifluor 250 uL Vectashield 1 uL DAPI stock (1 mg/mL)

The following FISH experiments were performed Tissue sections Probe Dye Ciona 2 TC EubI-III Alexa594 Non338 Alexa594 Alf968 Alexa594 Bet42a (competitor Gam42a) Alexa594 Gam42a (competitor Bet42a) Alexa594 Delta495a,b,c (+ competitors) Alexa594 Non338 repeat Alexa594 Didemnum 1 sucrose EubI-III Alexa594 OR Alexa488 gradient Non338 Alexa594 Ciona 4 tunic and cuticle EubI-III Alexa594 Non338 Alexa594 Ciona 5 tunic an cuticle EubI-III PLUS Euk516 Alexa594 (EubI-III) PLUS Alexa488(Euk516) Non338 PLUS Non338 Alexa594 (Non338) PLUS Alexa488(Non338) Ciona 5 gonad EubI-III PLUS Euk516 Alexa594 (EubI-III) PLUS Alexa488(Euk516) Non338 PLUS Non338 Alexa594 (Non338) PLUS Alexa488(Non338) Molgula 3 gonad EubI-III Alexa594 Non338 Alexa594

DNA extraction, PCR, and 16S rDNA clone libraries Tunicate-associated water samples were processed by filtering 50 mL through a 0.2 um syringe filter. Filters were frozen at -20deg C until DNA extraction. DNA was extracted from either one water sample filter or a >0.5 cm2 section of a given tunicate tissue using the PowerSoil DNA Extraction Kit (MolBio) according to the manufacturers instructions with the following modifications: samples were placed in Beadbeater on medium speed for 1-3 min instead of vortexing, final DNA was eluted in 50 uL. DNA concentration was measured by nanodrop. A portion of the 16S rDNA gene was PCR amplified with primers 8F 5'- AGAGTTTGATCCTGGCTCAG-3' and 1492R 5'-GGTTACCTTGTTACGACTT-3' and the following conditions: 95 °C for 5 min followed by 30 cycles of 95 °C for 30 sec, 46 °C for 30 sec, 72 °C for 1.5 min, and final elongation at 72 °C for 5 min. The PCR reaction included 1x Promega master mix with Taq polymerase, and 15 pmol of each primer in a 25 uL total volume. DNA was diluted as necessary for successful amplification (5x, 1x, 1/10x, 1/100x). No amplification was obtained for Ciona gonad samples. PCR products were gel extracted and TOPO/TA cloned (Invitrogen) into pCR4, followed by sequencing with primer 8Fthe Josephine Bay Paul Sequencing Center on an Applied Biosystems model 3730. Sequences were quality trimmed and sequences of less than 250 b were discarded. Community DNA was also submitted for 454 sequencing for Ciona associated water (CSW), Didemnum associated water (DSW), and D. vexillum sample 1A (D1A). Primers for 454 sequencing were barcoded 515F/907R 5'- CGTATCGCCTCCCTCGCGCCATCAGXXXXXXXXgaGTGYCAGCMGCCGCGGTAA-3' and 5'-CTATGCGCCTTGCCAGCCCGCTCAGggCCGYCAATTCMTTTRAGTTT-3' (X denotes barcode, lowercase indicates the linker between the barcode and 16S primer or adaptor). The amplification conditions were as follows: 10 cycles of touchdown PCR with annealing from 68-58 °C (95 °C, 68-58 °C, 72 °C), followed by 12 cycles with annealing at 58 °C (95 °C, 68-58 °C, 72 °C) followed by 10 cycles of two step PCR (95 °C, 72 °C) (32 total cycles). The amplification reactions contained 1x Phusion HF polymerase mastermix with 8% DMSO, 0.5 uM primers, and ~30 ng DNA. Amplified DNA was quantified with the PicoGreen assay and ~125 ng of each PCR product was concentrated to 100 uL with a vacufuge and then gel purified with the Montage kit (Millipore). 454 sequencing was performed at Penn State.

The following clone libraries were created: Library Name # Sequences Source Specimen C2TC 32 C. intestinalis 2 Middle tunic and cuticle CYT 24 C. intestinalis 2 Upper yellow tunic D1A 22 D. vexillum 1 Colonial full section D1B 47 D. vexillum 1 Colonial full section M3G 14 M. manhattensis 3 Gonad CSW 43 C. intestinalis associated 1-3 Water sample DSW 46 D. vexillum associated 1-3 Water sample MSW 37 M. manhattensis associated 1-3 Water sample

Results and Discussion

C. intestinalis CARD-FISH and microscopy A dense population of bacteria was observed in the ground substance of the tunic of Ciona intestinalis by DAPI staining and FISH labeling with general eubacterial probe EubI-III (Fig 4). I considered the possibility that the observed “bacteria” could be mitochondria, so I searched the Eub I-III probe sequence against the Ciona intestinalis complete mitochondrial genome using text search and probe search in ARB and could not find a hit with up to 5 mismatches. Discussions with Nicole Dubilier also indicated that they do not have a problem with eubacterial probes hitting mitochondrial genes. To check the location of the labeled bacteria in relation to the eukaryotic cells in the tunic, a double hybridization with EubI-III (Alexa594, red) and Euk516(Alexa488, green) was performed. The bacterial cells were located in the ground substance or extracellular matrix of the tunic and not within or associated with eukaryotic cells. In general, the bacterial cell density and eukaryotic cell density was greater towards the cuticle, although tissue sections were also thicker in this region. The FISH experiment with EubI-III was repeated on 3 Ciona specimens, and all three individuals contained similar bacterial populations as observed by FISH. No signals were observed by FISH with alpha, beta, or delta probes (Fig 5). A few rare signals were observed using the gamma probe. I observed one major bacterial morphotype that ressembled tiny crescent rolls. The size was variable with smaller and fatter individuals observed. Some bacteria were observed in pairs attached at the poles, possibly in the process of dividing. A few rare morphotypes were also observed by DAPI staining and by Gram staining (Fig 6), including a spiral morphotypes and rods. The major morphotype stained Gram-negative. Some square-shaped chains of possible cyanobacteria were observed attached to the exterior cuticle. Sections of the C. intestinalis gonad showed no labeled bacteria by FISH with the general EubI-III probe (Alexa594, red) in a double hybridization with Euk516 (Alexa488) (Fig 7). I also was unable to amplify bacterial 16S from DNA extracted from Ciona gonad using the standard bacterial primers 8F/1492R, however I did not for PCR inhibition with this sample. 16S Clone library The 16S clone library of Ciona individual 2 tunic and cuticle contained two major phylotypes. The most abundant OTU (44% of sequences) at 97% clustering was classified by RDP as Proteobacteria, but after aligning with the Silva reference database and further alignment in ARB, I determined that this group likely belongs to candidate phylum BD-1 (Fig 11). The closest BLAST hits to the BD-1 sequences had less than 90% maximum identity to the tunicate sequence. These closest hits were all uncultured organisms, one from the Vailulu'u seamount and one from a red alga. The two next most abundant groups (19% and 9%) in the C2TC library belonged to the Kordimonas in the alphaproteobacteria by RDP and Silva alignment. Both of these groups are potential candidates for the major gram negative morphotype observed by CARD-FISH in the Ciona tunic. None of the available FISH probes hit either of these phylotypes, so the next step will be to design specific probes for both. As another check, the CYT clone library did not contain the BD1-5 phylotype, but I do not have FISH data for this section to confirm whether or not it contains bacteria.

Molgula manhattensis

CARD-FISH Gonads of M. manhattensis were specifically labeled by the EubI-III probe (red) (Fig 8). The labeling occurred in a highly structured pattern, seeming to outline the more homogeneous regions of the gonad and revealing smaller “packets” of DAPI staining. The label was also observed in follicle cell regions surrounding possible oocyctes. A double hybridization was not performed with Euk516 so the location of the bacteria inside or outside cells was not verified. The EubI-III FISH signals were tiny and punctate, coccoid shapes. Only one morphotype was observed. The bacteria did not appear helical as would be expected for Spiroplasma. More specific probes were not tested as no available probe was a match for the only observed phylotype in the 16S rDNA clone library from the same gonad.

16S Clone Library Only one 16S OTU was observed in all 14 sequences from the M3G library, and the closest BLAST hit was to the M. manhattensis clone library strains of Mollicutes from Tait, 2006. These bacteria belong to the Tenericutes phylum which contains many animal-associated and pathogenic members.

Didemnum vexillum

CARD-FISH No specific bacterial labeling was observed with EubI-III FISH probes in D. vexillum whole colony sections, but the tissue complexity and autofluorescence made the analysis complicated (Fig 9). By chance, one of my sections had a portion of cuticle shorn away from the main section and specific bacterial signals were observed on that cuticle section (Fig 10). These represent possible epibionts. However, a good unlabeled control for this section was not available.

16S clone libraries and 454 data Fairly good saturation was achieved for the D1A 454 16S barcoded sequencing data as shown by a rarefaction plot (Fig 1). The diversity of the D. vexillum libraries was higher than that of the other tunicates which makes sense given that the entire animal was combined rather than a specific tissue. There was good agreement of the major phylotypes observed in the 454 data and the combined D1A and D1B clone libraries. The main difference between the Didemnum 454 data and the associated water sample was due to the presence of specific groups of alphaproteobacteria in the tunicate sample (Fig 12). The two major phylotypes in the Didemnum clone libraries were classified by RDP as Alphaproteobacteria Kiloniella and Alphaproteobacteria unclassified genus, and the closest BLAST hits were to marine organisms.

Conclusions and Future Directions

Ciona intestinalis • High density of bacteria present in “ground substance” of tunic (acid mucopolysaccharide and protein) of at least 3 individuals from MRC tank • One major gram-negative morphotype with short rod shape observed by FISH • Rare gammaproteobacteria as shown by FISH • No bacteria visible in gonad by FISH and no PCR amplification from gonad • 16S clone library of tunic and cuticle dominated by Candidate phylum BD1-5 and the alphaproteobacteria Kordimonas • Need specific FISH probes to identify major morphotype. A clone library of tunic without cuticle would also be useful. Molgula manhattensis • High density of bacteria present in gonad in a structured pattern • One phylotype in clone library consistent with literature data from Sievert lab in 2006 (Tait, 2006) - Mollicutes • Molgula from Eel Pond (Tait, 2006) and East Falmouth (this study) contain this Mollicute phylotype in the gonad • Bacteria observed by FISH do not appear helical – consistent with mycoplasma versus spiroplasma • Need Eub hybridization to confirm extracellular bacteria Didemnum vexillum • Most diverse of 16S clone libraries (whole animal versus specific tissue) • Two major alphaproteobacterial phylotypes specific to tunicate sample • Autofluoresence and complicated eukaryotic anatomy complicate microscopy • Bacterial FISH signals observed by chance on exterior cuticle • Next step would be alpha-specific probe on fixed cuticle surface

Even the well-studied tunicate Ciona intestinalis contains surprising numbers of uncharacterized bacterial in the tunic ground substance. This study highlights how little is known about microbial communities even of many model organisms in eukaryotic biology. Bacteria were labeled by FISH in or on all three tunicates used for this project. Further, the comparison of tunicate 16S rDNA clone libraries with libraries from associated seawater samples demonstrated that these eukaryotes enrich for specific bacterial populations and represent a unique biological niche within the marine environment.

Many questions remain to be answered about the observed tunicate-associated bacterial populations. Are these bacterial populations consistent across individuals, related tunicate species, and geography? How are they transmitted? How do the bacteria and eukaryote interact to select a specific population? How do the bacteria interact with the innate immune system? Several studies have examined the immune response in the Ciona tunic to foreign challenges including sheep blood erythrocytes and LPS (Bonura, 2009 and Parrinello, 1990). It appears that the tunic bacterial population is somehow evading the tunicate immune response. How do the bacteria interact with potential vanadocytes and antimicrobial peptides in the tunic? Alternatively, perhaps this aquarium-kept population of Ciona was unhealthy and unable to prevent invasion of pathogenic bacteria in the tunic. This raises the central unanswered question: What are the ecological and biological functions of these interactions? Are the observed bacteria commensal, mutualistic, or pathogenic? What are they eating and producing? The observation of one major morphotype by FISH in Ciona and the two major phylotypes in the clone library indicate that this natural enrichment could be a good source of future metagenomic studies. Methods would have to be developed to separate the bacterial cells from the tunic ground substance and eukaryotic cells. Since the Ciona intestinalis genome is available, eukaryotic portions of a metagenome should be easier to filter out. I also believe the Ciona tunic would represent an excellent source for enrichment of novel bacteria including candidate phylum BD1-5 and novel alphaproteobacteria. References

Blunt, J.W., Copp, B.R., Munro, M.H., Northcote, P.T., Prinsep, M.R. (2010) Marine natural products. Nat Prod Rep. 2, 165-237. Bonura, A., Vizzini, A., Salerno, G., Parrinello, N., Longo, V., Colombo, P. (2009) Isolation and expression of a novel MBL-like collectin cDNA enhanced by LPS injection in the body wall of the ascidian Ciona intestinalis. Molecular Immunology 46, 2389–2394 Buchsbaum, R. (1948) Animals without backbones, an introduction to the invertebrates. University of Chicago Press. De Leo, G., Patricolo, E. (1980) Blue-Green algalike cells associated with the tunic of Ciona intestinalis L. Cell Tissue Res.212, 91-98. De Leo, G., Patricolo, E., Frittitta, G. (1981) Fine structure of the tunic of Ciona intestinalis. Acta Zoologica 62, 259-271. Hirose, E., Hirose, M., Neilan, B.A. (2006) Localization of symbiotic cyanobacteria in the colonial ascidian Tridemnum miniatum (Didenidae, ). Zoological Science. 23, 435-442. Ishi, K., Mubmann, M., MacGregor, B.J., Amann, R. (2004) nd archea in marine sediments. FEMS Microbiology & Ecology 50, 203-212.An improved fluorescence in situ hybridization protocol for the identification of bacteria Martinez-Garcia, M., Diaz-Valdes, M., Wanner, G., Ramos-Espla, A., Anton, J. (2007) Microbial community associated with the colonial ascidian Cystodytes dellechiajei. Environmental Micro. 9, 521- 534. Moss, C., Green, D.H. Perez, B., Velasco, A. Henrıquez, R., McKenzi, J.D. (2003) Intracellular bacteria associated with the ascidian : phylogenetic and in situ hybridisation analysis. . 143, 99–110. Parrinello, N., De Leo, G., Di Bella, M.A. (1990) Fine Structural Observations of the Granulocytes Involved in theTunic Inflammatory-like Reaction of Ciona intestinalis (Tunicata). J of Pathology 56, 181-189. Passamaneck, Y.J., Gregorio, A.R. (2005) Ciona intestinalis: chordate development made simple. Developmental Dynamics. 233, 1-19. Pisut, D.P., Pawlik, J.R. (2002) Anti-predatory chemical defenses of ascidians: secondary metabolites or inorganic acids? J of Exp Marine Biol and Ecol. 270, 203-214. Schmidt, E.W., Nelson, J.T., Rasko, D.A., Sudek, S., Eisen, J.A., Haygood, M.G., Ravel, J. (2005) Patellamide A and C biosynthesis by a microcin-like pathway in Prochloron didemni, the cyanobacterial symbiont of . PNAS 102, 7315–7320. Saffo, M.B., McCoy, A.M., Rieken, C., Slamovits, C.H. (2010) Nephromyces, a beneficial apicomplexan symbiont in marine animals. PNAS 107, 16190-16195. Schmidt, E.W., Donia, M.S. (2010) Life in cellulose houses: symbiotic bacterial biosynthesis of ascidian drugs and drug leads. Curr Opin Biotechnol. 6, 827-33. Tait, E., Carman, M, Sievert, S.M. (2007) Phylogenetic diversity of bacteria associated with ascidians in Eel Pond (Woods Hole, Massachusetts, USA). J of Exp Marine Biol and Ecol. 342, 138-146. Trivedi, S. Ueki, T., Yamaguchi, N., Michibata, H. (2003) Novel vanadium-binding proteins () identified in cDNA libraries and the genome of the ascidian Ciona intesinalis. Biochim Biophys Acta. 1630, 64-70. Yokobori, S., Kurabayashi, A., Neilan, B.A., Maruyama, T., Hirose, E. (2006) Multiple origins of the ascidian-Prochloron symbiosis: molecular phylogeny of photosymbiotic and non-symbiotic colonial ascidians inferred from 18S rDNA sequences. Mol and Evol. 40, 8-19.

Fig 1. Rarefaction analysis with 97% OTU clustering 454 16S Barcoded Sequencing Rarefaction Plot

CSW DSW D1A

Clone Library Rarefaction Plot

CSW MSW DSW D1A D1B C2TC CYT M3G

Table of closest BLAST hits to tunicate 16S libraries. Shown are closest hits to sequences from 97% OTU clusters with more than one representative. BLAST search performed on 7/23/11.

% Closest Max. RDP Classification RDP Genus Source clones BLAST hits Id Uncultured C2TC Proteobacteria Unclassified 44% FJ497412.1 bacterium clone 89% Vailulu'u Seamount VS_CL-163 Uncultured DQ269061. Delisea pulchra (Red bacterium clone 89% 1 alga) DPC005 Uncultured EU287361. Alphaproteobacteria Kordiimonas 19% bacterium clone 99% arctic surface sediment 1 S26-61 Uncultured alpha AM162574. proteobacterium 98% cuttlefish egg capsule 1 clone 3iSOMBO30 Uncultured EU287361. Alphaproteobacteria Kordiimonas 9% bacterium clone 92% arctic surface sediment 1 S26-61 marine fuel oil Uncultured alpha GU259680. contaminated beach Alphaproteobacteria Unclassified 9% proteobacterium 92% 1 following the Prestige clone B23 fuel-oil spill CYT marine fuel oil Uncultured alpha GU259680. contaminated beach Alphaproteobacteria Unclassified 54% proteobacterium 92% 1 following the Prestige clone B23 fuel-oil spill Uncultured EU287361. Alphaproteobacteria Kordiimonas 33% bacterium clone 92% arctic surface sediment 1 S26-61 Uncultured GU363027. marine sediment from Verrucomicrobia Rubritalea 8% bacterium clone 95% 1 the South China Sea BD72BR59 Isolate from the AB297806. Rubritalea 95% visceral specimen of an 1 tangerina unidentified sea hare Kopriimonas DQ167245. D1 Alphaproteobacteria Kiloniella 23% byunsanensis 98% mature marine biofilm 1 strain KOPRI 13522 Uncultured alpha DQ860071. Cystodytes dellechiajei Alphaproteobacteria Unclassified 17% proteobacterium 99% 1 (colonial tunicate) clone L13 Uncultured marine GU319172. bacterium clone Acropora eurystoma Alphaproteobacteria Kiloniella 12% 99% 1 A3T_UNP1_B12 (coral) sequence Uncultured alpha DQ860071. Cystodytes dellechiajei Alphaproteobacteria Unclassified 10% proteobacterium 99% 1 (colonial tunicate) clone L13 Uncultured alpha hydrothermal fluid at a CYT AB294915. Alphaproteobacteria Kiloniella 9% proteobacterium 98% shallow submarine hot cont. 1 pItb-HW-71 spring Uncultured gamma GU230323. Gammaproteobacteria Unclassified 4% proteobacterium 97% coastal water 1 clone ARTE1_216 Uncultured Axinella corrugata Gammaproteobacteria Unclassified 4% EF092211.1 Coxiella sp. clone 92% () B2505_A5 Uncultured Mollicutes M3G Bacteria Unclassified 100% EF137401.2 97% M. manhattensis gonad bacterium clone Mm1 Uncultured Mollicutes EF137402.1 98% M. manhattensis gonad bacterium clone Mm2

Figure 2. Dissections of C. intestinalis and D. vexillum. A. Tunic removal of C. intestinalis. B and C. C. intestinalis epibionts on tunic cuticle surface D. C. intestinalis gonad (white) surrounded by gut. E. D. vexillum colony growing over Steyela clava. E. Section of D. vexillum colony. A. B.

C. D.

E. F.

Figure 3. Dissection of M. manhattensis gonad. A. Exterior of M. manhattensis siphon. B. Right side of M. manhattensis with removed tunic. Right hermaphroditic gonad (white) above renal sac. C. Dissected Right hermaphroditic gonad M3G. D. Left side of M. manhattensis with removed tunic. Left hermaphroditic gonad (white) above pyloric sac.

A. B.

I.

K. L.

Figure 4. CARD-FISH of C. intestinalis individual 5 tunic sections at 100x. A. Double hybridization with EubI-III(red) and Euk516(green) and DAPI (blue) showing numerous bacteria and few tunicate cells in ground substance. B. Same as A viewed with DIC. C. Double hybridization control with Non338(red) and Non338(green) and DAPI (blue). D. Same as C viewed with DIC. E. Confocal micrograph of tunic and cuticle (white arrow) stained as in A. F. Confocal micrograph of tunic stained as in A.

A. B.

C. D.

E. F.

Figure 5. CARD-FISH of C. intestinalis individual 2 tunic sections. A. Tunic DAPI stained and hybridized with Non338 (red). B. Tunic DAPI stained and hybridized with Gam42a (red). Three gammaproteobacterial signals are visible in this view.

A. B.

Figure 6. Gram stain of Ciona individual 5. A. Phase contrast micrograph at 40x of tunic and cuticle(black arrow). B. Phase contrast micrograph at 100x of tunic. A. B.

Figure 7. CARD-FISH of Ciona individual 5 gonad sections. A. DAPI stained and double hybridized with control Non338 (red) and Non338 (green) at 10x. B. DAPI stained and double hybridized with EubI-III (red) and Euk516 (green) at 100x. No bacterial signals were observed.

A. B.

Figure 8. M. manhattensis gonad CARD-FISH. A. DAPI stained and hybridized with EubI-IIII(red). View of follicle cell region at 100x. Colors are overexposed, green is autofluorescence. B. DAPI stained and hybridized with Non338(red). View of follicle cell region at 100x. Colors are overexposed, green is autofluorescence. C. 10x phase contrast view of molgula gonad section showing upper homogenous region and lower follicle region. D. Three dimensional rendering though homogenous gonad section DAPI stained and hybridized with EUbI-III(red). E and F. DAPI stained and hybridized with EubI-IIII(red). View of follicle cell region at 100x taken with confocal. A. B.

C. D.

E. F.

Figure 9. D. vexillum full colony cross sections. A-D. DAPI labeled and EubI-III(red) hybridized sections viewed at 100x with A480 long pass to show general anatomical features.

A. B.

C. D.

Figure 10. D. vexillum cuticle section. DAPI labeled and EubI-III(red) hybridized section viewed at 100x.

Figure 11. Tree of most abundant OTU at 97% clustering in C2TC clone library. Tree created by aligning to SILVA reference database and then alignment in ARB. This group falls into the Candidate phylum BD1-5.

Figue 12. Comparison of 454 16S barcoded sequencing data from D. vexillum sample 1A and associated water sample. A. Percentage of sequences by phylum. 97% OTU clustering and classified by RDP. B. Percentage of sequences in Proteobacterial groups.

A. 90 80 70 60 50 40 30 %LBD1A 20 %LBDSW 10 0

B.

80 70 60 50 40 30 %LBD1A 20 %LBDSW 10 0