Deletion of the Gene Pip4k2c, a Novel Phosphatidylinositol Kinase, Results in Hyperactivation of the Immune System

Deletion of the gene Pip4k2c, a novel phosphatidylinositol kinase, results in hyperactivation of the immune system

Hyeseok Shima,b,c,1, Chuan Wud, Shivan Ramsamooja,b, Kaitlyn N. Boscha,b, Zuojia Chend, Brooke M. Emerlinga,b, Jihye Yuna,b, Hui Liue, Rayman Choo-Winga,b, Zhiwei Yanga,b, Gerburg M. Wulfe, Vijay Kumar Kuchrood, and Lewis C. Cantleya,b,2

aMeyer Cancer Center, Weill Cornell Medical College, New York, NY 10065; bDepartment of Medicine, Weill Cornell Medical College, New York, NY 10065; cBiological and Biomedical Sciences Graduate Program, Harvard Medical School, Boston, MA 02115; dEvergrande Center for Immunologic Diseases, Harvard Medical School and Brigham and Women’s Hospital, Boston, MA 02115; and eDivision of Hematology/Oncology, Beth Israel Deaconess Medical Center, Boston, MA 02115

Contributed by Lewis C. Cantley, May 6, 2016 (sent for review January 28, 2016; reviewed by Richard A. Flavell and Robin F. Irvine) − − Type 2 phosphatidylinositol-5-phosphate 4-kinase (PI5P4K) converts with Trp53 / mice results in early embryonic lethality for the − − − − phosphatidylinositol-5-phosphate to phosphatidylinositol-4,5-bisphos- subset of embryos that are Pip4k2b / , Trp53 / , indicating a phate. Mammals have three enzymes PI5P4Kα,PI5P4Kβ, and PI5P4Kγ, synthetic lethality relationship between these genes. In contrast, − − and these enzymes have been implicated in metabolic control, Pip4k2a / mice do not exhibit any of the phenotypes observed in − − growth control, and a variety of stress responses. Here, we show the Pip4k2b / mice (5). They are not protected from obesity or that mice with germline deletion of type 2 phosphatidylinositol-5- insulin resistance, they do not exhibit a synthetic lethality re- phosphate 4-kinase gamma (Pip4k2c), the gene encoding PI5P4Kγ, lationship with Trp53, and in all ways examined, they resemble appear normal in regard to growth and viability but have increased wild-type mice (5). However, germline deletion of one allele of − − inflammation and T-cell activation as they age. Immune cell infiltrates Pip4k2a in the context of germline Pip4k2b / causes enhance- −/− − − increased in Pip4k2c mouse tissues. Also, there was an increase in ment of the phenotypes of the Pip4k2b / mice. Deletion of both γ proinflammatory cytokines, including IFN , interleukin 12, and inter- alleles of Pip4k2a and Pip4k2b did not have any observable effect Pip4k2c−/− Pip4k2c−/− leukin 2 in plasma of mice. mice had an in- on embryonic development up until the time of birth, but resulted crease in T-helper-cell populations and a decrease in regulatory T-cell in perinatal lethality of all pups. These results indicate that these populations with increased proliferation of T cells. Interestingly, genes do not play a major role in embryonic development and mammalian target of rapamycin complex 1 (mTORC1) signaling that Pip4k2a provides a backup for Pip4k2b that becomes critical was hyperactivated in several tissues from Pip4k2c−/− mice and − − at the time of birth. treating Pip4k2c / mice with rapamycin reduced the inflammatory phenotype, resulting in a decrease in mTORC1 signaling in tissues and a decrease in proinflammatory cytokines in plasma. Significance These results indicate that PI5P4Kγ plays a role in the regulation of the immune system via mTORC1 signaling. The mammalian target of rapamycin complex 1 (mTORC1) signaling pathway is an important facet of the immune system, PIP4K2C | mTORC1 | autoimmunity | PI5P4K | inflammation including that it regulates T-cell differentiation and activation. Here, we report that type 2 phosphatidylinositol-5-phosphate 4-kinase gamma (protein, PI5P4Kγ; gene, PIP4K2C) plays a role ype 2 phosphatidylinositol-5-phosphate 4-kinase (PI5P4K) con- in the regulation of the immune system by manipulating verts phosphatidylinositol-5-phosphate to phosphatidylinositol- T mTORC1 signaling. These results suggest that the SNP at the 4,5-bisphosphate. Mammals have three genes, PIP4K2A, PIP4K2B, PIP4K2C locus (rs1678542) in human patients with autoimmunity and PIP4K2C that encode the enzymes PI5P4Kα, PI5P4Kβ, and might cause a decrease in PI5P4Kγ expression and thereby an PI5P4Kγ, respectively. increase in mTORC1 signaling. In addition, these results imply All three isoforms are highly expressed in brain, whereas their that inhibition of mTORC1 would be beneficial to these patients. relative expressions in other tissues vary. PI5P4Kα is highly These studies also suggest that agents that inhibit PIP4K2C expressed in spleen and the peripheral blood. PI5P4Kβ is highly function could be useful to enhance cancer immunotherapy. expressed in muscle, whereas PI5P4Kγ is highly expressed in γ kidney (1). In kidney, PI5P4K is mostly detected in the cortex Author contributions: H.S., C.W., and L.C.C. designed research; H.S., C.W., S.R., K.N.B., Z.C., and the outer medulla (1). All tissues examined appear to express J.Y., H.L., R.C.-W., and Z.Y. performed research; B.M.E., G.M.W., and V.K.K. contributed at least one isoform of PI5P4K. At the cellular level, PI5P4Ks are new reagents/analytic tools; H.S. and C.W. analyzed data; and H.S. and L.C.C. wrote found in several organelles, including plasma membrane, cytosol, the paper. nucleus, and vesicular compartments (2, 3). It is not simple to Reviewers: R.A.F., Yale School of Medicine, Howard Hughes Medical Institute; and R.F.I., define unique compartmentalization of the individual enzymes Cambridge University. because all three isoforms can homodimerize or heterodimerize Conflict of interest statement: L.C.C. owns equity in, receives compensation from, and α β serves on the board of directors and scientific advisory board of Agios Pharmaceuticals. with each other. At the sequence level, PI5P4K and PI5P4K Agios Pharmaceuticals is identifying metabolic pathways of cancer cells and developing are more homologous to each other than either is to PI5P4Kγ. drugs to inhibit such enzymes to disrupt tumor cell growth and survival. L.C.C. owns Also, PI5P4Kγ is only about 1% as active as the other isoforms, equity in, receives compensation from, and serves on the scientific advisory board of Petra Pharmaceuticals, a company that develops targeted therapies for cancer treatment. In raising the possibility that its major role may be to localize or addition, Petra Pharmaceuticals will be providing funds to support research in the L.C.C. regulate the activities of PI5P4Kα and PI5P4Kβ. laboratory, although the research described in this paper predated the existence of this Germline deletion of both alleles of Pip4k2a or Pip4k2b in collaborative agreement. mice results in healthy mice that live a normal life span. The 1Present address: Petra Pharmaceuticals, New York, NY 10016. −/− Pip4k2b mice have increased insulin sensitivity and are pro- 2To whom correspondence should be addressed. Email: [email protected]. tected from obesity, insulin resistance, and type 2 diabetes when This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. −/− placed on a high-fat diet (4). Also, crossing the Pip4k2b mice 1073/pnas.1600934113/-/DCSupplemental.

7596–7601 | PNAS | July 5, 2016 | vol. 113 | no. 27 www.pnas.org/cgi/doi/10.1073/pnas.1600934113 Downloaded by guest on September 30, 2021 Whereas less is known about PI5P4Kγ, it has been linked to In addition, they exhibit hyperactivation of mTORC1 signaling in the mammalian target of rapamycin signaling complex (mTORC) multiple tissues, suggesting that Pip4k2c negatively regulates and to cellular immunity. Mackey et al. argued that PI5P4Kγ was mTORC1. These results, along with a recent observation that the negatively regulated by mTORC1 through direct phosphorylation enzyme encoded by this gene is a substrate of mTORC1 (6), at serine 324 and serine 328 (6). On the other hand, it was suggest a close relationship between mTORC1 and Pip4k2c. − − reported that knocking out the only PI5P4K isoform in Drosophila Moreover, the hyperimmune phenotype of the Pip4k2c / mice resulted in lower body weight and that this correlated with de- could be partially ameliorated by treatment with the mTORC1 creased mTORC1 signaling (7). Of particular interest, multiple inhibitor, rapamycin. Importantly, a SNP (rs1678542) located near studies have shown a link between a SNP (rs1678542) in the the PIP4K2C locus has been correlated with familial autoim- human PIP4K2C locus and familial autoimmunity (8, 9). The munity (8) and the results presented here suggest that loss of immune system is a complex network that evolved to protect PI5P4Kγ function could explain this disease. organisms from invasion of various microbes. Whereas an active immune system protects from microbes, overactivation of the Results immune system can result in autoimmunity. An understanding of Generation of Pip4k2c−/− Mice. To investigate the role of PI5P4Kγ − − the molecular underpinnings of an overactive or underactive in mammals, PI5P4Kγ knockout (Pip4k2c / ) mice were gener- immune system is important for developing therapies for immune- ated using Pip4k2c-targeted ES cell clones obtained from the related diseases from immunodeficiency to autoimmunity and knockout mouse project (KOMP) repository (www.komp.org). even cancers. mTORC1, a central regulator of cell survival, In the targeting construct, exons 3 and 4 of Pip4k2c were growth, and metabolism, also plays a critical role in regulation of bracketed by loxP sequences, so deletion of these exons could immune cells. mTORC1 responds to intra- and extracellular remove much of the kinase domain and place the protein out of signals such as growth factors, oxygen levels, energy status, and the correct reading frame (Fig. 1A). ES cell clones were kar- amino acid levels (10). The mTOR pathway is activated during yotyped and selected for microinjection. Because the targeted various cellular processes, including T-cell activation, insulin clones were C57BL/6N (agouti)-derived JM8A3.N1, the cells resistance, and tumor formation. The immunosuppressive drug were injected into C57BL/6J (black) blastocysts. Three chimeric rapamycin that has been used clinically to prevent transplant mice were born and they were backcrossed with C57BL/6 mice rejection, directly binds to mTORC1 to suppress immune responses for three generations. Then whole body knockout mice were (11). One of the identified roles of mTORC1 in the immune system obtained by crossing the transgenic mice with B6.C-Tg(CMV- + − + − is to direct T-cell-fate decisions. mTORC1 positively regulates cre)1Cgn/J. The Pip4k2c / mice were crossed with Pip4k2c / + + − − differentiation of the Th1 and Th17 subset of Th cells (12). On mice to get Pip4k2c / (WT) mice and Pip4k2c / (KO) mice to the other hand, mTORC1 is a negative regulator of Treg dif- use for the ensuing experiments. The wild-type allele and knock- ferentiation (13) and at the same time is required to maintain out allele of each mouse was confirmed by genomic DNA PCR Treg function (14). (Fig. 1B) and Western blot for protein expression (Fig. 1C). Here, we present the first characterization to our knowledge of − − − − − − mice with germline deletion of Pip4k2c. Surprisingly, Pip4k2c / Increased Inflammation in Pip4k2c / Mice. Pip4k2c / mice bred − − mice exhibit a phenotype that is quite different from Pip4k2a / or normally and grew into adulthood, displaying no obvious growth − − − − Pip4k2b / mice. These mice develop normally and are not pro- or behavioral abnormalities (Fig. S1 A–E). Unlike Pip4k2b / tected from obesity, insulin resistance, or diabetes, but rather mice, these mice did not have enhanced insulin sensitivity and develop enhanced immune responses, resulting in autoimmunity. were not protected from obesity on a high-fat diet (Fig. S1 A–E).

A Wild type locus B Mouse tail DNA +/- -/- Ex Ex Ex Ex +/+ 2 3 4 5 : loxP : FRT WT (pwtF,pwtR) pwtF pwtR KO Cassette inserted locus C (pkoF,pkoR) Ex En2 IR act : Ex Ex Ex Mouse kidney protein pA pA 2 SA ES gal :neo 3 4 5 +/+ +/+ +/+ -/- -/- -/- PI5P4K X CMV-Cre -actin Knockout locus

E INFLAMMATION Ex En2 IR Ex B220 CD3 MAC-2

pA IMMUNOLOGY AND 2 SA ES gal 5 pkoF pkoR WT

D WT KO (%)

2 * KO1 KO1 1.5 1

total area 0.5

0 KO2 Immune infiltrates WT KO

Fig. 1. Generation of Pip4k2c−/− mice. (A) Schematic representation of the Pip4k2c locus before and after deletion of the critical exons (exons 3 and 4). The deletion of the critical exons was induced by Cre-lox recombination. β-gal, β-galactosidase; En2SA, engrailed 2 gene splice acceptor sequence; Ex, exon; neo, neomycin; pA, polyA signal. (B) PCR analysis of genomic DNA prepared from mouse tail. Primers used for genotyping by PCR are pwtF, pwtR, pkoF, and pkoR. − − (C) Western blotting of proteins prepared from mouse kidney. (D) Immune cell infiltration in the liver of Pip4k2c / mice. H&E staining readily identifies − − immune infiltrates in the liver tissue from Pip4k2c / mice. (Scale bars, 100 μm.) The area of immune infiltrates of H&E-stained liver tissues was quantified − − using ImageJ software. Twenty-five Pip4k2c / mice and 12 wild-type mice (four images per mouse) were examined. The results are presented as means ± SE − − − − of the means. (E) Immune infiltrates in liver tissue of Pip4k2c / mice are mostly T cells and B cells. The Pip4k2c / liver sections of two animals (KO1 and KO2) were incubated with anti-CD3, anti-B220, and anti-Mac2 antibodies, respectively.

Shim et al. PNAS | July 5, 2016 | vol. 113 | no. 27 | 7597 Downloaded by guest on September 30, 2021 − − Because a SNP (rs1678542) near the human PIP4K2C locus has IgG3 increased in the plasma of Pip4k2c / mice, which agreed − − been linked to autoimmunity, we examined whether Pip4k2c / with the increase in IL-17 levels (Fig. 2C). mice exhibit any inflammatory phenotype. We carried out a Pip4k2c−/− T Cells Are Hyperactivated in Pip4k2c−/− Mice. Flow cytometry was complete necropsy of mice at different ages. We found + used to determine the activity of T cells by counting CD44 and that immune cells formed clusters in the organs of mature + − − Pip4k2c−/− – CD62L T cells. We found that Pip4k2c / mice have more mice (8 14 mo of age). The immune cell infiltration + + was observed in the liver, kidney, salivary glands, lungs, and in- CD44 -activated T cells and fewer CD62L naïve T cells compared with the wild-type mice (Fig. 2D). These data suggested that testine of the mice (Fig. 1D and Fig. S1F). To measure the −/− − − T cells were more activated in Pip4k2c mice. Also, Pip4k2c / surface area of infiltrating immune cells in the liver, we para- + + formaldehyde fixed and paraffin embedded liver tissues and mice showed increased CD4 and CD8 populations, indicating an increase of Th cells and cytotoxic T cells (Fig. S1G). performed H&E staining. The ratio of immune infiltrates per + −/− To investigate proliferation of T cells, we isolated CD4 T total area was significantly increased in the Pip4k2c mice (Fig. −/− − − cells from the spleens from Pip4k2c mice and wild-type mice. 1D), which indicated that the Pip4k2c / mice developed chronic The cells were seeded in 96-well plates coated with anti-CD3 and inflammation without a specific trigger such as infection or in- anti-CD28. After 48 h of culture, 3H-thymidine was added for juries. To identify which type of immune cells infiltrated the or- another 16 h before measuring the 3H-thymidine incorporation − − gans, we stained the liver tissue sections with anti-CD3, anti-B220, (Fig. 2E). The Pip4k2c / T cells showed significantly higher and anti-Mac2 antibodies. The infiltrating immune cells in the − − + + proliferation rates than T cells from wild-type mice. In accor- Pip4k2c / − − livers consisted of mostly CD3 T cells and B220 B dance with increased T-cell activation in Pip4k2c / mice, the E + + − − cells (Fig. 1 ). number of Foxp3 CD4 Treg cells decreased in Pip4k2c / mice − − Moreover, the plasma levels of various proinflammatory cy- (Fig. 2F). Therefore, these results indicate that Pip4k2c / mice Pip4k2c−/− tokines increased in the mice, including the Th1-type developed inflammation with an activation of T cells. cytokines IFNγ, IL-12, and IL-2 (Fig. 2A). Additionally, IL-17 + and IFNγ secreted by CD4 T cells isolated from spleen were Increased mTORC1 Signaling in Pip4k2c−/− Mice. Because the im- − − − − higher in the Pip4k2c / mice (Fig. 2B). As T-cell cytokines can mune system is hyperactivated in Pip4k2c / mice, as indicated affect Ig class switching, we performed Ig isotyping. It is known by an increase in inflammation concomitantly with an increase in that IL-17 drives B cells to undergo preferential isotype class T-cell activation, an increase in Th-cell population and a de- switching to IgG3 and IgG2a (15). We found that the level of crease in Treg-cell population, we next investigated if mTORC1

A 10000 WT KO 1000 * * * 100 *

10 * * pg /ml (log scale) 1

0.1 KC LIF LIX IL-9 IL-3 IL-5 IL-4 IL-6 IL-7 MIG IL-2 IFN IL-17 IL-10 IL-1a IL-1B IP-10 TNFa IL-15 IL-13 MIP-2 VEGF G-CSF MCP-1 M-CSF MIP-1B MIP-1a Eotaxin GM-CSF RANTES IL-12 (p40) IL-12 (p70)

B C 2.5 WT * 2 KO WT KO 1.5 1

IFN 0.5 IFN (ng /ml) IL-17 (ng /ml) 0 Absorbance at 450nm KO IgA IgM WT KO WT IgG1 IgG3 IL-17 IgG2a IgG2b DEF 80000 WT WT KO * CD4+ CD44+ KO CD4+Foxp3+ CD62L- (%) 60000 * * 44.2 20.7 (%) 80 50 60 40000 40 30 40 20 20 20000 Foxp3 10 CD62L 0 0 WT KO 0 WT KO H Uptake (c.p.m)

3 10 3 1 0.3 0.1 CD44 Anti-CD3 CD4

− − Fig. 2. Proinflammatory cytokines are increased in Pip4k2c / mice. (A) Plasma cytokines were detected using multiplex cytokine ELISA. The experiments were performed on >10 mice (12–14 mo old) per group, with two measurements per mouse. The y axis is in logarithmic scale. The results are presented as − − + means ± SE of the means. *P < 0.05. (B) T-cell–derived IFNγ and IL-17 levels are elevated in Pip4k2c / mice. Flow cytometry of IL-17 and IFNγ secretion by CD4 T cells isolated from spleen-indicated groups. The data are representative of three independent experiments with n > 3 mice (12–14 mo old) per group. *P < − − 0.05 (Student’s t test, error bars represent SD). (C) Plasma IgG3 levels are elevated in Pip4k2c / mice. Plasma Ig levels were measured using ELISA. Three Pip4k2c−/− mice (12 mo old) and four age-matched wild-type mice were examined. The results are presented as means ± SE of the means. *P < 0.05. (D) Pip4k2c−/− mice exhibit an increase in CD44+ active T cells and a decrease in CD62L+ naïve T cells. Flow cytometry is shown of CD44+ and CD62L+ T cells isolated from spleen-indicated groups. The most representative data from three independent experiments are given, with n > 3mice(12–14 mo old) from each group. − − + (E) T cells from Pip4k2c / mouse have enhanced growth rates. CD4 T cells were isolated from spleens of 12-mo-old mice and cultured in media con- taining 3H-thymidine. The level of radioactivity was measured by liquid scintillation. The data are presented as mean 3H-thymidine incorporation (cpm ± SEM, − − + + performed in triplicate). *P < 0.05. (F) Regulatory T cells are suppressed in Pip4k2c / mice. Flow cytometry of Foxp3 and CD4 T cells isolated from spleen- indicated groups. The most representative data from three independent experiments are given, with n > 3 mice (12–14 mo old) from each group.

7598 | www.pnas.org/cgi/doi/10.1073/pnas.1600934113 Shim et al. Downloaded by guest on September 30, 2021 blot. We found that Thr389 of p70-S6K was still hyperphos- A Kidney Liver Brain Pip4k2c−/− +/+ +/+ +/+ -/- -/- -/- +/+ +/+ +/+ -/- -/- -/- +/+ +/+ +/+ -/- -/- -/- phorylated in liver and spleen tissues of mice treated p-p70-S6K (T389) with vehicle control for 2 wk. However, in the rapamycin-treated −/− p70-S6K Pip4k2c mice, p70-S6K phosphorylation on Thr389 was reduced SREBP1 to the levels seen in tissues from wild-type mice, indicating that (mature) rapamycin had suppressed mTORC1 signaling (Fig. 4 A and B). -actin The levels of plasma cytokines were measured in the control Muscle p = 0.038 and rapamycin-treated mice. In agreement with the results in +/+ +/+ +/+ -/- -/- -/- 1.5 * A Pip4k2c−/− p-p70-S6K 1 Fig. 2 , before rapamycin treatment the mice (T389) γ 0.5 exhibited very high plasma levels of IL-12(p40) and IFN com- p70-S6K

p-p70-S6K 0 pared with levels in plasma of wild-type mice. The plasma level

total p70-S6K −/− SREBP1 of IL-12(p40) in Pip4k2c mice was reduced to the level ob- (mature) liver brain KO liverT muscle -actin WT W KO brainT WT kidneyKO kidney W KO muscle served in wild-type mice at 24 h of rapamycin treatment and remained suppressed after 2 wk of treatment. Rapamycin had no p= 0.07 BCSpleen 2 Treg 1.5 Th +/+ +/+ +/+ -/- -/- -/- +/+ -/- +/+ -/- p-p70-S6K 1 p-p70-S6K (T389) 0.5 (T389)

p70-S6K p-p70-S6K 0 Liver p-p70-60K total p70-S6K T p70-S6K A KO WT KO total p70-60K -actin W vehicle +++ -- -+++ --- 2.5 * 2 p = 0.021 rapamycin ---+++ ---+++ 1.5 Fig. 3. Signaling downstream of mTORC1 is up-regulated in various tissues p-p70-S6K 1 − − of Pip4k2c / mice. (A) p70-S6K Thr389 phosphorylation, total p70-S6K, and (T389) 0.5 p70-S6K 0 SREBP1 (cleaved mature form) were blotted for in kidney, liver, brain, and WT WT KO KO − − muscles from 12-mo-old wild-type and Pip4k2c / mice (three mice per actin veh rapa veh rapa group). The bar graph shows the ratio of p70-S6K Thr389 phosphorylation Spleen ± B p-p70-60K over total p70-S6K. The results are presented as means SE of the means. WT KO total p70-60K < *P 0.05. (B) p70-S6K Thr389 phosphorylation and total p70-S6K were vehicle +++ -- -+++ --- p = 0.502 1.5 blotted for spleen of 12-mo-old mice (three mice per group). The bar graph rapamycin --- +++ ---+++ 1 shows the ratio of p70-S6K Thr389 phosphorylation over total p70-S6K. The p-p70-S6K 0.5 ± (T389) results are presented as means SE of the means. (C) Th cells and Treg cells 0 p70-S6K isolated from the spleens of 12-mo-old mice (three mice per group). p70-S6K WT WT KO KO actin Thr389 phosphorylation and total p70-S6K were blotted. veh rapa veh rapa

CD100 1000 IFN IL-12(p40) Immune infiltrates signaling, which is known to regulate diverse immune cell types, 100 (%) total area 10 (including T cells, macrophages, dendritic cells, neutrophils, and 10 * − − 10 8 mast cells) was altered in Pip4k2c / mice. We found that 1 6 phosphorylation of p70-S6K on threonine 389 (Thr389, a direct 1 4 2 substrate of mTORC1) was increased in kidney, liver, brain, and 0.1 −/− 0.1 0 muscle tissues from Pip4k2c mice compared with wild-type Relative level (log scale) before 1 day 14 days before 1 day 14 days mice (Fig. 3A). Phosphorylation of Thr389 of p70-S6K was also WT, veh KO, veh WT, rapa KO, rapa T vehT rapa enhanced in spleen, the major immune system organ (Fig. 3B). W W KO KOveh rapa Levels of mature SREBP1 have recently been shown to be a Fig. 4. (A and B) Rapamycin reduces the activation of mTORC1 signaling in − − downstream reporter for mTORC1 activity (16). Consistent with Pip4k2c / mice. p70-S6K Thr389 phosphorylation, total p70-S6K, and actin the increased p70-S6K phosphorylation, we also found that levels were blotted for in liver (A) and spleen (B) from 12- to 14-mo-old wild-type of mature SREBP1 were significantly higher in various tissues and Pip4k2c−/− mice treated with vehicle or rapamycin. Daily i.p. injections − − − − from the Pip4k2c / mice (Fig. 3A). On the other hand, other were given for 2 wk (3 mg·kg 1·d 1, three mice per group). The bar graph upstream and downstream components of the mTORC1 path- shows the ratio of p70-S6K Thr389 phosphorylation over total p70-S6K. The ± < way, including Akt, AMPK, PDK1, GSK3α/β, and 4E-BP1, did results are presented as means SE of the means. *P 0.05. (C) Changes in plasma cytokine levels after treatment with rapamycin. Plasma cytokines not exhibit significant changes in phosphorylation sites that were detected using multiplex cytokine ELISA. Plasma was collected before regulate the activity of this pathway (Fig. S2). The failure to see the treatment (“before”), 24 h after the first treatment (“1day”), and a significant changes in these other components probably reflects “ ” INFLAMMATION

day after the final treatment ( 14 day ) from the following four groups: IMMUNOLOGY AND robust feedback control at each of these steps and further sup- wild type with vehicle, wild type with rapamycin (3 mg·kg−1·d−1), knockout − − ports the concept that Pip4k2c regulates a step quite proximal to with vehicle, and knockout with rapamycin (3 mg·kg 1·d 1) [approximately mTORC1. These results indicate that mTORC1 signaling is four to eight mice (12–14 mo old) per group, daily i.p. injection for 2 wk]. − − γ highly activated in Pip4k2c / mice, which suggests that increased Data were normalized to the mean plasma level of IL-12(p40) and IFN in wild-type mice before therapy, with 1 on the y axis indicating the mean of mTORC1 signaling could explain the hyperactive immune system Pip4k2c−/− wild-type pretreatment (WT, vehicle, before): IL-12(p40): 46.1875 relative lu- in mice. minescence unit (RLU), IFNγ: 2.148 RLU. The results are presented as means ± SE of the means. Results for IL-2 and IL-12(p70) are shown in Fig. S1H.(D) Rapamycin Reduces mTORC1 Signaling and the Inflammatory Phenotypes Changes in immune cell infiltration after treatment with rapamycin. Mouse −/− in Pip4k2c Mice. We next examined whether rapamycin, the allo- livers were collected after the final treatment (daily i.p. injections for 2 wk) steric mTORC1 inhibitor, could reduce the inflammatory pheno- from the following groups: wild type with vehicle, wild type with rapa- − − −1 −1 type of Pip4k2c / mice. Pip4k2c wild-type and knockout mice mycin (3 mg·kg ·d ), knockout with vehicle, and knockout with rapa- · −1· −1 – were intraperitoneally injected with either vehicle or rapamycin mycin (3 mg kg d ), approximately four to eight mice (12 14 mo old) per · −1· −1 group. The area of immune infiltrates of H&E-stained liver tissues was (3 mg kg d ) once a day for 2 wk. Blood was withdrawn 2 wk quantified using ImageJ software. Five images per mouse were examined. before the treatment and 24 h after the first treatment. On the final The y axis indicates the ratio of the area of immune infiltrates over total day, blood, liver, and spleen were collected. Using protein lysates area of the tissue in each image. The results are presented as means ± SE of from the liver and spleen, we performed SDS/PAGE and Western the means. *P < 0.05.

Shim et al. PNAS | July 5, 2016 | vol. 113 | no. 27 | 7599 Downloaded by guest on September 30, 2021 − − significant effect on plasma IL-12(p40) in wild-type mice. IFNγ in Pip4k2c / mice. The simplest explanation for the observed −/− levels decreased somewhat in both wild-type and Pip4k2c autoimmunity is that the protein encoded by Pip4k2c (PI5P4Kγ) mice at 24 h after the first treatment with rapamycin. However, plays a role in suppressing the function of the related and much after 2 wk of treatment with rapamycin, IFNγ levels in both wild- more highly active enzymes PI5P4Kα and PI5P4Kβ when mTORC1 −/− type and Pip4k2c mice returned to the basal levels (the level signaling is too high and that this provides feedback suppression of before any treatment). On the other hand, IL-2 and IL-12(p70) mTORC1 signaling to maintain homeostasis in the T-cell pop- −/− levels did not significantly change in the Pip4k2c or wild-type ulation. However, because these studies are based on germline mice in response to rapamycin treatment (Fig. S1H). More deletion of Pip4k2c in all tissues, it is possible that non–T-cell strikingly, we found that the area of immune infiltrates in the autonomous events in other tissues contribute to the autoim- − − livers of rapamycin-treated Pip4k2c / mice was dramatically munity observed. This question is currently being addressed by decreased after 2 wk of rapamycin treatment (Fig. 4D). These generation of mice with T-cell–specific deletion of Pip4k2c. data collectively indicate that inhibition of mTORC1 by The biochemical mechanisms by which PI5P4Kγ might pro- rapamycin partially reduced the inflammatory phenotypes in vide feedback inhibition of mTORC1 signaling is not clear. The − − Pip4k2c / mice. fact that PI5P4Kγ has very low activity compared with PI5P4Kα and PI5P4Kβ but forms heterodimeric complexes with these Discussion active enzymes suggests that its major role is to regulate the − − Here we report the generation of Pip4k2c / mice and show that localization and/or activity of PI5P4Kα and PI5P4Kβ. As dis- − − −/− Pip4k2c / mice have hyperactivated immune systems. Pip4k2c cussed in the introduction, it was reported by Mackey et al. (6) mice were viable with a normal lifespan and did not show any that PI5P4Kγ is phosphorylated by mTORC1 on S324 and S328. specific abnormality until they were older than 8 mo. But among Interestingly, Mackey et al. (6) found that expression of a S324A/ − − the older mice at ages between 8 mo and 14 mo, Pip4k2c / mice S328A double-mutant form of PI5P4Kγ in HeLa cells enhanced displayed increased immune infiltrates in various tissues, including mTORC1 signaling, whereas expression of a phosphomimetic liver, intestine, kidney, and lungs. These infiltrating immune cells mutant (S324D/S328D) suppressed mTORC1 signaling. These were mostly T cells and B cells. Moreover, we found that plasma results are consistent with a model in which PI5P4Kγ can facil- −/− of Pip4k2c mice contained high levels of proinflammatory itate mTORC1 signaling (perhaps by recruiting the more active Th1-type cytokines such as IFNγ, IL-12, and IL-2. Importantly, enzymes, PI5P4Kα and/or PI5P4Kβ to lysosomes where mTORC1 − − the increase in Th cells and the decrease in Treg cells in Pip4k2c / is activated) and that phosphorylation of PI5P4Kγ at S324 and mice reflect the inflammatory phenotype of these mice. Further- S328 by mTORC1 provides a negative feedback loop to shut off + more, the increase in CD44 T-cell population (central memory mTORC1 signaling (perhaps by preventing recruitment of PI5P4Kα T cells) in these mice also supports the hyperactivation of their and PI5P4Kβ to lysosomes). According to this model, deletion of immune system. Interestingly, mTORC1 downstream compo- PI5P4Kγ might impair basal mTORC1 signaling, although PI5P4Kα −/− nents p70-S6K and SREBP1 were activated in Pip4k2c mouse and/or PI5P4Kβ homodimers or heterodimers could be capable of tissues. Because mTORC1 signaling directs the immune system localizing to lysosomes independent of PI5P4Kγ to maintain −/− by regulating diverse immune cell types, a possibility that other mTORC1 signaling in tissues from Pip4k2c mice. In any event, immune cells in addition to T cells contribute to the inflammatory in the absence of PI5P4Kγ the negative feedback control would phenotype of these mice would be interesting to investigate further. be eliminated, thereby explaining increased mTORC1 activity in −/− Moreover, after 2 wk of rapamycin treatment, the inflamma- multiple tissues of the Pip4k2c mice. tory phenotypes as well as the mTORC1 signaling that were With respect to the abilities of PI5P4Kγ, PI5P4Kα, and −/− enhanced in the Pip4k2c mice decreased. These results sug- PI5P4Kβ to heterodimerize with each other (17–20), the genetic −/− gested that increased activation of mTORC1 signaling in Pip4k2c interaction among PI5P4Kγ, PI5P4Kα, and PI5P4Kβ is particu- − − − − mice could be responsible for the chronic inflammation in larly thought provoking. Interestingly, Pip4k2a / Pip4k2b / −/− − − − − Pip4k2c mice. These results are in agreement with the cor- double KO mice (5) and Pip4k2b / Pip4k2c / double KO − − − − relation between the SNP (rs1678542) in the PIP4K2C locus mice (Fig. S3D) are not viable, whereas Pip4k2a / Pip4k2c / and familial autoimmunity in humans and suggest that the SNP mice are viable. Thus, mice that only have Pip4k2b are viable, may suppress expression of PI5P4Kγ protein. Our current but if this gene is deleted both Pip4k2a and Pip4k2c are critical model is that loss of PI5P4Kγ results in activation of mTORC1 for viability, indicating that these genes do not have redundant signaling and that this results in increased inflammation, par- functions and must both be expressed to replicate the function tially through up-regulation of Th cells. of Pip4k2b. The respective roles for PI5P4Kγ,PI5P4Kα,and − − Whereas high rheumatoid factor levels are often associated PI5P4Kβ are complex. Pip4k2b / mice exhibited enhanced with autoimmune diseases, they do not always correlate. We insulin sensitivity, smaller body size, and decreased adiposity on −/− − − measured the levels of rheumatoid factor from Pip4k2c mice a high-fat diet. In contrast, Pip4k2c / mice were not different and found that the levels of rheumatoid factor were not elevated from wild-type mice in these features (Fig. S1 A–E). In addition −/− in the case of Pip4k2c mice (Fig. S3B). In addition, the sizes of to the synthetic lethality for loss of Pip4k2a and Pip4k2b,and − − organs of Pip4k2c / mice were not different from wild-type forlossofPip4k2b and Pip4k2c, distinct phenotypes of each of − − − − − − − − mice. However, we found that Pip4k2c / mice older than 12 mo the Pip4k2a / , Pip4k2b / ,andPip4k2c / mice indicate that occasionally exhibit pale livers (Fig. S3C). So we analyzed liver each isoform has a unique role in vivo. function parameter proteins and metabolites using plasma from Of particular interest is the effect of the various knockouts on − − Pip4k2c / mice (Fig. S3A). There was an increase in aspartate signaling through the PI3K–Akt–mTORC1 pathway. Deletion of transaminase (AST) and a decrease in blood urea nitrogen Pip4k2b enhances Akt activation but, surprisingly, does not result (BUN), without a significant change in alanine transaminase in enhanced mTORC1 signaling (4, 5). Previous studies from (ALT) and other metabolites. These high AST and low BUN many laboratories have shown that impaired mTORC1 activa- − − results suggest liver damage in Pip4k2c / mice, the mechanism tion results in smaller cells and smaller mice (10, 21). Consistent of which would be intriguing to investigate further. with the failure of Pip4k2b deletion to link Akt activation to − − The mechanism by which the immune system is hyperactivated mTORC1 activation, the Pip4k2b / mice are smaller than wild- − − in Pip4k2c / mice has not yet been fully elucidated. Our studies type littermates. Although deletion of Pip4k2a results in no ob- suggest that mTORC1, which regulates the immune system in di- servable phenotypes, deletion of a single allele of Pip4k2a in the verse aspects, including modulating T-cell differentiation and ac- context of deletion of both alleles of Pip4k2b results in even tivation (12), is required to maintain the inflammatory phenotype smaller mice. These data indicate that Pip4k2a and PIP4k2b

7600 | www.pnas.org/cgi/doi/10.1073/pnas.1600934113 Shim et al. Downloaded by guest on September 30, 2021 suppress PI3K-Akt activation but facilitate mTORC1 activation. Preparation of Mouse Tissues for Immunohistochemistry. Tissues were re- This model is consistent with the observation that deletion of the moved from the killed mice and washed with PBS. The samples were fixed in single form of PIP4K2 in flies causes suppression of TORC1 10% (vol/vol) buffered formalin for 24 h and paraffin embedded. H&E activation and suppression of growth (7). To determine the staining was performed at the Rodent Histopathology Core at the Dana- epistasis among the multiple mammalian enzymes, phenotypes Farber/Harvard Cancer Center. Staining the immune infiltrates in liver tissue of the viable double knockout mice will need to be better was performed at the Laboratory of Comparative Pathology at Memorial examined. Sloan Kettering Cancer Center. The samples were microsectioned, depar- Finally, the results that we present here support the associa- affinized, rehydrated, and heated with a pressure cooker to 125 °C for 30 s in tion of a SNP in the PIP4K2C locus with autoimmunity, sug- citrate buffer for antigen retrieval and then incubated with peroxidase and protein blocking reagents, respectively, for 5 min. Sections were then in- gesting that PI5P4Kγ expression is probably low in autoimmune cubated with anti-CD3, anti-B220, and anti-Mac2 antibodies, respectively. patients with the SNP near the PIP4K2C locus. Our observation Pip4k2c−/− that treating mice with rapamycin reduced the in- Blood Collection from Mouse and Plasma Preparation. Mouse tails were cut flammatory phenotype by decreasing the activation of mTORC1 1 mm from the tip with scissors and blood was collected into prechilled 1.5 mL indicates that drugs that target mTORC1 signaling are likely to EDTA-coated Eppendorf tubes (Microvette CB300, Sarstedt). The samples be effective for patients with familial autoimmunity that corre- were centrifuged for 15 min at 825 × g at 4 °C. The supernatants were lates with the SNP (rs1678542) near the PIP4K2C locus. transferred to new Eppendorf tubes and passed through 0.22-μm filters (centrifuging for 1 min at 5,000 rpm at 4 °C). Methods −/− Generation of Pip4k2c Mice. Protocols approved by Beth Israel Deaconess Measurement of Plasma Cytokines. Mouse plasma was prepared as described Medical Center’s Institutional Animal Care and Use Committee and Weill above. Plasma cytokine levels were measured using multiplex cytokine assay ’ Cornell s Institutional Animal Care and Use Committee were used for the at Eve Technologies. To measure cytokines in our laboratory, the BD Bio- care and use of the mice in this research. Pip4k2c-targeted embryonic stem science ELISA kit for IL-12, IFNγ, and IL-2 (M1270, MIF00, and M2000, re- cell clones, BO1, BO2, and DO1, were obtained from the KOMP repository. spectively) was used according to the manufacturer’s protocol. These cells were grown in our laboratory and the conditional knockout allele of each clone was confirmed by genomic DNA PCR. The clones were then T-Cell Proliferation. Cells were grown in DMEM supplemented with 10% FCS, karyotyped and the normal clones BO1 and BO2 were selected and injected β-mercaptoethanol, l-glutamine, gentamicin sulfate, and penicillin/strepto- into blastocysts at the Beth Israel Deaconess Transgenic Facility. Three chi- mycin. For the thymidine proliferation assay, 5 × 105 cells per milliliter purified meric male mice were obtained and each was backcrossed with C57BL/6J + mice. Cassette-bearing mice were mated to Rosa-eFLP1 mice to remove the naïve CD4 T cells were cultured for 48 h in flat-bottom 96-well plates in the – μ lacZ reporter. The critical exons 3 and 4 were removed by mating the lacZ presence of various concentrations of anti-CD3 antibody (range, 0.1 10 g/mL). 3 reporter-deleted mice to germline cytomegalovirus (CMV)-Cre deleter mice. Cells were pulsed with 1 μCi H thymidine for another 16 h of incubation. Knockout mice were verified by PCR and Western blotting. Mean thymidine incorporation in triplicate wells was measured using a β-counter (LS 5000; Beckman Coulter). PCR Genotyping. For genotyping, the four primers below were used to amplify regions of genomic DNA present in either wild-type samples or knockout Rapamycin Treatment of the Mice. For rapamycin treatment, stock solutions samples: (50 mg/mL) were diluted into vehicle [5% (vol/vol) Tween-80, 5% (vol/vol) PEG 400 (polyethylene glycol, molecular weight 400)] in 1× PBS for 2 wk pwtF: TGTCCCCAGGTCTTCAGGAACCT (3 mg·kg−1·d−1) treatments through i.p. injections. Mice were killed after pwtR: TGCCTTCAGTTTCGCTTGGGGG 2wkoftreatment. pkoF: CACACCTCCCCCTGAACCTGAAAC ACKNOWLEDGMENTS. We thank Gina DeNicola, Florian Kerrath, and other pkoR: AGCCGCTGGGGCCAGATGAT. members of the L.C.C. laboratory for helpful discussions. L.C.C. is supported by NIH Grants R01 GM041890 and P01 CA120964. C.W. is supported by The primer pair pwtF/pwtR amplifies a fragment (∼0.5 kb) in wild type and National Multiple Sclerosis Society Career Transition Award TA 3059-A-2 and the primer pair pkoF/pkoR amplifies a fragment (∼0.5 kb) in knockout. R00 NIH Pathway to Independence Award 4R00AL110649-02.

1. Clarke JH, Emson PC, Irvine RF (2008) Localization of phosphatidylinositol phosphate 11. Saunders RN, Metcalfe MS, Nicholson ML (2001) Rapamycin in transplantation: A kinase IIgamma in kidney to a membrane trafficking compartment within specialized review of the evidence. Kidney Int 59(1):3–16. cells of the nephron. Am J Physiol Renal Physiol 295(5):F1422–F1430. 12. Delgoffe GM, et al. (2011) The kinase mTOR regulates the differentiation of helper T 2. Ciruela A, Hinchliffe KA, Divecha N, Irvine RF (2000) Nuclear targeting of the beta cells through the selective activation of signaling by mTORC1 and mTORC2. Nat isoform of type II phosphatidylinositol phosphate kinase (phosphatidylinositol 5- Immunol 12(4):295–303. phosphate 4-kinase) by its alpha-helix 7. Biochem J 346(Pt 3):587–591. 13. Delgoffe GM, et al. (2009) The mTOR kinase differentially regulates effector and – 3. Clarke JH, Emson PC, Irvine RF (2009) Distribution and neuronal expression of phos- regulatory T cell lineage commitment. Immunity 30(6):832 844. phatidylinositol phosphate kinase IIgamma in the mouse brain. J Comp Neurol 517(3): 14. Zheng Y, et al. (2009) Regulatory T-cell suppressor program co-opts transcription – – factor IRF4 to control T(H)2 responses. Nature 458(7236):351 356. 296 312. INFLAMMATION

4. Lamia KA, et al. (2004) Increased insulin sensitivity and reduced adiposity in phos- 15. Mitsdoerffer M, et al. (2010) Proinflammatory T helper type 17 cells are effective B- IMMUNOLOGY AND cell helpers. Proc Natl Acad Sci USA 107(32):14292–14297. phatidylinositol 5-phosphate 4-kinase beta-/- mice. Mol Cell Biol 24(11):5080–5087. 16. Düvel K, et al. (2010) Activation of a metabolic gene regulatory network downstream 5. Emerling BM, et al. (2013) Depletion of a putatively druggable class of phosphati- of mTOR complex 1. Mol Cell 39(2):171–183. dylinositol kinases inhibits growth of p53-null tumors. Cell 155(4):844–857. 17. Bultsma Y, Keune WJ, Divecha N (2010) PIP4Kbeta interacts with and modulates 6. Mackey AM, Sarkes DA, Bettencourt I, Asara JM, Rameh LE (2014) PIP4kγ is a substrate nuclear localization of the high-activity PtdIns5P-4-kinase isoform PIP4Kalpha. for mTORC1 that maintains basal mTORC1 signaling during starvation. Sci Signal Biochem J 430(2):223–235. 7(350):ra104. 18. Rao VD, Misra S, Boronenkov IV, Anderson RA, Hurley JH (1998) Structure of type 7. Gupta A, et al. (2013) Phosphatidylinositol 5-phosphate 4-kinase (PIP4K) regulates IIbeta phosphatidylinositol phosphate kinase: A protein kinase fold flattened for in- TOR signaling and cell growth during Drosophila development. Proc Natl Acad Sci terfacial phosphorylation. Cell 94(6):829–839. – USA 110(15):5963 5968. 19. Burden LM, et al. (1999) The flattened face of type II beta phosphatidylinositol 8. Raychaudhuri S, et al. (2008) Common variants at CD40 and other loci confer risk of phosphate kinase binds acidic phospholipid membranes. Biochemistry 38(46): rheumatoid arthritis. Nat Genet 40(10):1216–1223. 15141–15149. 9. Fung EY, et al. (2009) Analysis of 17 autoimmune disease-associated variants in type 1 20. Wang M, et al. (2010) Genomic tagging reveals a random association of endogenous diabetes identifies 6q23/TNFAIP3 as a susceptibility locus. Genes Immun 10(2): PtdIns5P 4-kinases IIalpha and IIbeta and a partial nuclear localization of the IIalpha 188–191. isoform. Biochem J 430(2):215–221. 10. Laplante M, Sabatini DM (2013) Regulation of mTORC1 and its impact on gene ex- 21. Shima H, et al. (1998) Disruption of the p70(s6k)/p85(s6k) gene reveals a small mouse pression at a glance. J Cell Sci 126(Pt 8):1713–1719. phenotype and a new functional S6 kinase. EMBO J 17(22):6649–6659.

Shim et al. PNAS | July 5, 2016 | vol. 113 | no. 27 | 7601 Downloaded by guest on September 30, 2021