DOCSLIB.ORG

Nuclear Ribosomal DNA Evidence for a Western North American Origin of Hawaiian and South American Species of Sanicula (Apiaceae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Nuclear Ribosomal DNA Evidence for a Western North American Origin of Hawaiian and South American Species of Sanicula (Apiaceae) Proc. Natl. Acad. Sci. USA Vol. 95, pp. 235–240, January 1998 Evolution Nuclear ribosomal DNA evidence for a western North American origin of Hawaiian and South American species of Sanicula (Apiaceae) PABLO VARGAS†,BRUCE G. BALDWIN‡, AND LINCOLN CONSTANCE Jepson Herbarium and Department of Integrative Biology, University of California, Berkeley, CA 94720-2465 Communicated by Peter H. Raven, Missouri Botanical Garden, St. Louis, MO, November 7, 1997 (received for review July 17, 1997) ABSTRACT Results from phylogenetic analysis of nu- Raillardiopsis) ancestry of the Hawaiian silversword alliance clear rDNA internal transcribed spacer (ITS) sequences from (Argyroxiphium, Dubautia, Wilkesia) provides one unequivocal a worldwide sample of Sanicula indicate that Hawaiian example of such dispersal in the sunflower family (4–6). In this sanicles (Sanicula sect. Sandwicenses) constitute a monophy- paper, we provide phylogenetic evidence from nuclear ribo- letic group that descended from a western North American somal DNA internal transcribed spacer (ITS) sequences for ancestor in Sanicula sect. Sanicoria, a paraphyletic assemblage another example of angiosperm dispersal from the Pacific of mostly Californian species. A monophyletic group compris- coast of temperate western North America to the Hawaiian ing representatives of all 15 species of S. sect. Sanicoria and the Islands involving Sanicula (Apiaceae). In addition, we show three sampled species of S. sect. Sandwicenses was resolved in evidence for two amphitropical dispersals of sanicles from all maximally parsimonious trees, rooted with sequences from temperate western North America to southern South America. species of Astrantia and Eryngium. All sequences sampled from eastern North American, European, and Asian species of MATERIALS AND METHODS Sanicula fell outside the ITS clade comprising S. sect. Sani- coria and S. sect. Sandwicenses. A lineage comprising the We examined DNAs from one to six populations of 23 species Hawaiian taxa and three species endemic to coastal or near- representing all 15 taxa in the western American Sanicula sect. coastal habitats in western North America (Sanicula arcto- Sanicoria, three of four species in the Hawaiian Sanicula sect. poides, Sanicula arguta, and Sanicula laciniata) is diagnosed by Sandwicenses (Sanicula kauaiensis may be extinct), two of six nucleotide substitutions and a 24-bp deletion in ITS2. The species from the Asian Sanicula sect. Pseudopetagnia, and hooked fruits in Sanicula lead us to conclude that the ancestor three of 13 species from the cosmopolitan Sanicula sect. of Hawaiian sanicles arrived from North America by external Sanicla (for taxonomy of Sanicula see refs. 7–10). The only bird dispersal; similar transport has been hypothesized for the section not examined was the Asian Sanicula sect. Tubercula- North American tarweed ancestor of the Hawaiian silversword tae, comprising three species (unavailable to us) regarded by alliance (Asteraceae). Two additional long-distance dispersal Shan and Constance (7) as having ‘‘diverged least from the events involving members of S. sect. Sanicoria can be con- assumed progenitors...ofthegenus.’’ Sampling encompassed cluded from the ITS phylogeny: dispersal of Sanicula crassi- the main continental distribution of the genus (Asia, Europe, caulis and Sanicula graveolens from western North America to North America, and South America) and included a Malaysian southern South America. sample of the only species known from Africa. Populations were sampled widely across the distribution of species repre- The volcanic history, extreme geographic isolation, and dis- sented by multiple DNAs (Table 1). Three species outside harmonic biota of the Hawaiian archipelago demonstrate that Sanicula in subfamily Saniculoideae (Astrantia major, Eryn- terrestrial life in the islands must have arrived by long-distance gium cervantesii, and Eryngium mexicanum) were chosen as dispersal (1). Among plants, the approximately 966 species of outgroups based on morphological and molecular evidence of indigenous Hawaiian angiosperms (89% endemic) have been close relationship to the ingroup (see ref. 11). estimated to stem from 272 to 282 natural introductions to the Total DNAs were extracted from pooled fresh leaf tissue of islands (2). On the basis of comparative floristics, Fosberg (3) 5–10 individuals per population or from dried leaf fragments hypothesized that most natural introductions of Hawaiian of herbarium specimens by using a modification of the hexa- flowering plants were from southeast Asian source areas. decyltrimethylammonium bromide (CTAB) method in Doyle and Doyle (12), with two ethanol precipitations. The 18S–26S Directionality of prevailing air currents, occurrence of inter- nuclear rDNA ITS region (ITS1, 5.8S subunit, and ITS2) was mediary ‘‘stepping-stone’’ islands, and climatic similarities PCR-amplified by using c28kj (59-TTGGACGGAATTTAC- between the Hawaiian archipelago and tropical areas to the CGCCCG-39, designed by K. W. Cullings, San Francisco State west and southwest of the islands accord with Fosberg’s University) and LEU1 (59-GTCCACTGAACCTTATCATT- estimate. TAG-39, designed by L. E. Urbatsch, Louisiana State Univer- A minority (about 18%) of ancestral Hawaiian plant colo- sity) for most samples. The internal primers ITS2, ITS3, ITS4, nists are thought to have dispersed from the Americas (3), and ITS5 (13) were used for sequencing reactions and for PCR despite unfavorable prevailing winds and water currents. Plant dispersal across the unbroken 3,900-km oceanic barrier be- tween temperate western North America and the Hawaiian Abbreviations: ITS, internal transcribed spacer of 18S–26S nuclear Islands appears to have been exceedingly rare. Molecular ribosomal DNA; Ma, million years ago. y Data deposition: The sequences reported in this paper have been phylogenetic evidence of a California tarweed (Madia deposited in the GenBank database (accession nos. AF031960– AF032016). † The publication costs of this article were defrayed in part by page charge Permanent address: Real Jardı´n Bota´nico, Plaza de Murillo, 2, 28014-Madrid, Spain. payment. This article must therefore be hereby marked ‘‘advertisement’’ in ‡To whom reprint requests should be addressed at: Jepson Herbarium accordance with 18 U.S.C. §1734 solely to indicate this fact. and Dept. of Integrative Biology, 1001 Valley Life Sciences Building, © 1998 by The National Academy of Sciences 0027-8424y98y95235-6$2.00y0 no. 2465, University of California, Berkeley, CA 94720-2465. e-mail: PNAS is available online at http:yywww.pnas.org. [email protected]. 235 236 Evolution: Vargas et al. Proc. Natl. Acad. Sci. USA 95 (1998) Table 1. Matrix of informative nucleotide sites and insertionsydeletions (indels) from the nuclear rDNA ITS region in Sanicula and outgroups 1111111111111111111111111111 1123344555555566666777788899990011122222233333456667778888 57824727123578912579567804734893726901235901459353464781346 1 TAGGCCCCCGACATCGGGCCCCACACGGCTCGGACTCAACGGACCTCGCATGCAATCTG 2 TAGGCCACCGACGTCGGGCCCCACCTGGCTCGGCCTCAACGGCACTCGCATGCAATTTG 3 TTAGCCACGGACATTGGTCCCCCAGAGGCGCGGCTTCRATTACCACCGCATGTCACTGC 4 TTAGACACCGACGTCGGGCCCCGTTTGATCGGGCTCCGCTACAATTTATATGCCATCCT 5 TTAGACACCGACGTCGGGCTCCGTT-GACCGGGTTCCGCTACAATTTGTATGCTATCCT 6 TTAGACACCGACGTCGGGCCCTGTTCGACCGGGCTCCGCTACAACTTGTATGCCATCCT 7 TTAGATACCGACGTCGGGCCCCATTCGATCAGGCTCCGCTACAATTTGTATGCCATCCT 8 TTAGACACCGATGTCGTGCCCCGTTCGACCGGGCTCCGCTACAATTTGTATGCTATCCT 9 ATAGAAATCGACGTCGGGTTCCGTGCGATCGGGATCCGCTACAATTTATATGCCATCCT 10 ATAGAAATCGACGTCGGGTTCCGTGCGATCGGGATCCGCTACAATTTATATGCCATCCT 11 ATAGAAATCGACGTCGGGTTCCGTGCAATCGGGATCCGCTACAATTTATATGCCATCCT 12 TTAGAAATCAACGTCTGGTCCTGTTCAACCGGGCTCCGCTACAATTTATATGCCATCCT 13 TTAGAGGCCGACGTCGGGTCCCGTTCAACCGGA--CCGCTACAATTTATATGCCATCCT 14 TAAGAA-CCGACGCAGTGTCTCGTTCGACCGGGCTCTTCTACAATTTGTTTTCCATTCT 15 TTAGAAATCGACGTCGGGTCCCGTTCGACCGGGCTCCGCTACAATTTATATGCCATCCT 16 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 17 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 18 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 19 TTAAAATCCGACGTCGGGTCCTGTTCGACCGGCCTCCGCTACAATTTATACGCCACCCT 20 TAAGAGATCGACGTAGTGTCCCGTTCGACCGAGCTCTGCTACAATTCGTTTTTCATT-T 21 TTAGAGACGCCCGTCGTGTCCTGTTCGATCGGTTTCCGCTACAACATGTTTGCTGTACT 22 TTAGAGACGCCCGTCGTGTCCTGTTCGACCGGTTTCCGCTACAACATGTTTGCTGTACT 23 TTAGAGACGCCCGTCATGTCCTGTTTGATCGGTCTCCGCTACAACATGTTTGCTGTACT 24 TAAGAAACCAACGTAGTTTCCCGTTCGACCGGGCTCTGCTACCATTTGTTTTCCATTCT 25 TTAGAGGCCGACGTCGGGTCCYGTACGACCGGGCTCCGCTACAATTTATATGCCATCCT 26 TAAGAA-CCGACGCAGTGTCTCGTTCGACCGGGCTCTTCTACAATTTGTTTTCCATTCT 27 TTAGAGACGCCTGTCATGTCCTGTTCGACCGGTCTCCGCTACAACATGTTTGCTGTACT 28 TTAGAGACGCCCGTCATGTCCTGTTCGACCGGTCTCCGCTACAACATGTTTGTTGTACT 29 TTAGAGACGCCCGTCATGTCCTGTTTGACCGGTCTCCGCT-CAACATGTTTGCTGTACT 30 TAAGAAACCGACATAGTGTCCCGTTCGACCGAACTCTGCTACAATTCGTTTTTCATTCT 31 TAAGAAACCGAMGTAGTGTCCYGTTCGACCGGGCTCTTCTACAATTTGTTTTTCATTCT 22223333333444444444444444444444444444444444444444455555555 00024689999000111111222222233333345566666677788889900134555 25609283789479146789012567801236950303678902306788949265237 1 TCGGGGGGCGC-CCCACTCCTGGTGGTCGTCACGAGGCCGCAGGCCCGCACGTCGGCGC 2 TCGGGGGGCGCCCCCACTCCTTGTGCTCGTCATGAGGCCGCGGGCCCGCACGTCGGCGC 3 CTGGGCGGCGCAACTTTCCACTTGGCTTGCGCGGTGGATGCATGCCAGCACGTCGAC-- 4 TCGGGGGGCGC-ACTATCCTTCCGACTCGCATTGAGGTTGTGGATCAACGTTTTGGCGC 5 CTGGGGGGCGC-ACCATCCTTGCGATTCGCATGGAGGCTGTGGATCAACGTTTCGGCGC 6 CCGGGGGGCGC-ACCATCCTCAGGACTCGCATGGAGGCTGTGGATCAACGTTTCGACGC 7 CCAGAGGGCGC-ACCTTCCTTACGATTCGCATGGAGGCTGTGGATCAACGTTTCGGTGT
Load more

Recommended publications
  • Vascular Plants at Fort Ross State Historic Park
    19005 Coast Highway One, Jenner, CA 95450 ■ 707.847.3437 ■ [email protected] ■ www.fortross.org Title: Vascular Plants at Fort Ross State Historic Park Author(s): Dorothy Scherer Published by: California Native Plant Society i Source: Fort Ross Conservancy Library URL: www.fortross.org Fort Ross Conservancy (FRC) asks that you acknowledge FRC as the source of the content; if you use material from FRC online, we request that you link directly to the URL provided. If you use the content offline, we ask that you credit the source as follows: “Courtesy of Fort Ross Conservancy, www.fortross.org.” Fort Ross Conservancy, a 501(c)(3) and California State Park cooperating association, connects people to the history and beauty of Fort Ross and Salt Point State Parks. © Fort Ross Conservancy, 19005 Coast Highway One, Jenner, CA 95450, 707-847-3437 .~ ) VASCULAR PLANTS of FORT ROSS STATE HISTORIC PARK SONOMA COUNTY A PLANT COMMUNITIES PROJECT DOROTHY KING YOUNG CHAPTER CALIFORNIA NATIVE PLANT SOCIETY DOROTHY SCHERER, CHAIRPERSON DECEMBER 30, 1999 ) Vascular Plants of Fort Ross State Historic Park August 18, 2000 Family Botanical Name Common Name Plant Habitat Listed/ Community Comments Ferns & Fern Allies: Azollaceae/Mosquito Fern Azo/la filiculoides Mosquito Fern wp Blechnaceae/Deer Fern Blechnum spicant Deer Fern RV mp,sp Woodwardia fimbriata Giant Chain Fern RV wp Oennstaedtiaceae/Bracken Fern Pleridium aquilinum var. pubescens Bracken, Brake CG,CC,CF mh T Oryopteridaceae/Wood Fern Athyrium filix-femina var. cyclosorum Western lady Fern RV sp,wp Dryopteris arguta Coastal Wood Fern OS op,st Dryopteris expansa Spreading Wood Fern RV sp,wp Polystichum munitum Western Sword Fern CF mh,mp Equisetaceae/Horsetail Equisetum arvense Common Horsetail RV ds,mp Equisetum hyemale ssp.affine Common Scouring Rush RV mp,sg Equisetum laevigatum Smooth Scouring Rush mp,sg Equisetum telmateia ssp.
    [Show full text]
  • EV Fr YOI4,NO2 ,/ / Wtnrer 1Se1 1!Ews[Etter The,Vlonld.No' 9.'L Q'tlue 9Lcnt Soci,St
    --.--t-, l@lseya uniflora eI\EV fr YOI4,NO2 ,/ / wtNrER 1se1 1!ews[etter the,Vlonld.no' 9.'l q'tlue 9Lcnt Soci,st SULPHUR CINQUEFOIL - AN INTHODUCED WEED TO EQUAL KNAPWEED AND SPURGE BY 2A2O? - Peter M Rice Suffur cinquetoil (Potentillarecfa L.) is native to Eurasia, management of this plant. Werner and Soule (1972) have an origin similar to spotted knapweed and leafy spurge. compiled most of the scattered information on sulfur Sulfur cinquefoil had become a well established weed by cinquefoil, but most of these observations were made the 1950s in eastern Canada, the northeast United States under the moist climatic conditions of eastern North and the Great Lakes region, and scanered populations America. had been recorded in southern British Columbia. The first confirmed Montana collections in the herbaria at Montana A rough description of the niche of this plant can be state university and the university of Montana were made composed from the published information and casual in 1962 (Missoula County) and 1965 (Lake County). A observations made in Montana Sulfur cinquefoil can recent re-examination of the collection of cinquefoils at the establish in open grasslands, shrubby areas and forest University of Montana herbarium resulted in designating an margins, but not under dense forest canopies. Roadsides, unidentified specimen collected in 1956 as a sulfur waste places and abandoned fields are particularly cinquefoil. This panicular plant was collected in a field susceptible. lt is most successful on coarse-textured soils adiacent to the Missoula Counry Fairgrounds, a typical and dry sites at low and mid elevations, and moderately locale for a possible first state record of an introduced moist sites at low elevations.
    [Show full text]
  • Rinconada Checklist-02Jun19
    Checklist1 of Vascular Flora of Rinconada Mine and Rinconada Trail San Luis Obispo County, California (2 June 2019) David J. Keil Robert F. Hoover Herbarium Biological Sciences Department California Polytechnic State University San Luis Obispo, California Scientific Name Common Name Family Rare n ❀ Achyrachaena mollis blow wives ASTERACEAE o n ❀ Acmispon americanus var. americanus Spanish-clover FABACEAE o n Acmispon brachycarpus shortpod deervetch FABACEAE v n ❀ Acmispon glaber var. glaber common deerweed FABACEAE o n Acmispon parviflorus miniature deervetch FABACEAE o n ❀ Acmispon strigosus strigose deer-vetch FABACEAE o 1 Please notify the author of additions or corrections to this list ([email protected]). ❀ — See Wildflowers of San Luis Obispo, California, second edition (2018) for photograph. Most are illustrated in the first edition as well; old names for some species in square brackets. n — California native i — exotic species, introduced to California, naturalized or waif. v — documented by one or more specimens (Consortium of California Herbaria record; specimen in OBI; or collection that has not yet been accessioned) o — observed during field surveys; no voucher specimen known Rare—California Rare Plant Rank Scientific Name Common Name Family Rare n Acmispon wrangelianus California deervetch FABACEAE v n ❀ Acourtia microcephala sacapelote ASTERACEAE o n ❀ Adelinia grandis Pacific hound's tongue BORAGINACEAE v n ❀ Adenostoma fasciculatum var. chamise ROSACEAE o fasciculatum n Adiantum jordanii California maidenhair fern PTERIDACEAE o n Agastache urticifolia nettle-leaved horsemint LAMIACEAE v n ❀ Agoseris grandiflora var. grandiflora large-flowered mountain-dandelion ASTERACEAE v n Agoseris heterophylla var. cryptopleura annual mountain-dandelion ASTERACEAE v n Agoseris heterophylla var. heterophylla annual mountain-dandelion ASTERACEAE o i Aira caryophyllea silver hairgrass POACEAE o n Allium fimbriatum var.
    [Show full text]
  • Plant List for Web Page
    Stanford Working Plant List 1/15/08 Common name Botanical name Family origin big-leaf maple Acer macrophyllum Aceraceae native box elder Acer negundo var. californicum Aceraceae native common water plantain Alisma plantago-aquatica Alismataceae native upright burhead Echinodorus berteroi Alismataceae native prostrate amaranth Amaranthus blitoides Amaranthaceae native California amaranth Amaranthus californicus Amaranthaceae native Powell's amaranth Amaranthus powellii Amaranthaceae native western poison oak Toxicodendron diversilobum Anacardiaceae native wood angelica Angelica tomentosa Apiaceae native wild celery Apiastrum angustifolium Apiaceae native cutleaf water parsnip Berula erecta Apiaceae native bowlesia Bowlesia incana Apiaceae native rattlesnake weed Daucus pusillus Apiaceae native Jepson's eryngo Eryngium aristulatum var. aristulatum Apiaceae native coyote thistle Eryngium vaseyi Apiaceae native cow parsnip Heracleum lanatum Apiaceae native floating marsh pennywort Hydrocotyle ranunculoides Apiaceae native caraway-leaved lomatium Lomatium caruifolium var. caruifolium Apiaceae native woolly-fruited lomatium Lomatium dasycarpum dasycarpum Apiaceae native large-fruited lomatium Lomatium macrocarpum Apiaceae native common lomatium Lomatium utriculatum Apiaceae native Pacific oenanthe Oenanthe sarmentosa Apiaceae native 1 Stanford Working Plant List 1/15/08 wood sweet cicely Osmorhiza berteroi Apiaceae native mountain sweet cicely Osmorhiza chilensis Apiaceae native Gairdner's yampah (List 4) Perideridia gairdneri gairdneri Apiaceae
    [Show full text]
  • 2004 Vegetation Classification and Mapping of Peoria Wildlife Area
    Vegetation classification and mapping of Peoria Wildlife Area, South of New Melones Lake, Tuolumne County, California By Julie M. Evens, Sau San, and Jeanne Taylor Of California Native Plant Society 2707 K Street, Suite 1 Sacramento, CA 95816 In Collaboration with John Menke Of Aerial Information Systems 112 First Street Redlands, CA 92373 November 2004 Table of Contents Introduction.................................................................................................................................................... 1 Vegetation Classification Methods................................................................................................................ 1 Study Area ................................................................................................................................................. 1 Figure 1. Survey area including Peoria Wildlife Area and Table Mountain .................................................. 2 Sampling ................................................................................................................................................ 3 Figure 2. Locations of the field surveys. ....................................................................................................... 4 Existing Literature Review ......................................................................................................................... 5 Cluster Analyses for Vegetation Classification .........................................................................................
    [Show full text]
  • Wild Plants of Ohlone Regional Wilderness Common Name Version
    Wild Plants of Ohlone Regional Wilderness Common Name Version A Photographic Guide Sorted by Form, Color and Family with Habitat Descriptions and Identification Notes Photographs and text by Wilde Legard District Botanist, East Bay Regional Park District New Revised and Expanded Edition - Includes the latest scientific names, habitat descriptions and identification notes Decimal Inches .1 .2 .3 .4 .5 .6 .7 .8 .9 1 .5 2 .5 3 .5 4 .5 5 .5 6 .5 7 .5 8 .5 9 1/8 1/4 1/2 3/4 1 1/2 2 1/2 3 1/2 4 1/2 5 1/2 6 1/2 7 1/2 8 1/2 9 English Inches Notes: A Photographic Guide to the Wild Plants of Ohlone Regional Wilderness More than 2,000 species of native and naturalized plants grow wild in the San Francisco Bay Area. Most are very difficult to identify without the help of good illustrations. This is designed to be a simple, color photo guide to help you identify some of these plants. This guide is published electronically in Adobe Acrobat® format so that it can easily be updated as additional photographs become available. You have permission to freely download, distribute and print this guide for individual use. Photographs are © 2014 Wilde Legard, all rights reserved. In this guide, the included plants are sorted first by form (Ferns & Fern-like, Grasses & Grass-like, Herbaceous, Woody), then by most common flower color, and finally by similar looking flowers (grouped by genus within each family). Each photograph has the following information, separated by '-': COMMON NAME According to The Jepson Manual: Vascular Plants of California, Second Edition (JM2) and other references (not standardized).
    [Show full text]
  • Classification of the Vegetation Alliances and Associations of Sonoma County, California
    Classification of the Vegetation Alliances and Associations of Sonoma County, California Volume 1 of 2 – Introduction, Methods, and Results Prepared by: California Department of Fish and Wildlife Vegetation Classification and Mapping Program California Native Plant Society Vegetation Program For: The Sonoma County Agricultural Preservation and Open Space District The Sonoma County Water Agency Authors: Anne Klein, Todd Keeler-Wolf, and Julie Evens December 2015 ABSTRACT This report describes 118 alliances and 212 associations that are found in Sonoma County, California, comprising the most comprehensive local vegetation classification to date. The vegetation types were defined using a standardized classification approach consistent with the Survey of California Vegetation (SCV) and the United States National Vegetation Classification (USNVC) system. This floristic classification is the basis for an integrated, countywide vegetation map that the Sonoma County Vegetation Mapping and Lidar Program expects to complete in 2017. Ecologists with the California Department of Fish and Wildlife and the California Native Plant Society analyzed species data from 1149 field surveys collected in Sonoma County between 2001 and 2014. The data include 851 surveys collected in 2013 and 2014 through funding provided specifically for this classification effort. An additional 283 surveys that were conducted in adjacent counties are included in the analysis to provide a broader, regional understanding. A total of 34 tree-overstory, 28 shrubland, and 56 herbaceous alliances are described, with 69 tree-overstory, 51 shrubland, and 92 herbaceous associations. This report is divided into two volumes. Volume 1 (this volume) is composed of the project introduction, methods, and results. It includes a floristic key to all vegetation types, a table showing the full local classification nested within the USNVC hierarchy, and a crosswalk showing the relationship between this and other classification systems.
    [Show full text]
  • Vegetation Classification, Descriptions, and Mapping of The
    Vegetation Classification, Descriptions, and Mapping of the Clear Creek Management Area, Joaquin Ridge, Monocline Ridge, and Environs in San Benito and Western Fresno Counties, California Prepared By California Native Plant Society And California Department of Fish and Game Final Report Project funded by Funding Source: Resource Assessment Program California Department of Fish and Game And Funding Source: Resources Legacy Fund Foundation Grant Project Name: Central Coast Mapping Grant #: 2004-0173 February 2006 Vegetation Classification, Descriptions, and Mapping of the Clear Creek Management Area, Joaquin Ridge, Monocline Ridge, and Environs in San Benito and Western Fresno Counties, California Final Report February 2006 Principal Investigators: California Native Plant Society staff: Julie Evens, Senior Vegetation Ecologist Anne Klein, Vegetation Ecologist Jeanne Taylor, Vegetation Assistant California Department of Fish and Game staff: Todd Keeler-Wolf, Ph.D., Senior Vegetation Ecologist Diana Hickson, Senior Biologist (Botany) Addresses: California Native Plant Society 2707 K Street, Suite 1 Sacramento, CA 95816 California Department of Fish and Game Biogeographic Data Branch 1807 13th Street, Suite 202 Sacramento, CA 95814 Reviewers: Bureau of Land Management: Julie Anne Delgado, Botanist California State University: John Sawyer, Professor Emeritus TABLE OF CONTENTS ABSTRACT ................................................................................................................................................. 1 BACKGROUND...........................................................................................................................................
    [Show full text]
  • 3-Web RV Plant List
    Wild Plants of Round Valley Regional Park Grouped by Growth Form Alphabetical by Scientific Name September 5, 2003 Wild Plants of Round Valley Regional Park Grouped by Growth Form Alphabetical by Scientific Name This document contains a comprehensive list of the wild plants reported to be found in Round Valley Regional Park. The plants are grouped according to their growth form for easy accessibility. These four groups are: Ferns & Horsetails, Grasses & Grasslike, Herbaceous, and Woody. The plants within each group are listed alphabetically by scientific name. Other information on each plant includes the common name, family, whether the plant is native or introduced, and its longevity. For quick reference, the upper left corner of each page displays both the group name (based on growth form) and the genus of the first scientific name. The abbreviations used: Checklist column for marking off the plants you observe Scientific Name According to The Jepson Manual: Higher Plants of California, 1993 Common Name According to Jepson and other references (highly variable) Family The scientific plant family name according to Jepson L Longevity: Annual (a), Biennial (b), Perennial (p), or a combination N/I Native (n) or Introduced (i) according to Jepson The listing of plants included in this document is by no means complete. The intent is to maintain an ongoing inventory to which additional plants can be added over time. Readers are encouraged to report any corrections or additions to this list by emailing the District Botanist (Wilde Legard, [email protected]). This welcomed assistance will help facilitate improved management of the Park District’s natural resources.
    [Show full text]
  • A Sensitive Plant and Wildlife Resource Inventory of Diablo Canyon Lands, Volume Ii
    A SENSITIVE PLANT AND.WILDLIFE RESOURCE INVENTORY OF DIABLO CANYON LANDS, VOLUME I: SURVEY PROCEDURES AND A SUMMARY OF SURVEY RESULTS Prepared by: BioSystems Analysis, Inc. 303 Potrero Street, Suite 29-101 Santa Cruz, California 95060 and Pacific Gas and Electric Company Technical and Ecological Services 3400 Crow Canyon Road San Ramon, California 94583 Prepared for: Pacific Gas and Electric Company Diablo Canyon Land Stewardship Committee Diablo Canyon Power Plant Avila Beach, California © 1995 by PG&E (Revised 1996) Legal Notice Pacific Gas and Electric Company (PG&E) makes no warranty or representation, expressed or implied, with respect to the accuracy, completeness, or usefulness of the information contained in this report, or that the use of any information, apparatus, method, or process disclosed in this report may not infringe upon privately owned rights. Nor does PG&E assume any liability with respect to use of, or damages resulting from the use of, any information, apparatus, method, or process disclosed in this report. © 1995 by PG&E All rights reserved EXECUTIVE SUMMARY PG&E owns or controls through long-term lease agreements approximately 10,000 acres of ecologically diverse coastal lands surrounding Diablo Canyon Power Plant in San Luis Obispo County, California. Beginning in 1992, a comprehensive survey of these lands was undertaken to identify and describe all sensitive plant and wildlife resources not previously known that might occur there. Though not required by state or federal regulatory agencies, this voluntary effort is consistent with PG&E's Corporate Policy on Management of Company Real Property (Section 7, paragraphs a and d), as well as specific Best Management Practices identified by the Diablo Canyon Land Stewardship Program (PG&E 1993a).
    [Show full text]
  • Nuclear Ribosomal DNA Evidence for a Western North American Origin of Hawaiian and South American Species of Sanicula (Apiaceae)
    Proc. Natl. Acad. Sci. USA Vol. 95, pp. 235–240, January 1998 Evolution Nuclear ribosomal DNA evidence for a western North American origin of Hawaiian and South American species of Sanicula (Apiaceae) PABLO VARGAS†,BRUCE G. BALDWIN‡, AND LINCOLN CONSTANCE Jepson Herbarium and Department of Integrative Biology, University of California, Berkeley, CA 94720-2465 Communicated by Peter H. Raven, Missouri Botanical Garden, St. Louis, MO, November 7, 1997 (received for review July 17, 1997) ABSTRACT Results from phylogenetic analysis of nu- Raillardiopsis) ancestry of the Hawaiian silversword alliance clear rDNA internal transcribed spacer (ITS) sequences from (Argyroxiphium, Dubautia, Wilkesia) provides one unequivocal a worldwide sample of Sanicula indicate that Hawaiian example of such dispersal in the sunflower family (4–6). In this sanicles (Sanicula sect. Sandwicenses) constitute a monophy- paper, we provide phylogenetic evidence from nuclear ribo- letic group that descended from a western North American somal DNA internal transcribed spacer (ITS) sequences for ancestor in Sanicula sect. Sanicoria, a paraphyletic assemblage another example of angiosperm dispersal from the Pacific of mostly Californian species. A monophyletic group compris- coast of temperate western North America to the Hawaiian ing representatives of all 15 species of S. sect. Sanicoria and the Islands involving Sanicula (Apiaceae). In addition, we show three sampled species of S. sect. Sandwicenses was resolved in evidence for two amphitropical dispersals of sanicles from all maximally parsimonious trees, rooted with sequences from temperate western North America to southern South America. species of Astrantia and Eryngium. All sequences sampled from eastern North American, European, and Asian species of MATERIALS AND METHODS Sanicula fell outside the ITS clade comprising S.
    [Show full text]
  • Plant-Pollinator Interactions of the Oak-Savanna: Evaluation of Community Structure and Dietary Specialization
    Plant-Pollinator Interactions of the Oak-Savanna: Evaluation of Community Structure and Dietary Specialization by Tyler Thomas Kelly B.Sc. (Wildlife Biology), University of Montana, 2014 Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science in the Department of Biological Sciences Faculty of Science © Tyler Thomas Kelly 2019 SIMON FRASER UNIVERSITY SPRING 2019 Copyright in this work rests with the author. Please ensure that any reproduction or re-use is done in accordance with the relevant national copyright legislation. Approval Name: Tyler Kelly Degree: Master of Science (Biological Sciences) Title: Plant-Pollinator Interactions of the Oak-Savanna: Evaluation of Community Structure and Dietary Specialization Examining Committee: Chair: John Reynolds Professor Elizabeth Elle Senior Supervisor Professor Jonathan Moore Supervisor Associate Professor David Green Internal Examiner Professor [ Date Defended/Approved: April 08, 2019 ii Abstract Pollination events are highly dynamic and adaptive interactions that may vary across spatial scales. Furthermore, the composition of species within a location can highly influence the interactions between trophic levels, which may impact community resilience to disturbances. Here, I evaluated the species composition and interactions of plants and pollinators across a latitudinal gradient, from Vancouver Island, British Columbia, Canada to the Willamette and Umpqua Valleys in Oregon and Washington, United States of America. I surveyed 16 oak-savanna communities within three ecoregions (the Strait of Georgia/ Puget Lowlands, the Willamette Valley, and the Klamath Mountains), documenting interactions and abundances of the plants and pollinators. I then conducted various multivariate and network analyses on these communities to understand the effects of space and species composition on community resilience.
    [Show full text]