Original Article the Role and Function of Matrix Metalloproteinase-8 in Rhegmatogenous Retinal Detachment
Total Page：16
File Type：pdf, Size：1020Kb
Int J Clin Exp Pathol 2017;10(7):7325-7332 www.ijcep.com /ISSN:1936-2625/IJCEP0039672 Original Article The role and function of matrix metalloproteinase-8 in rhegmatogenous retinal detachment Hong Pan1, Zhiming Zheng2 Departments of 1Ophthalmology, 2Neurosurgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan 250021, Shandong, People’s Republic of China Received September 7, 2016; Accepted November 18, 2016; Epub July 1, 2017; Published July 15, 2017 Abstract: Rhegmatogenous retinal detachment (RRD) is one blinding disease, and has pathological features cor- related with migration of retinal pigment epithelium (RPE) cells to viscous body. Matrix metalloproteinase-8 (MMP-8) participates in eye diseases including xerophthalmia and retinal disease. Its role in RRD, however, has not been illustrated with the functional mechanism. RPE cells from RRD model mice and normal mice were separated and cultured. MMP-8 expression plasmid was transfected into RPE cell in model group. Real time PCR and Western blot were employed to test expression level of MMP-8, whilst MTT method was used to test proliferation activity of RPE cells. Caspase 3 activity was quantified by test kit. Transwell migration assay was adopted to measure invasion ability of RPE cells. ELISA method was used to test expression level of inflammatory factors interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α). MMP-8 expression level was significantly decreased in RPE cells of RRD group, which also had enhanced cell proliferation and migration, accompanied with higher IL-1β and TNF-α levels (P<0.05 compared to control group). After MMP-8 transfection and over-expression, RPE cell proliferation and migration were inhibited, along with higher Caspase 3 activity, plus lower IL-1β and TNF-α expression (P<0.05 compared to model group). RRD caused decreased expression of MMP-8 in RPE cells. MMP-8 can facilitate RPE cells proliferation and migration via modulating cell apoptotic activity and secretion of inflammatory factor, thus participating in RRD pathogenesis and progression. Keywords: Rhegmatogenous retinal detachment, retinal pigment epithelium, matrix metalloproteinase-8, cell apoptosis, inflammatory factor Introduction regenerate, RPE cells cannot be replaced after death, but are occupied by adjacent cells via Rhegmatogenous retinal detachment (RRD) sliding [6, 7]. Occurrence of RRD causes sepa- frequently occurs in middle and aged popula- ration of retinal neural epithelium and RPE, tions, especially in male patients. It normally depriving the nutrient supply of outer retina via develops sequentially in both eyes, and com- choroid plexus, further aggravating post-macu- monly happens in people with severe myopia lar area injury and retinal damage. Without refractive errors [1, 2]. RRD is manifested as timely treatment or relocation, detached retina the detachment of neural layer from retinal pig- may develop atrophy and denature, leading to ment epithelium (RPE) layer of retina, and vision damage [8]. RRD in macular region can severely affects patient’s life quality as one cause sharply decreased vision function, and blinding disease [3]. RRD is also featured as irreversible loss of vision without timely treat- liquidation of viscous body following forma- ment [9, 10]. tion of cleft on retina, making the detachment between retina and RPE cells [4]. RPE is formed RPE cells are activated after stimulus, followed by single layers of epithelial cells with regular by departure from original position, differentia- arrangement. Polygonal RPE cells can be divid- tion and migration into viscous body. Proli- ed into apical, soma and basal compartments feration of RPE can secrete abundant extra cel- [5]. There are over one million RPE cells in each lular matrix (ECM), forming hyperplasia mem- human eye. However, due to the inability to brane with contractibility, stretching both sides MMP-8 and retinal detachment of retina and viscous body, causing retinal was purchased from BD (US). Other common detachment [11, 12]. Matrix metalloproteinase reagents were purchased from Sangon (China). (MMPs) can degrade effective component of ECM and basal membrane, and regulate cell Animal grouping and treatment adhesion, thus playing a critical role in ECM dynamic balance [13, 14]. Previous study Healthy male Wistar rats were randomly divid- showed the involvement of MMPs in various ed into two groups (N=20), including control diseases including tumor, rheumatoid arthritis and RRD model group. and proliferative vitreoretinopathy [15, 16]. The RRD model preparation function and mechanism of MMP-8, which is one important member of MMPs family, in RRD, Rats were anesthetized by 30 mg/kg pentobar- however, have not been elucidated. bital sodium, and were fixed in a supine posi- Materials and methods tion. 0.1% atropine eye dropping, 0.3% ofloxa- cin eye droppings were applied 3 d before Experimental animals surgery. Mydrin-P was used to dilate the pupil. Focal anesthesia was performed by sub-con- Healthy male Wistar rats (2 months old, SPF junctival injection of 2% lidocaine and 0.75% grade, body weight 250±20 g) were purchased levobupivacaine. Bulbar conjunctiva was open- from laboratory animal center of Shandong ed, and an incision was made 3 mm posterior University and were kept in an SPF grade facili- of corneoscleral junction to prepare channels ty with fixed temperature (21±1°C), fixed humid- for incision, perfusion, and optical fiber lighting. ity (50-70%) and 12 h light/dark cycle. Rats The scaffold of corneal contact lens was placed were used for all experiments, and all proce- in, along with surgical microscope. Partial vis- dures were approved by the Animal Ethics cous body was removed under sterile condi- Committee of Provincial Hospital Affiliated to tion. Retina was scratched gently to form 2~3 Shandong University. optic disc holes. Incisions of both cornea and bulbar conjunctiva were closed. 10000 U of Major materials and equipment gentamicin and dexamethasone were injected underneath the bulbar conjunctiva, along with 0.1% atropine eye dropping, 0.3% ofloxacin eye post-op application of chloramphenicol eye dropping and Mydrin-P were purchased from dropping to prevent infection. Optical coher- Merck (US). Pentobarbital sodium and lidocaine ence tomography can observe interruption of were purchased from Zhaohui Pharm (China). retinal neural epithelium, in addition to signifi- PVDF membrane was purchased from Pall Life cant uplift of highly-reflective pigmented epi- Sciences (US). Western blotting reagents were thelium to form detachment with certain purchased from Beyotime (China). ECL reagent angles. These features plus liquid dark region was purchased from Amersham Biosciences indicated successful generation of the model (US). Rabbit anti-mouse MMP-8 monoclonal [17]. antibody and goat anti-rabbit horseradish per- oxidase (HRP)-labelled IgG secondary antibo- Culture of RPE cells dy were purchased from Cell Signaling (US). Β-actin (MAB8929) was purchased from R&D Control and model rats were anesthetized by (US). IL-β and TNF-α ELISA kits were purchased 2% lidocaine via post-bulbar injection. Bilateral from R&D (US). Caspase 3 activity assay kit eyeballs were removed under sterile condi- was purchased from Cell signaling (US). RNA tions. Attached fascia tissues were removed. extraction kit, pcDNA3.1 vector, and reverse The eyeball was rinsed in gentamicin-contain- transcription kit were purchased from Axygen ing saline and was placed in DMEM culture (US). Transwell chamber was purchased from medium. A circular incision was made 3 mm Corning (US). pcDNA3.1 empty plasmid and posterior of corneoscleral junction. Anterior pcDNA3.1-MMP-8 plasmid were synthesized by segment and viscous body were removed, fol- Gimma (China). Surgical microscope was pur- lowed by 0.25% trypsin digestion for 10 min. chased from Suzhou Instrument (China). ABI Retinal neural epithelial layer was separated 2000 fluorescent quantitative PCR cycler was and removed. Remaining eyecup, which con- purchased from ABI (US). Microplate reader tained RPE cell layer, was cut radically. After 7326 Int J Clin Exp Pathol 2017;10(7):7325-7332 MMP-8 and retinal detachment Table 1. Primer sequence measured for standard samples Target gene Forward primer 5’-3’ Reverse primer 5’-3’ based on internal reference GAPDH GAPDH AGTACCAGTCTGTTGCTGG TAATAGACCCGGATGTCTGGT gene for plotting standard curve. Quantitative analysis was perfor- MMP8 ACCCTTCCCTCTAGTGAATC TAGATGGACCTCTGTTTAAT med by 2-ΔCt approach. 0.25% trypsin digestion for 30 min at 37°C, Western blot for MMP8 protein expression cells suspensions were then centrifuged at 800 rpm for 10 min. the supernatant was dis- Proteins of RPE cells were extracted by RIPA carded and cultured medium containing 100 U/ lysis buffer containing proteinase inhibitor. In ml penicillin and 100 μg/ml streptomycin was brief, cells were mixed with lysis buffer for added for incubation at 37°C with 5% CO2. 15~30 min iced incubation. Using ultrasonic Culture medium was changed every changed rupture (5 s, 4 times) and centrifugation (10000 every other day. Cells were passed every 2-3 g, 15 min at 4°C), proteins were quantified from days. RPE cells at log-growth phase at 2nd to 8th the supernatant and were kept at -20°C for generation were used for experiments. Model Western blotting. Proteins were separated in group was randomly divided into three groups: 10% SDS-PAGE, and were transferred to PVDF model group; empty transfection group, which membrane by semi-dry method. Non-specific was transfected by empty pcDNA3.1 plasmid; binding sites were blocked by 5% defatted milk and MMP-8 group, which was transfected with powders for 2 hours. Anti-MMP8 monoclonal pcDNA3.1-MMP8 plasmid. antibody (1:1000) or β-actin antibody (1:2000) was applied for 4°C overnight incubation. Goat Liposome transfection of MMP8 plasmid into anti-rabbit IgG (1:2000) was then added for RPE cells 30-min incubation after PBST rinsing. After PBST washing and ECL development for 1 min, pcDNA3.1 and MMP8 plasmid were transfect- the membrane was exposed under X-ray. An ed into RPE cells, which were cultured in 6-well imaging analyzing system and Quantity one plate until 70-80% confluence.