Subcellular Distribution of Envoplakin and Periplakin: Insights into Their Role as Precursors of the Epidermal Cornified Envelope Teresa DiColandrea, Tadashi Karashima, Arto Määttä, and Fiona M. Watt Keratinocyte Laboratory, Imperial Cancer Research Fund, London WC2A 3PX, England Abstract. Envoplakin and periplakin are two plakins moplakin, that of periplakin localized to desmosomes; that are precursors of the epidermal cornified envelope. however, in addition, the periplakin NH2 terminus ac- We studied their distribution and interactions by trans- cumulated at cell surface microvilli in association with fection of primary human keratinocytes and other cells. cortical actin. Endogenous periplakin was redistributed Full-length periplakin localized to desmosomes, the in- from microvilli when keratinocytes were treated with terdesmosomal plasma membrane and intermediate the actin disrupting drug Latrunculin B. We propose filaments. Full length envoplakin also localized to des- that whereas envoplakin and periplakin can localize in- mosomes, but mainly accumulated in nuclear and cyto- dependently to desmosomes, the distribution of en- plasmic aggregates with associated intermediate fila- voplakin at the interdesmosomal plasma membrane de- ments. The envoplakin rod domain was required for pends on heterodimerization with periplakin and that aggregation and the periplakin rod domain was neces- the NH2 terminus of periplakin therefore plays a key sary and sufficient to redistribute envoplakin to desmo- role in forming the scaffold on which the cornified en- somes and the cytoskeleton, confirming earlier predic- velope is assembled. tions that the proteins can heterodimerize. The linker domain of each protein was required for intermediate Key words: envoplakin • periplakin • desmosomes • filament association. Like the NH2 terminus of des- cornified envelope • keratinocytes Introduction One important function of mammalian epidermis is to sequencing of peptides released from envelopes during provide a physical barrier between the body and the envi- controlled sequential proteolysis (Marekov and Steinert, ronment. This function depends on a structure known as 1998; Steinert and Marekov, 1995, 1997, 1999). An early the cornified envelope that is formed in the outermost epi- step in envelope assembly is transglutaminase-mediated dermal layers (Reichert et al., 1993; Simon, 1994; Ishida- oligomerization of a precursor known as involucrin. Since Yamamoto and Iizuka, 1998; Nemes and Steinert, 1999). involucrin is a cytosolic protein there must be a mecha- The cornified envelope is assembled from a range of pre- nism by which it becomes associated with the plasma cursor proteins that become cross-linked to one another membrane. It is believed that this occurs by cross-linking through the activity of transglutaminases. The resulting of involucrin to two proteins, envoplakin and periplakin, structure is an insoluble layer of protein with covalently which are found at desmosomes and the interdesmosomal ,nm thick, that is deposited on the in- plasma membrane (Simon and Green, 1984; Ma and Sun-15ف ,attached lipid ner surface of the plasma membrane. 1986; Ruhrberg et al., 1996, 1997). Subsequent to incorpo- The most current model of how the cornified envelope ration of involucrin, envoplakin, and periplakin into the is assembled (Steinert and Marekov, 1999) is based on two envelope, further proteins are added, including small pro- types of data: immunoelectron microscopy of isolated en- line-rich proteins, loricrin, and keratin filaments. velopes using antibodies to known precursor proteins, and Envoplakin and periplakin belong to the plakin family of cytolinker proteins that also includes desmoplakin, T. DiColandrea and T. Karashima are joint first authors. plectin, and BPAG1 (reviewed by Ruhrberg and Watt, Address correspondence to Fiona M. Watt, Imperial Cancer Research 1997; Fuchs and Cleveland, 1998; Houseweart and Cleve- Fund, P.O. Box 123, 44 Lincoln’s Inn Fields, London WC2A 3PX, En- land, 1998; Fuchs and Yang, 1999; Herrmann and Aebi, gland. Tel.: 44 20 7269 3528; Fax: 44 20 7269 3078; E-mail: watt@icrf. icnet.uk 2000). In addition to being expressed in the epidermis, en- T. Karashima is on leave from Department of Dermatology, Kurume Uni- voplakin and periplakin are found in other stratified epi- versity School of Medicine, 67 Asahimachi, Kurume, Fukuoka 830, Japan. thelia and in two-layered and transitional epithelia such as The Rockefeller University Press, 0021-9525/2000/10/573/13 $5.00 The Journal of Cell Biology, Volume 151, Number 3, October 30, 2000 573–585 http://www.jcb.org/cgi/content/full/151/3/573 573 the mammary gland and bladder (Ruhrberg et al., 1996, teins and their individual domains by stable and transient 1997; Aho et al., 1998). Periplakin is also highly expressed transfection of primary human keratinocytes and other cell in brain (Aho et al., 1998). In differentiating keratinocytes types. We demonstrate a key role for periplakin in direct- that have not yet assembled a cornified envelope en- ing the subcellular distribution of both proteins and, specif- voplakin and periplakin are found at desmosomal plaques, ically, for the NH2 terminus of periplakin in targeting the in close proximity to desmoplakin, in an interdesmosomal proteins to the interdesmosomal plasma membrane. network at the plasma membrane, and associated with keratin filaments (Ruhrberg et al., 1996, 1997). Materials and Methods All conventional plakins comprise an NH2-terminal glob- ular domain, a central rod domain and a COOH-terminal Generation of cDNA Constructs globular domain. More distantly related proteins include Drosophila kakapo (Stumpf and Volk, 1998; Gregory and Plasmids containing partial cDNAs (Ruhrberg et al., 1996, 1997) for both Brown, 1998) and its mammalian homolgue ACF7 (Leung envoplakin and periplakin were used to create full-length cDNAs by using unique restriction enzyme digests to allow fusion of multiple cDNA frag- et al., 1999; Karakesisoglou et al., 2000), which share ho- ments and assembly into pBluescript II KSϩ/Ϫ (Stratagene). The full- mology with plakins at the NH2 terminus and with dystro- length cDNAs were then tagged with either influenza virus hemagglutinin 1 phin at the COOH terminus. The NH2-terminal domain is (HA ; periplakin) or FLAG (envoplakin) protein coding sequences in a known to direct desmoplakin and plectin to membrane lo- PCR reaction using primers that linked the epitope tags in frame with the plakin cDNAs at the COOH-terminal ends. Subsequently, the new calization sites (desmosomes and hemidesmosomes, re- COOH-terminal fragments were ligated to the cDNA in pBluescript and spectively) (Bornslaeger et al., 1996; Smith and Fuchs, the resulting tagged cDNA was subcloned into pCI-neo, a mammalian ex- 1998; Wiche, 1998; Geerts et al., 1999). Plectin and some al- pression vector from Promega. The primers used were: AGGCCCTC- ternatively spliced variants of BPAG1 have, in addition, an CTCTCCGGGATGATCAGTGAAGA (envoplakin COOH terminus, NH -terminal actin binding domain (Yang et al., 1996; Liu 5Ј end); GCTCTAGAGCTCACTTGTCATCGTCGTCCTTGTAGT- 2 CGCGAAGGGAGCGCGGGACGGTGGGGGAGGCGGAGCGGTA et al., 1996; Andrä et al., 1998; Fuchs et al., 1999). One of (envoplakin COOH-terminal FLAG tag, 3Ј end); AAGGTAACCCAT- the BPAG1 isoforms has an NH2-terminal microtubule ACGCAGAAGGTGGTGCTGCA (periplakin COOH terminus, 5Ј binding site (Yang et al., 1999) and plectin interacts with end); CCAAGCTTGGGTCTAGAGCGGCCGCCTAAGCGTAGTCT- microtubules, probably via microtubule-associated proteins GGCACGTCGTATGGGTACTTCTGCCCAGATACCAAGACCGCA (periplakin COOH-terminal HA tag, 3Ј end). (Svitkina et al., 1996; Wiche, 1998). The central rod domain All truncated periplakin cDNAs were constructed by PCR amplifica- forms a coiled coil structure that mediates assembly of tion from the full-length cDNA linking the epitope tag to the mutant plakins into parallel homodimers (Green et al., 1990, 1992; cDNA in frame at either the NH2-terminal or COOH-terminal end (see Wiche et al., 1991; Sawamura et al., 1991) and the COOH- Fig. 1). Primers for generating the periplakin cDNA fused with the HA terminal globular domains of desmoplakin, plectin, and epitope tag were as follows: 5Ј-GACCGAGTCGACCTACGCATAG- TCAGGAACATCGTATGGGTAATTCTCGGTCTTCAGCACCTC- BPAG1 bind intermediate filaments (Foisner et al., 1988; ATACCGCTGCT (P-1/2N); 5Ј-AAGACGAATTCGCCGCCACCA- Stappenbeck and Green, 1992; Stappenbeck et al., 1993; TGTACCCATACGATGTTCCTGACTATGCGCAGAAGCGCCTG- Wiche et al., 1993; Kouklis et al., 1994; Nikolic et al., 1996; GGCTCC (P-C); 5Ј-GACCGAGTCGACCTACGCATAGTCAGGA- Yang et al., 1996; Steinböck et al., 2000). ACATCGTATGGGTAGACGGCCACGGAGCCCAGGCGCTT (P-R and P-NR); 5Ј- GTGCTCAAGAATTCAGCCACCATGTACCCA- Although periplakin and envoplakin share the overall TACGATGTTCCTGACTATGCGCAGGAATCGGTGGTGAGGAA- structure of desmoplakin, plectin, and BPAG1, their GGAGGTGCT (P-RC). COOH-terminal domains, are considerably smaller, with All the envoplakin partial cDNAs except for E-NR and E-RC (see Fig. envoplakin having only one of the globular subdomains 1) were assembled using PCR reactions to amplify targeted sequences (the C box) and periplakin none (Ruhrberg et al., 1996, which were then subcloned in frame into a modified pCI-neo vector (F9). F9 was created by inserting the FLAG epitope into the SmaI site of the 1997; Aho et al., 1998). The COOH termini of envoplakin pCI multicloning region, flanked by an ATG start site, a TAG termination and periplakin do, however, include the recently defined