DOCSLIB.ORG

Efficient Targeted Gene Disruption in the Soma and Germ Line of the Frog

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Efficient Targeted Gene Disruption in the Soma and Germ Line of the Frog Efficient targeted gene disruption in the soma and germ line of the frog Xenopus tropicalis using engineered zinc-finger nucleases John J. Younga, Jennifer M. Cheroneb, Yannick Doyonb, Irina Ankoudinovab, Farhoud M. Farajib, Andrew H. Leeb, Catherine Ngob, Dmitry Y. Guschinb, David E. Paschonb, Jeffrey C. Millerb, Lei Zhangb, Edward J. Rebarb, Philip D. Gregoryb, Fyodor D. Urnovb, Richard M. Harlanda,1, and Bryan Zeitlerb aDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3200; and bSangamo BioSciences, Inc., Richmond, CA 94804 Edited* by John Gerhart, University of California, Berkeley, CA, and approved March 10, 2011 (received for review February 7, 2011) The frog Xenopus, an important research organism in cell and de- To develop conditions for gene disruption in X. tropicalis,we velopmental biology, currently lacks tools for targeted mutagen- made use of transgenic animals carrying a single-copy GFP esis. Here, we address this problem by genome editing with zinc- transgene (14). Wild-type X. tropicalis eggs were fertilized with finger nucleases (ZFNs). ZFNs directed against an eGFP transgene in sperm from a homozygous GFP transgenic male. The resulting Xenopus tropicalis induced mutations consistent with nonhomol- heterozygous embryos were injected with mRNA-encoding ZFNs ogous end joining at the target site, resulting in mosaic loss of the that target the eGFP coding region (15). Uninjected tadpoles ex- fluorescence phenotype at high frequencies. ZFNs directed against press GFP robustly in the somites, lens, and head musculature the noggin gene produced tadpoles and adult animals carrying up (Fig. 1 A and B). Injection of 20 pg eGFP ZFN RNAs led to mosaic to 47% disrupted alleles, and founder animals yielded progeny loss of fluorescence in otherwise healthy tadpoles (Fig. 1 E and F). carrying insertions and deletions in the noggin gene with no in- At a higher dose of ZFNs, most cells had lost fluorescence, sug- dication of off-target effects. Furthermore, functional tests dem- gesting efficient somatic mutation of the transgene (Fig. 1 H and I). onstrated an allelic series of activity between three germ-line To determine whether loss of fluorescence resulted from a BIOLOGY mutant alleles. Because ZFNs can be designed against any locus, fi ZFN-induced mutation in the eGFP transgene, we rst genotyped DEVELOPMENTAL our data provide a generally applicable protocol for gene disrup- the target locus using an assay based on the mismatch-sensitive tion in Xenopus. endonuclease, Cel-1 (8). This analysis (Fig. 1J) demonstrated that ZFN-treated, but not control, tadpoles had acquired a DNA se- rogs of the genus Xenopus have been an important model quence alteration in the stretch targeted by the ZFNs. Sequencing Forganism for cell and developmental biologists since the subsequently revealed that individual tadpoles often carried 1930s (1). Xenopus laevis is the standard model, but is allote- multiple distinct indels ranging from 5 to 20 bp centered over traploid and hence less suited for genetic approaches than the the ZFN recognition site (Fig. 1K), a signature of mutagenic diploid Xenopus tropicalis, whose genome sequence has been NHEJ. Taken together, these experiments show that ZFN mRNA determined (2). Whereas embryological manipulations and gain- injection into the two-cell embryo yields tadpoles without de- of-function experiments are major strengths of Xenopus, reverse tectable developmental defects that exhibit both genetic and genetics is currently limited to the use of antisense reagents that phenotypic mosaicism for the ZFN-targeted locus and trait, provide transient and often incomplete gene knockdown (3). The respectively. To determine whether this approach can be used to disrupt an ability to introduce targeted, heritable mutations that disrupt endogenous gene, we designed ZFNs that target the noggin locus. gene function has remained elusive. Noggin is a bone morphogenetic protein (BMP) antagonist that Here, we provide a generally applicable solution to this prob- contributes to dorsal/ventral patterning during gastrulation in lem: targeted gene disruption with designed zinc-finger nucleases fi Xenopus (16). Although its function in later development has been (ZFNs). ZFNs are the fusion of the nonspeci c cleavage domain studied in human patients (17) and mice (18–21), its de- of the type IIS restriction enzyme FokI to a zinc-finger protein fi velopmental role in nonmammalian vertebrates remains poorly (4, 5) that is engineered to bind a speci c genomic locus to in- understood. Noggin is expressed at stages when knockdown via duce a targeted double-strand break (DSB). Pioneering studies morpholinos is not effective. Therefore, mutant alleles of the en- in oocytes of X. laevis (6) and subsequent work in Drosophila (7) dogenous noggin gene are required to probe its role throughout showed the mutagenic potential of a DSB induced by ZFNs amphibian development. (reviewed in refs. 10 and 11). Resolution of ZFN-induced DSBs We designed a panel of ZFNs targeting noggin, screened them via nonhomologous end joining (NHEJ) generates small inser- in a budding yeast proxy system (22), and cloned the ZFNs into tions and deletions that often produce null or hypomorphic an expression construct that allows the synthesis of an efficiently alleles (7, 9, 12). translated mRNA with a stabilizing polyadenylation signal (23). In the present work, we set out to develop an effective pro- Embryos were injected in the animal pole, and mRNA was de- tocol for gene disruption in X. tropicalis. Using ZFNs designed against a reporter transgene and the noggin locus, we optimized delivery and expression conditions and attained high frequencies Author contributions: J.J.Y., F.D.U., R.M.H., and B.Z. designed research; J.J.Y., J.M.C., Y.D., of somatic and germ-line mutations that were transmissible to F.M.F., A.H.L., C.N., and B.Z. performed research; I.A., D.Y.G., D.E.P., J.C.M., L.Z., E.J.R., and P.D.G. contributed new reagents/analytic tools; J.J.Y., J.M.C., Y.D., F.M.F., A.H.L., C.N., F.D.U., the next generation. R.M.H., and B.Z. analyzed data; and J.J.Y., F.D.U., R.M.H., and B.Z. wrote the paper. Conflict of interest statement: J.M.C., Y.D., I.A., F.M.F., A.H.L., C.N., D.Y.G., D.E.P., J.C.M., Results L.Z., E.J.R., P.D.G., F.D.U., and B.Z. are current or past employees of Sangamo Biosciences, Inc. Xenopus eggs are large and easily manipulated (13), offering the *This Direct Submission article had a prearranged editor. opportunity to deliver ZFNs via injection of mRNA, a method 1To whom correspondence should be addressed. E-mail: [email protected]. that has been successful in bringing about ZFN-driven gene This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. disruption in other organisms (10, 11). 1073/pnas.1102030108/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1102030108 PNAS Early Edition | 1of6 Downloaded by guest on October 1, 2021 A D G U.C. 20 pg eGFP ZFNs 50 pg eGFP ZFNs B E H U.C. 20 pg eGFP ZFNs 50 pg eGFP ZFNs C F I eGFP ZFN L eGFP ZFN R J 20 pg 50 pg K Gln Leu Gln Gln Pro Gln Arg Leu Tyr His Gly Arg Gln WT CAACTACAACAGCCACAACGTCTATATCATGGCCGACAAG CAACTACAACAGCCACAACGT---TATCATGGCCGACAAG( 3) 1 2 3 1 2 3 UC CAACTACA------------TCTATATCATGGCCGACAAG( 12) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) 345 bp CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAGCCACAACGT-----------CCGACAAG( 11) Deletions CAACTACAACAGCCACAAC-----TATCATGGCCGACAAG( 5) 246 bp CAACTACAACAGC--------------CATGGCCGACAAG( 14) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAGC--------------CATGGCCGACAAN( 14) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAGC--------------CATGGCCGACAAG( 14) CAACTACAACAGCCACAA--------TCATGGCCGACAAG( 8) GAACTACAACAGCCACAACGTGTGT--CATGGCCGACAAG( 6,+4) 99 bp CAACTACAACAGCCACAACAA------CA--GCCGACAAG( 12,+4) Indels CAACTACAACAGT--------------CATGGCCGACAAG( 15,+1) CAACTACAACAG----AA------------AGCCGACAAG( 19,+3) CAACTACAACAGCCACAAC----GGATCATGGCCGACAAG( 6,+2) %%NHEJ NHEJ 16 11 11 19 17 24 Insertions CAACTACAACAGCCACAACGTCTATATATCATGGCCGACA(+2) Fig. 1. Disruption of the eGFP transgene in X. tropicalis using ZFNs. (A–C) Uninjected tadpoles (U.C.). (D–F) Tadpoles injected with 20 pg of eGFP ZFN mRNA and 200 pg mCherry RNA (to monitor injection). (G–I) Heterozygous eGFP tadpoles injected with 50 pg eGFP ZFN mRNA and 200 pg mCherry RNA (tracer). (A, D, and G) Brightfield. (B, E,andH) eGFP expression of tadpoles in A, D, and G, respectively. (C, F, and I) Enlarged view of eGFP expression in B, E, and H, respectively. (J) Cel-1 digestion of eGFP amplicons. Bands migrating at 345 bp are full-length amplicons; Cel-1 cleavage products migrate at 246 and 99 bp. The fractions of modified chromatids detected by Cel-1 are quantified as percentage NHEJ. UC, uninjected control. (K) Sequence alignment of ZFN-induced mutant eGFP transgene alleles from tadpoles injected with 50 pg ZFN mRNA. Red nucleotides indicate insertions and dashes represent deletions. Horizontal bold lines at top indicate ZFN-binding sites. posited in the center of each blastomere at the two-cell stage and ded efficient genome editing in Xenopus embryos as measured by raised to stage 40, and DNA was isolated from tadpoles that sequencing noggin amplicons from injected tadpoles. exhibited broad mCherry (i.e., tracer) expression. Use of ZFNs Because no Xenopus strains carrying noggin mutations exist, we carrying a wild-type FokI endonuclease domain yielded a signif- were unable to screen for phenotypes on a heterozygous back- icant fraction of embryos with developmental defects (Fig. 2A). ground (22) and instead screened the ZFNs for activity by gen- However, this was alleviated by expressing the same zinc-finger otyping the targeted region using the Cel-1 endonuclease (Fig. DNA recognition domains fused to the obligate heterodimer 3A).
Load more

Recommended publications
  • Inbreeding Ratio and Genetic Relationships Among Strains of the Western Clawed Frog, Xenopus Tropicalis
    RESEARCH ARTICLE Inbreeding Ratio and Genetic Relationships among Strains of the Western Clawed Frog, Xenopus tropicalis Takeshi Igawa1¤*, Ai Watanabe1, Atsushi Suzuki1, Akihiko Kashiwagi1, Keiko Kashiwagi1, Anna Noble2, Matt Guille2, David E. Simpson3, Marko E. Horb4, Tamotsu Fujii5, Masayuki Sumida1 1 Institute for Amphibian Biology, Graduate School of Science, Hiroshima University, Higashi-Hiroshima, Hiroshima, Japan, 2 School of Biological Sciences, Institute of Biomedical and Biomolecular Science, University of Portsmouth, Portsmouth, United Kingdom, 3 The Wellcome Trust/Cancer Research UK Gurdon Institute, The Henry Wellcome Building of Cancer and Developmental Biology, University of Cambridge, Cambridge, United Kingdom, 4 Bell Center for Regenerative Biology and Tissue Engineering and National Xenopus Resource, Marine Biological Laboratory, Woods Hole, MA, United States of America, 5 Department of Health Sciences, Faculty of Human Culture & Science, Prefectural University of Hiroshima, Hiroshima, Japan ¤ Current Address: Division of Development Science, Graduate School of International Development and OPEN ACCESS Cooperation, Hiroshima University, Higashi-Hiroshima, Hiroshima, Japan * [email protected] Citation: Igawa T, Watanabe A, Suzuki A, Kashiwagi A, Kashiwagi K, Noble A, et al. (2015) Inbreeding Ratio and Genetic Relationships among Strains of the Western Clawed Frog, Xenopus tropicalis. PLoS Abstract ONE 10(7): e0133963. doi:10.1371/journal. pone.0133963 The Western clawed frog, Xenopus tropicalis, is a highly promising model amphibian, espe- Editor: Gert Jan C. Veenstra, Radboud University cially in developmental and physiological research, and as a tool for understanding disease. Nijmegen, NETHERLANDS It was originally found in the West African rainforest belt, and was introduced to the research Received: January 8, 2015 community in the 1990s.
    [Show full text]
  • Frogs Reveal Mechanism That Determines Viability of Hybrids 11 January 2018
    Frogs reveal mechanism that determines viability of hybrids 11 January 2018 which one is the mother. One hybrid is viable, the other hybrid is not Both mules and hinnies are infertile, because donkeys and horses have a different number of chromosomes, the protein structures on which Crossbreeding Xenopus laevis, the African clawed frog, genetic material is present. Yeasts, plants, fish and and Xenopus tropicalis, the Western clawed frog has amphibians (in contrast to mammals) can, however, asymmetric results. When a female African clawed frog produce fertile hybrids. Professor of Molecular is crossbred with a male Western clawed frog, the Developmental Biology Gert Jan Veenstra says, embryos are viable. However, the other way around, "For instance, in frogs a duplication of crossbreeding a male African clawed frog and a female Western clawed frog leads to embryos that die in the chromosomes can appear, in which the whole set early stages of development. Researchers found the of chromosomes from the father and the mother are reason for this: the maternal molecular machinery of the passed on to the next generation." Western clawed frog cannot fully recognize the paternal chromosomes of the African clawed frog. The separation However, there is another problem: Some hybrids of the paternal chromosomes during cell division is are not viable, while crossbreeding the other way disrupted. As a consequence, the cells lack a large around is. The embryos are genetically identical, number of vital genes and quickly die. Credit: University but there is a difference in viability, depending on of California Berkeley, Radboud University the father species and the mother species.
    [Show full text]
  • Publications 2018-2019
    Centre Eau Terre Environnement er Publications des membres (1 mai 2018 - 30 avril 2019) Articles dans des revues scientifiques avec révision par des pairs Ahad JME, Pakdel H, Gammon PR, Siddique T, Kuznetsova A et Savard MM (2018). Evaluating in situ biodegradation of 13C-labelled naphthenic acids in groundwater near oil sands tailings ponds. Sci. Total Environ., 643 (Décembre): 392-399. http://dx.doi.org/10.1016/j.scitotenv.2018.06.159 Alsaadi F, Madison BN, Brown RS, Hodson PV et Langlois VS (2018). Morphological and molecular effects of two diluted bitumens on developing fathead minnow (Pimephales promelas). Aquat. Toxicol., 204 (Novembre): 107-116. http://dx.doi.org/10.1016/j.aquatox.2018.09.003 Alvarez C, Bégin C, Savard MM, Dinis L, Marion J, Smirnoff A et Bégin Y (2018). Relevance of using whole- ring stable isotopes of black spruce trees in the perspective of climate reconstruction. Dendrochronologia, 50 (Août): 64-69. http://dx.doi.org/10.1016/j.dendro.2018.05.004 Assemian A, Kouassi KE, Adouby K, Drogui P et Boa D (2018). Removal of Methylene Blue in aqueous solutions by electrocoagulation process: Adsorption, kinetics, studies. Eur. J. Chem., 9 (4): 311-316. http://dx.doi.org/10.5155/eurjchem.9.4.311-316.1736 Atheba GP, Blaise Allou N, Drogui P et Trokourey A (2018). Adsorption kinetics and thermodynamics study of butylparaben on activated carbon coconut based. J. Encapsul. Adsorption Sci., 8 (2): 39-57. http://dx.doi.org/10.4236/jeas.2016.82003 Audet L, Duchesne S et Kokutse N (2018). A regionalized river water quality model calibration method based on watershed physical characteristics: Application to the Cau River in Vietnam.
    [Show full text]
  • UNDP Project Document Niger Delta Biodiversity Project
    UNDP Project Document Government of Nigeria Lead Agency: Federal Ministry of Environment Additional partners: Ministry of Niger Delta; Niger Delta Development Commission Ministry of Petroleum Resources; Oil Production Trade Sector, Lagos Chamber of Commerce United Nations Development Programme (UNDP) Global Environment Facility (GEF) The GEF’s Strategic Programme for West Africa (SPWA) – Sub-component Biodiversity UNDP GEF PIMS no.: 2047 GEFSEC Project ID: 4090 Niger Delta Biodiversity Project Brief description This project’s goal is to contribute to the conservation and sustainable use of globally significant biological diversity in the Niger Delta. The project objective is “to mainstream biodiversity management priorities into the Niger Delta oil and gas (O&G) sector development policies and operations.” The project’s three main outcomes designed to achieve this objective are: 1) Stakeholders strengthen the governance framework of law, policy, and institutional capacity to enable the mainstreaming of biodiversity management into the O&G sector in the Niger Delta; 2) Government, the O&G industry and local communities adopt and pilot new biodiversity action planning tools for proactive biodiversity mainstreaming in the Niger Delta; 3) Stakeholders support long-term biodiversity management and the use of these new tools in the Niger Delta by capitalizing the Niger Delta Biodiversity Trust with a collaborative engagement mechanism for local communities, O&G companies and Government at its core. Each of the three outcomes of this project reflects the project’s (and UNDP’s) focus on strengthening the governance of biodiversity in the Niger Delta. By mainstreaming biodiversity into the O&G sector of the Niger Delta, the project is strengthening the governance of those resources.
    [Show full text]
  • Antimicrobial Peptides with Therapeutic Potential from Skin Secretions of Polyploid Frogs of the Pipidae Family
    Antimicrobial peptides with therapeutic potential from skin secretions of polyploid frogs of the Pipidae family Milena Mechkarska Thesis committee Promotor Prof. dr. Jerry M. Wells Professor of Host Microbe Interactomics, Wageningen University Co-promotor Prof. J. Michael Conlon Professor of Biochemistry College of Medicine and Health Sciences (CMHS) United Arab Emirates University (UAEU), Al Ain, UAE Other members Prof. Sylvie Dufour, Museum National d’Histoire Naturelle, Paris, France Prof. Eric W. Roubos, Radboud University, Nijmegen, The Netherlands Prof. dr. ir. Huub Savelkoul, Wageningen University Prof. Liliane Schoofs, KU Leuven, Belgium This research was conducted under the auspices of the Graduate School of Wageningen Institute of Animal Sciences (WIAS) Antimicrobial peptides with therapeutic potential from skin secretions of polyploid frogs of the Pipidae family Milena Mechkarska Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 7 May 2013 at 4 p.m. in the Aula. Milena Mechkarska Antimicrobial peptides with therapeutic potential from skin secretions of polyploid frogs of the Pipidae family, 226 pages. Thesis, Wageningen University, Wageningen, NL (2013) With references, with summaries in English and Dutch ISBN: 978-94-6173-550-8 To my family: The ones who love, support, care and forgive Table of contents
    [Show full text]
  • Flow Cytometric Analysis of Xenopus Laevis and X. Tropicalis Blood Cells Using Acridine Orange
    www.nature.com/scientificreports OPEN Flow cytometric analysis of Xenopus laevis and X. tropicalis blood cells using acridine orange Received: 8 May 2018 Kei Sato 1,2, Azusa Uehara2, Sayaka Kinoshita2, Ikki Nomura2, Minami Yagi2, Yuta Tanizaki2, Accepted: 1 October 2018 Yu Matsuda-shoji2, Atsushi Matsubayashi2, Nobuyasu Endo1, Yutaka Nagai3 & Takashi Kato 1,2 Published: xx xx xxxx Automated blood cell counters can distinguish cells based on their size and the presence or absence of a nucleus. However, most vertebrates have nucleated blood cells that cannot be counted automatically. We established an alternative automatic method for counting peripheral blood cells by staining cells with the fuorescent dye acridine orange (AO) and analysing cell populations using fow cytometry (FCM). As promising new animal models, we chose Xenopus laevis and three inbred strains of X. tropicalis. We compared the haematological phenotypes, including blood cell types, cell sizes, cellular structure, and erythrocyte lifespans/turnover rate among X. laevis and the three inbred strains of X. tropicalis. Each cell type from X. laevis was sorted according to six parameters: forward- and side-scattered light emission, AO red and green fuorescence intensity, and cellular red and green fuorescence. Remarkably, the erythrocyte count was the highest in the Golden line, suggesting that genetic factors were associated with the blood cells. Furthermore, immature erythrocytes in anaemic X. laevis could be separated from normal blood cells based on red fuorescence intensity. These results show that FCM with AO staining allows for an accurate analysis of peripheral blood cells from various species. Te determination of haematological variables is essential for both laboratory and clinical research and is a routine technique for analysis in humans, fsheries, and domestic animals.
    [Show full text]
  • Coexistence of Y, W, and Z Sex Chromosomes in Xenopus Tropicalis
    Coexistence of Y, W, and Z sex chromosomes in Xenopus tropicalis Álvaro S. Rocoa, Allen W. Olmsteadb,1, Sigmund J. Degitzb, Tosikazu Amanoc, Lyle B. Zimmermanc, and Mónica Bullejosa,2 aDepartment of Experimental Biology, Faculty of Experimental Sciences, University of Jaén, Las Lagunillas Campus S/N, 23071 Jaén, Spain; bMid-Continent Ecology Division, Environmental Protection Agency, Duluth, MN 55804; and cDivision of Developmental Biology, Medical Research Council-National Institute for Medical Research, London, NW7 1AA, United Kingdom Edited by David C. Page, Whitehead Institute, Cambridge, MA, and approved July 1, 2015 (received for review March 28, 2015) Homomorphic sex chromosomes and rapid turnover of sex-determin- (3, 16, 17). Nevertheless, not all sex chromosomes are morpho- ing genes can complicate establishing the sex chromosome system logically distinct. This lack of differentiation does not always in- operating in a given species. This difficulty exists in Xenopus tro- dicate a recent origin of the sex chromosomes, as is the case in picalis, an anuran quickly becoming a relevant model for genetic, ge- ratite birds and boid snakes (18, 19). Two hypotheses have been nomic, biochemical, and ecotoxicological research. Despite the recent proposed to explain the lack of differentiation between some pairs interest attracted by this species, little is known about its sex chromo- of sex chromosomes: (i) occasional recombination between them, some system. Direct evidence that females are the heterogametic sex, as could happen in sex-reversed individuals (20), and (ii)frequent as in the related species Xenopus laevis, has yet to be presented. turnover of sex chromosomes because of rapid changes of sex- Furthermore, X.
    [Show full text]
  • Identifying Homomorphic Sex Chromosomes from Wild‐Caught
    UC Riverside UC Riverside Previously Published Works Title Identifying homomorphic sex chromosomes from wild-caught adults with limited genomic resources. Permalink https://escholarship.org/uc/item/6dg869dw Journal Molecular ecology resources, 17(4) ISSN 1755-098X Authors Brelsford, Alan Lavanchy, Guillaume Sermier, Roberto et al. Publication Date 2017-07-01 DOI 10.1111/1755-0998.12624 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Molecular Ecology Resources (2017) 17, 752–759 doi: 10.1111/1755-0998.12624 Identifying homomorphic sex chromosomes from wild-caught adults with limited genomic resources ALAN BRELSFORD,*1a GUILLAUME LAVANCHY,*a ROBERTO SERMIER,* ANNA RAUSCH† and NICOLAS PERRIN* *Department of Ecology and Evolution, Biophore, University of Lausanne, 1015 Lausanne, Switzerland†Department of Integrative Zoology, University of Vienna, Althanstrasse 14, 1090 Vienna, Austria Abstract We demonstrate a genotyping-by-sequencing approach to identify homomorphic sex chromosomes and their homo- log in a distantly related reference genome, based on noninvasive sampling of wild-caught individuals, in the moor frog Rana arvalis. Double-digest RADseq libraries were generated using buccal swabs from 30 males and 21 females from the same population. Search for sex-limited markers from the unfiltered data set (411 446 RAD tags) was more successful than searches from a filtered data set (33 073 RAD tags) for markers showing sex differences in heterozy- gosity or in allele frequencies. Altogether, we obtained 292 putatively sex-linked RAD loci, 98% of which point to male heterogamety. We could map 15 of them to the Xenopus tropicalis genome, all but one on chromosome pair 1, which seems regularly co-opted for sex determination among amphibians.
    [Show full text]
  • Evoluci Cromos爅ica En Mam璗ers
    ! ! ! ! ! ! !"#$%&'()&*#+#,-+'&.)/0)+.+12/*,3)&.*'#4'5,).0&/,4*.$,)') 5%04,)6/)4*/0&.+/04)/"#$%4'%,) ! ! ! ! "#$%&'(! )&#*#+,(-(! )#&! 7.*4.) 8.**9) :/$+#04/! )#&!(!.),(&!(/!0&(1!-#!2.3,.&!#+!4'./.0'(!5#/6/1/(&! )#&!/(!7+'8#&*',(,!91,%+.$(!-#!4(&3#/.+(:! ! 9;1#*,! ,&#<(//! =(! #*,(,! &#(/',>(,! (! /(! 7+',(,! -#! 4'./.0'(! 5#/6/1/(&! -#/! 2#)(&,($#+,! -#! 4'./.0'(! 5#/6/1/(&?! @'*'./.0'(! '! A$$1+./.0'(! -#! /(! 7+'8#&*',(,! 91,%+.$(! -#! 4(&3#/.+(?! *.,(! /(! 3.B -'&#33'C!-#!/(!2&(:!;%*#*.)<%'=>?/**/*.)7#*/0#!'! /(!2&(:!7#04,/**.4):#,&@)A.$$/B#:! ! ! ! ! ! ! ! 2&(:!91&.&(!D1'>BE#&&#&(!".&#+.! ! 2&(:!".+,*#&&(,!4.*3=!F(//#0.! !!!!!"(&,(!@(&&G!4#/$.+,#! !"#$%& ! "#$! %! &'(#$! #)*#)($#! +%! (,)-.,/%! #0'+1*,0%! (#+2! 3#)'.#2! 42! ,.&$#2/,)(,5+#! /')6,7#$!/'.!#2*%)!'$3%),*8%*2!#+2!/$'.'2'.#2!(#!+#2!(,9#$#)*2!#2&6/,#2!,!(#*#$.,)%$! :1,)2! *,&12! (#! $#'$3%),*8%/,')2! /$'.'2;.,:1#2! #2*%)! ,.&+,/%(#2! #)! #+2! &$'/#22'2! (<#2&#/,%/,=! ,! #)! #2(#0#),.#)*2! .%/$'#0'+1*,12! :1#! %9#/*#)! %+2! 3$%)2! 3$1&2! *%7');.,/2>! ?2! &#$! %,7;! :1#! #)! %:1#2*%! *#2,! #)2! @#.! &+%)*#A%*! (#9,),$! #+! /%$,'*,&! %)/#2*$%+! (#! .%.B9#$2C! %.),'*#2! ,! *#*$-&'(#2! &#$! %! &'(#$! (#*#$.,)%$! +#2! $#3,')2! /')2#$0%(#2!D!"#"$"%"&'()*+,-+./(0$"/1'C!EFG2H!,!+#2!$#3,')2!(#!*$#)/%.#)*!#0'+1*,1! D23"$&,."+45*(05-416".+,(7-%."+'C!IGJ2H!&%$*,)*!(#+!3#)'.%[email protected]!/'.!%!$#9#$6)/,%>! K$-/,#2! %! +%! ,)/+12,=! (#+! 3#)'.%! (<#2&6/,#2! "&,%5"&6! D3$%)'*%! ,! 3%++HC! @#.! &'31*! .,++'$%$! #+! /%$,'*,&! %)/#2*$%+! (#! *#*$-&'(#2! ,! %.),'*#2C! (#9,),)*! )'0#2! %22'/,%/,')2!
    [Show full text]
  • Genomic Dynamics of Transposable Elements in the Western Clawed Frog (Silurana Tropicalis)
    GBE Genomic Dynamics of Transposable Elements in the Western Clawed Frog (Silurana tropicalis) Jiangshan J. Shen1,3, Jonathan Dushoff1,AdamJ.Bewick1,Fre´de´ric J.J. Chain2,andBenJ.Evans1,* 1Department of Biology, McMaster University, Hamilton, Ontario, Canada 2Department of Evolutionary Ecology, Max Planck Institute for Evolutionary Biology, Plo¨ n, Germany 3Present address: Department of Pathology, The University of Hong Kong, Hong Kong, China *Corresponding author: E-mail: [email protected]. Accepted: April 18, 2013 Downloaded from Abstract Transposable elements (TEs) are repetitive DNA sequences that can make new copies of themselves that are inserted elsewhere in a host genome. The abundance and distributions of TEs vary considerably among phylogenetically diverse hosts. With the aim of exploring the basis of this variation, we evaluated correlations between several genomic variables and the presence of TEs and non-TE http://gbe.oxfordjournals.org/ repeats in the complete genome sequence of the Western clawed frog (Silurana tropicalis). This analysis reveals patterns of TE insertion consistent with gene disruption but not with the insertional preference model. Analysis of non-TE repeats recovered unique features of their genome-wide distribution when compared with TE repeats, including no strong correlation with exons and a particularly strong negative correlation with GC content. We also collected polymorphism data from 25 TE insertion sites in 19 wild-caught S. tropicalis individuals. DNA transposon insertions were fixed at eight of nine sites and at a high frequency at one of nine, whereas insertions of long terminal repeat (LTR) and non-LTR retrotransposons were fixed at only 4 of 16 sites and at low frequency at 12 of 16.
    [Show full text]
  • A Large Pseudoautosomal Region on the Sex Chromosomes of the Frog Silurana Tropicalis
    GBE A Large Pseudoautosomal Region on the Sex Chromosomes of the Frog Silurana tropicalis Adam J. Bewick1,Fre´de´ric J.J. Chain2, Lyle B. Zimmerman3, Abdul Sesay3, Michael J. Gilchrist3,Nick D.L. Owens3, Eva Seifertova4, Vladimir Krylov4, Jaroslav Macha4, Tereza Tlapakova4, Svatava Kubickova5, Halina Cernohorska5, Vojtech Zarsky4,andBenJ.Evans1,* 1Department of Biology, McMaster University, Hamilton, Ontario, Canada 2Max Planck Institute for Evolutionary Biology, Plo¨ n, Germany 3MRC National Institute for Medical Research, London, United Kingdom 4Charles University in Prague, Faculty of Science, Czech Republic 5Veterinary Research Institute, Brno, Czech Republic *Corresponding author: E-mail: [email protected]. Accepted: May 3, 2013 Data deposition: This project has been deposited at GenBank under the accession number SRP022004. Abstract Sex chromosome divergence has been documented across phylogenetically diverse species, with amphibians typically having cyto- logically nondiverged (“homomorphic”) sex chromosomes. With an aim of further characterizing sex chromosome divergence of an amphibian, we used “RAD-tags” and Sanger sequencing to examine sex specificity and heterozygosity in the Western clawed frog Silurana tropicalis (also known as Xenopus tropicalis). Our findings based on approximately 20 million genotype calls and approxi- mately 200 polymerase chain reaction-amplified regions across multiple male and female genomes failed to identify a substantially sized genomic region with genotypic hallmarks of sex chromosome divergence, including in regions known to be tightly linked to the sex-determining region. We also found that expression and molecular evolution of genes linked to the sex-determining region did not differ substantially from genes in other parts of the genome. This suggests that the pseudoautosomal region, where recombination occurs, comprises a large portion of the sex chromosomes of S.
    [Show full text]
  • Coexistence of Y, W, and Z Sex Chromosomes in Xenopus Tropicalis
    Coexistence of Y, W, and Z sex chromosomes in PNAS PLUS Xenopus tropicalis Álvaro S. Rocoa, Allen W. Olmsteadb,1, Sigmund J. Degitzb, Tosikazu Amanoc, Lyle B. Zimmermanc, and Mónica Bullejosa,2 aDepartment of Experimental Biology, Faculty of Experimental Sciences, University of Jaén, Las Lagunillas Campus S/N, 23071 Jaén, Spain; bMid-Continent Ecology Division, Environmental Protection Agency, Duluth, MN 55804; and cDivision of Developmental Biology, Medical Research Council-National Institute for Medical Research, London, NW7 1AA, United Kingdom Edited by David C. Page, Whitehead Institute, Cambridge, MA, and approved July 1, 2015 (received for review March 28, 2015) Homomorphic sex chromosomes and rapid turnover of sex-determin- (3, 16, 17). Nevertheless, not all sex chromosomes are morpho- ing genes can complicate establishing the sex chromosome system logically distinct. This lack of differentiation does not always in- operating in a given species. This difficulty exists in Xenopus tro- dicate a recent origin of the sex chromosomes, as is the case in picalis, an anuran quickly becoming a relevant model for genetic, ge- ratite birds and boid snakes (18, 19). Two hypotheses have been nomic, biochemical, and ecotoxicological research. Despite the recent proposed to explain the lack of differentiation between some pairs interest attracted by this species, little is known about its sex chromo- of sex chromosomes: (i) occasional recombination between them, some system. Direct evidence that females are the heterogametic sex, as could happen in sex-reversed individuals (20), and (ii)frequent as in the related species Xenopus laevis, has yet to be presented. turnover of sex chromosomes because of rapid changes of sex- Furthermore, X.
    [Show full text]