DOCSLIB.ORG

Anuran Adaptations to Climatic Stress: Immune Responses and the SMAD Family in the Wood Frog, Rana Sylvatica, and the African Clawed Frog, Xenopus Laevis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Anuran Adaptations to Climatic Stress: Immune Responses and the SMAD Family in the Wood Frog, Rana Sylvatica, and the African Clawed Frog, Xenopus Laevis Anuran adaptations to climatic stress: Immune responses and the SMAD family in the wood frog, Rana sylvatica, and the African clawed frog, Xenopus laevis by HELEN A. HOLDEN B. Sc. Honours - Carleton University, 2009 A THESIS SUBMITTED TO THE FACULTY OF GRADUATE AND POSTDOCTORAL AFFAIRS IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGY CARLETON UNIVERSITY OTTAWA, ONTARIO, CANADA © COPYRIGHT 2011 Helen A. Holden Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de Pedition 395 Wellington Street 395, rue Wellington OttawaONK1A0N4 OttawaONK1A0N4 Canada Canada Your file Votre r6f6rence ISBN: 978-0-494-83134-2 Our file Notre r6f4rence ISBN: 978-0-494-83134-2 NOTICE: AVIS: The author has granted a non­ L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non­ support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats. The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission. In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these. While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis. 1*1 Canada The undersigned hereby recommend to the Faculty of Graduate and Postdoctoral Affairs acceptance of the thesis entitled: "Anuran adaptations to climatic stress: Immune responses and the SMAD family in the wood frog, Rana sylvatica, and the African clawed frog, Xenopus laevis" submitted by HELEN A. HOLDEN B.Sc. Honours - Carleton University, 2009 In partial fulfillment of the requirements for the degree of Master of Science Chair, Biology Department Thesis Supervisor Carleton University 2011 II ABSTRACT The wood frog, Rana sylvatica, survives freezing over winter. The African clawed frog, Xenopus laevis, withstands substantial dehydration seasonally. The effects of environment on these frogs' immunity were investigated with a focus on antimicrobial peptides. Expression of brevinin-lSY was analyzed during freezing, dehydration, anoxia, and development in R. sylvatica. Brevinin-lSY responded differently to each stress, suggesting environmentally regulated expression. Upregulation of hepcidin mRNA was demonstrated during dehydration in X. laevis liver, as were hepcidin agonists, STAT 3 and cMYC. Alternatively, hepcidin antagonizing TGF-P-mediated SMADs were downregulated and the BMP-mediated SMADs, promoters of hepcidin expression, did not change. Molecular controls of X. laevis skeletal muscle growth were also explored during dehydration. Myostatin, a muscle growth antagonizer, was downregulated during dehydration, whereas cMYC, a muscle growth agonizer, and GLUT 4, a glucose transporter, were upregulated; differential control of SMADs was documented. The data suggest that, during estivation, muscle growth signals are promoted. in ACKNOWLEDGMENTS I would like to take this opportunity to formally thank both my supervisor Dr. KB Storey, and his wife, Jan Storey, for the knowledge, patience, and continuous support they have provided me over the past three plus years. I am so grateful for the opportunities to conduct this research, explore my passions, and grow as a scientist and individual. With your guidance and support, I have developed numerous lifelong skills including a few highly specialized ones like wrangling Xenopi and siphoning tadpole water! I would also like to emphasize my great appreciation for Jan Storey's enduring patience and assistance in the preparation of this thesis and her thorough reviews and edits of my works that have allowed me to better express myself in the scientific field. I would like to thank all my fellow Storey lab members past, present, and honorary. Your guidance, insights, and above all friendships have enriched my time inside and outside the lab and made for the best memories. And, a special thank you to Katrina and Shannon for being such excellent buddies - PCR was never as much fun as when we got to share that prime 12 o'clock time block. A big thank you to my family for your love, encouragement, and great confidence in my abilities (despite being quite sure you have no idea what I am doing with 'those proteins') and to Mike for always being there for me, for all the wonderful dinners I came home to, and for knowing just how to make me laugh. And finally, a salute to all the wee froggies who made the greatest sacrifice to my research, thank you. TABLE OF CONTENTS Title Page i Acceptance Sheet ii Abstract iii Acknowledgments iv Table of Contents v List of Abbreviations vi List of Figures x List of Appendices xii Chapter 1 General Introduction 1 Chapter 2 Developmental and environmental impacts on brevinin-lSY 19 expression in the wood frog, Rana sylvatica Chapter 3 Hepcidin antimicrobial peptides from the African clawed 49 frog, Xenopus laevis Chapter 4 Expression of SMAD transcription factors in the skeletal 100 muscle of the African clawed frog, Xenopus laevis Chapter 5 General Discussion 128 Appendices 142 References 145 v LIST OF ABBREVIATIONS Akt protein kinase B AMP antimicrobial peptide ANOVA analysis of variance APR acute phase response APS ammonium persulphate ATP adenosine triphosphate BHK baby hamster kidney BLAST basic local alignment search tool BMP bone morphogenetic protein bp base pair BWQ initial body water content cAMP cyclic adenosine monophosphate CBP CPvEB binding protein cDNA complementary deoxyribonucleic acid co-SMAD common partner SMAD CPvEB cAMP response element binding protein DEPC diethylpyrocarbonate dNTPs deoyxnucleotide triphosphate ddH20 double distilled H20 DTT dithiolthreitol EDTA ethylenediamine tetraacetic acid EMSA electrophoretic mobility shift assay vi ERK extracellular signal-regulated kinases E2F E2 promoter binding factor FoxO forkhead box, class O protein GDF growth differentiation factor GLUT4 glucose transporter 4 gpl30 glucoprotein 130 GSK-3P glycogen synthase kinase-3|3 HEPES N- (2-hydroxyethyl) piperazine-N'- (2- ethanesulfonic acid) HepG2 human hepatocellular liver carcinoma HJV hemojuvelin HRP horseradish peroxidise IGF-1 insulin-like growth factor 1 IL6 interleukin 6 INA ice nucleating active I-SMAD inhibitory SMAD JAKs Janus kinases JNK c-Jun N-terminal kinase kDa kilodalton MAPK mitogen-activated protein kinase Md mass during dehydration MEF2 myocyte enhancer factor-2 MH mad homology M, initial mass VII MODS multiple organ dysfunction syndrome MRD metabolic rate depression mRNA messenger RNA mTOR mammalian target of rapamycin Oligo-dT oligodeoxythymidylic acid PAGE polyacrylamide gel electrophoresis P-cMYC phosphorylated cMYC PCR polymerase chain reaction PGLa peptide with amino-terminal glycine & carboxy- terminal leucinamide PI3K phosphatidylinositol-3-OH kinase PKAc cAMP-activated protein kinase PKC protein kinase C PMSF phenylmethylsulfonyl fluoride poly d(I-C) poly-deoxy-inosinic-deoxy-cytidylic acid P-SMAD phosphorylated SMAD P-STAT phosphorylated STAT PVA polyvinyl acetate PVDF polyvinylidene fluoride RNA ribonucleic acid rRNA ribosomal RNA R-SMAD receptor regulated SMAD RT-PCR reverse transcriptase polymerase chain reaction SDS sodium dodecyl sulphate VIII SEM standard error of the mean SMAD small mothers against decapentaplegic SNK Student-Newman-Keuls SOCS3 suppressor of cytokine signaling 3 STAT 3 signal transducers and activators of transcription 3 TAE tris-acetate-ethylenediamine tetraacetic acid buffer Temed N,N,N' ,N' -tetramethylethylenediamine TBE tris/borate/EDTA TBST tris-buffered saline containing Tween-20 TGF-P transforming growth factor-P TH thyroid hormone Tris tris (hydroxymethyl) aminomethane UV ultraviolet IX LIST OF FIGURES FIG. 2.01 Partial nucleotide sequence of R. sylvatica brevinin-lSY 43 and comparison to other frog species. FIG. 2.02 Partial nucleotide and deduced amino acid sequence of 44 R. sylvatica brevinin-lSY. FIG. 2.03 Effects of freezing (24 h), anoxia (24 h), and dehydration 46 (40% total body water lost) on the mRNA expression of brevinin-lSY as determined by RT-PCR. FIG. 2.04 Effects of growth and metamorphosis through Gosner Stages 47 14-20, 21-25, 26-30, 31-35, 36-41, 42-43, and 44-45 on the mRNA expression of brevinin-lSY m.R. sylvatica as determined by RT-PCR. FIG. 2.05 Partial nucleotide and deduced amino acid sequence of 48 R. sylvatica unidentified mRNA. FIG. 3.01 Molecular events outlining the impact of the SMAD signalling 53 pathway on liver cells. FIG. 3.02 Partial nucleotide and deduced amino acid sequence of 77 X. laevis hepcidin I. FIG. 3.03 Partial nucleotide and deduced amino acid sequence of 79 X. laevis hepcidin II. FIG. 3.04 Effects of medium and high dehydration on the mRNA 81 expression of hepcidin I and hepcidin II mX. laevis liver. FIG. 3.05 Partial nucleotide and deduced amino acid sequence of 82 X. laevis SMAD 2. FIG. 3.06 Comparison of the partial African clawed frog (X. laevis) 84 SMAD 2 protein sequence with the corresponding region in SMAD 2 from other animals. FIG. 3.07 Effects of medium and high dehydration on the mRNA and 85 protein expression of SMAD 2 inX.
Load more

Recommended publications
  • Rapid Effects of Sex Steroids on PGF2 Approach Response in Zebrafish
    Rapid effects of sex steroids on PGF2� approach response in zebrafish (Danio rerio) Student Researcher: Leah B. Kratochvil, Advisor: Richmond R. Thompson Bowdoin College Department of Neuroscience Abstract Steroids are molecular messengers that regulate a variety of bodily functions, including behaviors and sexual motivation. Steroids have long been known to induce behavioral effects in days or weeks, but more recently have been discovered to effect these changes within seconds. Research surrounding these so-called “rapid” effects of steroids on sensory systems is lacking. I took advantage of the sophisticated sex pheromone system in zebrafish to study this system, and the male zebrafish approach response to the pre-ovulatory pheromone prostaglandin F2� (PGF2�). Sexually mature male zebrafish were treated with vehicle, T, or 11-ketotestosterone (11-KT) for 40 minutes, and then immediately evaluated for time spent near vehicle or PGF2� administered to their test tank. Initial data suggests that T-treated fish spent more time near the pheromone, indicating that T may rapidly modulate this response in zebrafish. There were no significant differences between treatments. Further investigation, with higher steroid and pheromone concentrations and a slightly different experimental design, is underway to confirm how T and/or 11-KT modulate(s) the male zebrafish approach response to PGF2�. Project Objectives Classically, steroids have been thought to act in the body by binding to intracellular receptors and inducing gene transcription, protein translation and ultimately behavioral responses. However, because this process – termed the “genomic” mechanism due to its interactions with the genome – takes time, these genomic behavioral effects usually take days or weeks to appear.
    [Show full text]
  • The Bone Marrow Niche in the Pathogenesis of Multiple Myeloma a Role for Wnt Signaling and Adrenomedullin
    A role for Wnt signaling and Adrenomedullin and signaling Wnt for A role Myeloma Multiple of niche in the pathogenesis marrow The bone The bone marrow niche in the pathogenesis of Multiple Myeloma A role for Wnt signaling and Adrenomedullin pracownia DTP i grafiki www.przygotowalniaDTP.pl ISBN 978-83-63861-16-2 Kinga Anna Kocemba okladka_nowa.indd 1-3 2014-01-20 11:57:46 The bone marrow niche in the pathogenesis of Multiple Myeloma A role for Wnt signaling and Adrenomedullin The bone marrow niche in the pathogenesis of Multiple Myeloma A role for Wnt signaling and Adrenomedullin Kinga Anna Kocemba The research described in this thesis was funded by the Dutch Cancer Society Editing Przygotowalnia Pracownia DTP i Grafiki Graphic design and typesetting Przygotowalnia Pracownia DTP i Grafiki Cover: Antelope Canyon, Arizona, USA by Kinga Anna Kocemba © Copyright by Kinga Anna Kocemba ISBN 978-83-63861-16-2 Amsterdam–Kraków 2014 Pracownia DTP i Grafiki ul. Łużycka 71c/9 30–693 Kraków [email protected] www.przygotowalniaDTP.pl Moim rodzicom To my parents The bone marrow niche in the pathogenesis of Multiple Myeloma A role for Wnt signaling and Adrenomedullin academisch proefschrift ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. dr. D.C. van den Boom ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Agnietenkapel op donderdag 6 maart 2014, te 14:00 uur door Kinga Anna Kocemba geboren te Oświęcim, Polen Promotiecommissie promotor Prof.
    [Show full text]
  • The Effect of Fluoxetine on Self-Control in Betta Splendens
    University of Montana ScholarWorks at University of Montana Graduate Student Theses, Dissertations, & Professional Papers Graduate School 2014 The effect of fluoxetine on self-control in betta splendens Kathryn Gwen Lamp The University of Montana Follow this and additional works at: https://scholarworks.umt.edu/etd Let us know how access to this document benefits ou.y Recommended Citation Lamp, Kathryn Gwen, "The effect of fluoxetine on self-control in betta splendens" (2014). Graduate Student Theses, Dissertations, & Professional Papers. 10770. https://scholarworks.umt.edu/etd/10770 This Dissertation is brought to you for free and open access by the Graduate School at ScholarWorks at University of Montana. It has been accepted for inclusion in Graduate Student Theses, Dissertations, & Professional Papers by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. THE EFFECT OF FLUOXETINE ON SELF-CONTROL IN BETTA SPLENDENS by KATHRYN GWEN LAMP Bachelor of Arts, Christopher Newport University, Newport News, VA, 2008 Master of Arts, The University of Montana, Missoula, MT, 2012 Dissertation presented in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Experimental Psychology The University of Montana Missoula, MT June 2014 Approved by: Dr. Allen Szalda-Petree, Chair Department of Psychology Dr. Nabil Haddad Department of Psychology Dr. Stuart Hall Department of Psychology Dr. Jerry Smith Department of Biomedical and Pharmaceutical Sciences Dr. Keith Parker Department of Biomedical and Pharmaceutical Sciences UMI Number: 3628951 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
    [Show full text]
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • Inbreeding Ratio and Genetic Relationships Among Strains of the Western Clawed Frog, Xenopus Tropicalis
    RESEARCH ARTICLE Inbreeding Ratio and Genetic Relationships among Strains of the Western Clawed Frog, Xenopus tropicalis Takeshi Igawa1¤*, Ai Watanabe1, Atsushi Suzuki1, Akihiko Kashiwagi1, Keiko Kashiwagi1, Anna Noble2, Matt Guille2, David E. Simpson3, Marko E. Horb4, Tamotsu Fujii5, Masayuki Sumida1 1 Institute for Amphibian Biology, Graduate School of Science, Hiroshima University, Higashi-Hiroshima, Hiroshima, Japan, 2 School of Biological Sciences, Institute of Biomedical and Biomolecular Science, University of Portsmouth, Portsmouth, United Kingdom, 3 The Wellcome Trust/Cancer Research UK Gurdon Institute, The Henry Wellcome Building of Cancer and Developmental Biology, University of Cambridge, Cambridge, United Kingdom, 4 Bell Center for Regenerative Biology and Tissue Engineering and National Xenopus Resource, Marine Biological Laboratory, Woods Hole, MA, United States of America, 5 Department of Health Sciences, Faculty of Human Culture & Science, Prefectural University of Hiroshima, Hiroshima, Japan ¤ Current Address: Division of Development Science, Graduate School of International Development and OPEN ACCESS Cooperation, Hiroshima University, Higashi-Hiroshima, Hiroshima, Japan * [email protected] Citation: Igawa T, Watanabe A, Suzuki A, Kashiwagi A, Kashiwagi K, Noble A, et al. (2015) Inbreeding Ratio and Genetic Relationships among Strains of the Western Clawed Frog, Xenopus tropicalis. PLoS Abstract ONE 10(7): e0133963. doi:10.1371/journal. pone.0133963 The Western clawed frog, Xenopus tropicalis, is a highly promising model amphibian, espe- Editor: Gert Jan C. Veenstra, Radboud University cially in developmental and physiological research, and as a tool for understanding disease. Nijmegen, NETHERLANDS It was originally found in the West African rainforest belt, and was introduced to the research Received: January 8, 2015 community in the 1990s.
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Housing, Husbandry and Welfare of a “Classic” Fish Model, the Paradise Fish (Macropodus Opercularis)
    animals Article Housing, Husbandry and Welfare of a “Classic” Fish Model, the Paradise Fish (Macropodus opercularis) Anita Rácz 1,* ,Gábor Adorján 2, Erika Fodor 1, Boglárka Sellyei 3, Mohammed Tolba 4, Ádám Miklósi 5 and Máté Varga 1,* 1 Department of Genetics, ELTE Eötvös Loránd University, Pázmány Péter stny. 1C, 1117 Budapest, Hungary; [email protected] 2 Budapest Zoo, Állatkerti krt. 6-12, H-1146 Budapest, Hungary; [email protected] 3 Fish Pathology and Parasitology Team, Institute for Veterinary Medical Research, Centre for Agricultural Research, Hungária krt. 21, 1143 Budapest, Hungary; [email protected] 4 Department of Zoology, Faculty of Science, Helwan University, Helwan 11795, Egypt; [email protected] 5 Department of Ethology, ELTE Eötvös Loránd University, Pázmány Péter stny. 1C, 1117 Budapest, Hungary; [email protected] * Correspondence: [email protected] (A.R.); [email protected] (M.V.) Simple Summary: Paradise fish (Macropodus opercularis) has been a favored subject of behavioral research during the last decades of the 20th century. Lately, however, with a massively expanding genetic toolkit and a well annotated, fully sequenced genome, zebrafish (Danio rerio) became a central model of recent behavioral research. But, as the zebrafish behavioral repertoire is less complex than that of the paradise fish, the focus on zebrafish is a compromise. With the advent of novel methodologies, we think it is time to bring back paradise fish and develop it into a modern model of Citation: Rácz, A.; Adorján, G.; behavioral and evolutionary developmental biology (evo-devo) studies. The first step is to define the Fodor, E.; Sellyei, B.; Tolba, M.; housing and husbandry conditions that can make a paradise fish a relevant and trustworthy model.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Zebrafish Embryos and Bioinformatics: Useful and Marketable Exercises for Students Enrolled in Upper-Level Undergraduate Courses
    2019 Eastern Biologist Special Issue 1 Zebrafish as a Model System for Research and Teaching A. Davis, H. Nguyen, and J. Qian 2019 Eastern Biologist Special Issue 1:47–63 Zebrafish Embryos and Bioinformatics: Useful and Marketable Exercises for Students Enrolled in Upper-Level Undergraduate Courses Adam Davis1*, Hong Nguyen1, and Jo Qian1 Abstract - The zebrafish (Danio rerio) is a widely used vertebrate model system in several branches of biological research, including molecular biology, developmental biology, and evolutionary biology. The rapid and transparent development of embryos outside of the mother allows for real- time observation of embryonic development of different types of organ systems. However, the types of wet-lab exercises involving zebrafish embryos that undergraduate students can perform during a 2-3 hour laboratory period are limited. Recent advances in bioinformatics applications and the availability of genomic sequence data from zebrafish and other evolutionarily divergent vertebrates, including human, allow students to be actively involved in semester-long molecular, evolutionary, and developmental biology projects that can be performed both in and out of the laboratory. In this paper, we report several exercises that can be used in upper level undergraduate biology courses that include a 2-3 hour weekly laboratory session. These exercises include amino acid and genomic DNA sequence alignment and gene expression analysis of Hoxa2, a developmental regulatory gene that is highly characterized in its expression and function. All exercises make use of standard operating procedures for training students on new techniques. The exercises presented will provide several learning outcomes for students, including the identification of conserved protein domains and cis- regulatory elements and how mutations to these motifs can lead to evolutionary diversity as well as the development of homeostatic imbalances in humans.
    [Show full text]
  • Lower Organisms As Alternatives for Toxicity Testing in Rodents with a Focus on Ceanorhabditis Elegans and the Zebrafish (Danio Rerio)
    Report 340720003/2009 L.T.M. van der Ven Lower organisms as alternatives for toxicity testing in rodents With a focus on Ceanorhabditis elegans and the zebrafish (Danio rerio) RIVM report 340720003/2009 Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabditis elegans and the zebrafish (Danio rerio) L.T.M. van der Ven Contact: L.T.M. van der Ven Laboratory for Health Protection Research [email protected] This investigation has been performed by order and for the account of the Ministry of Health, Welfare and Sport, within the framework of V/340720 Alternatives for animal testing RIVM, P.O. Box 1, 3720 BA Bilthoven, the Netherlands Tel +31 30 274 91 11 www.rivm.nl © RIVM 2009 Parts of this publication may be reproduced, provided acknowledgement is given to the 'National Institute for Public Health and the Environment', along with the title and year of publication. RIVM report 340720003 2 Abstract Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabiditis elegans and the zebrafish (Danio rerio) The nematode C. elegans and the zebrafish embryo are promising alternative test models for assessment of toxic effects in rodents. Tests with these lower organisms may have a good predictive power for effects in humans and are thus complementary to tests with in vitro models (cell cultures). However, all described tests need further validation. This is the outcome of a literature survey, commissioned by the ministry of Health, Welfare and Sport of the Netherlands. The survey is part of the policy to reduce, refine and replace animal testing (3R policy).
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Identification of QTL for Resistance Against Two Fungal Pathogens, Pyrenophora Teres F
    Fluturë Novakazi Institut für Resistenzforschung und Stresstoleranz Identification of QTL for resistance against two fungal pathogens, Pyrenophora teres f. teres and Bipolaris sorokiniana, in a barley (Hordeum vulgare L.) diversity set Dissertationen aus dem Julius Kühn-Institut Julius Kühn-Institut Bundesforschungsinstitut für Kulturpflanzen Kontakt | Contact: Fluturë Novakazi Beethovenstraße 24 18069 Rostock Die Schriftenreihe ,,Dissertationen aus dem Julius Kühn-lnstitut“ veröffentlicht Doktorarbeiten, die in enger Zusammenarbeit mit Universitäten an lnstituten des Julius Kühn-lnstituts entstan- den sind. The publication series „Dissertationen aus dem Julius Kühn-lnstitut“ publishes doctoral disser- tations originating from research doctorates and completed at the Julius Kühn-Institut (JKI) either in close collaboration with universities or as an outstanding independent work in the JKI research fields. Der Vertrieb dieser Monographien erfolgt über den Buchhandel (Nachweis im Verzeichnis liefer- barer Bücher - VLB) und OPEN ACCESS unter: https://www.openagrar.de/receive/openagrar_mods_00005667 The monographs are distributed through the book trade (listed in German Books in Print - VLB) and OPEN ACCESS here: https://www.openagrar.de/receive/openagrar_mods_00005667 Wir unterstützen den offenen Zugang zu wissenschaftlichem Wissen. Die Dissertationen aus dem Julius Kühn-lnstitut erscheinen daher OPEN ACCESS. Alle Ausgaben stehen kostenfrei im lnternet zur Verfügung: http://www.julius-kuehn.de Bereich Veröffentlichungen. We advocate open access to scientific knowledge. Dissertations from the Julius Kühn-lnstitut are therefore published open access. All issues are available free of charge under http://www.julius-kuehn.de (see Publications). Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation In der Deutschen Nationalbibliografie: detaillierte bibliografische Daten sind im lnternet über http://dnb.d-nb.de abrufbar.
    [Show full text]