Efficient targeted gene disruption in the soma and germ line of the frog Xenopus tropicalis using engineered zinc-finger nucleases John J. Younga, Jennifer M. Cheroneb, Yannick Doyonb, Irina Ankoudinovab, Farhoud M. Farajib, Andrew H. Leeb, Catherine Ngob, Dmitry Y. Guschinb, David E. Paschonb, Jeffrey C. Millerb, Lei Zhangb, Edward J. Rebarb, Philip D. Gregoryb, Fyodor D. Urnovb, Richard M. Harlanda,1, and Bryan Zeitlerb aDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3200; and bSangamo BioSciences, Inc., Richmond, CA 94804 Edited* by John Gerhart, University of California, Berkeley, CA, and approved March 10, 2011 (received for review February 7, 2011) The frog Xenopus, an important research organism in cell and de- To develop conditions for gene disruption in X. tropicalis,we velopmental biology, currently lacks tools for targeted mutagen- made use of transgenic animals carrying a single-copy GFP esis. Here, we address this problem by genome editing with zinc- transgene (14). Wild-type X. tropicalis eggs were fertilized with finger nucleases (ZFNs). ZFNs directed against an eGFP transgene in sperm from a homozygous GFP transgenic male. The resulting Xenopus tropicalis induced mutations consistent with nonhomol- heterozygous embryos were injected with mRNA-encoding ZFNs ogous end joining at the target site, resulting in mosaic loss of the that target the eGFP coding region (15). Uninjected tadpoles ex- fluorescence phenotype at high frequencies. ZFNs directed against press GFP robustly in the somites, lens, and head musculature the noggin gene produced tadpoles and adult animals carrying up (Fig. 1 A and B). Injection of 20 pg eGFP ZFN RNAs led to mosaic to 47% disrupted alleles, and founder animals yielded progeny loss of fluorescence in otherwise healthy tadpoles (Fig. 1 E and F). carrying insertions and deletions in the noggin gene with no in- At a higher dose of ZFNs, most cells had lost fluorescence, sug- dication of off-target effects. Furthermore, functional tests dem- gesting efficient somatic mutation of the transgene (Fig. 1 H and I). onstrated an allelic series of activity between three germ-line To determine whether loss of fluorescence resulted from a BIOLOGY mutant alleles. Because ZFNs can be designed against any locus, fi ZFN-induced mutation in the eGFP transgene, we rst genotyped DEVELOPMENTAL our data provide a generally applicable protocol for gene disrup- the target locus using an assay based on the mismatch-sensitive tion in Xenopus. endonuclease, Cel-1 (8). This analysis (Fig. 1J) demonstrated that ZFN-treated, but not control, tadpoles had acquired a DNA se- rogs of the genus Xenopus have been an important model quence alteration in the stretch targeted by the ZFNs. Sequencing Forganism for cell and developmental biologists since the subsequently revealed that individual tadpoles often carried 1930s (1). Xenopus laevis is the standard model, but is allote- multiple distinct indels ranging from 5 to 20 bp centered over traploid and hence less suited for genetic approaches than the the ZFN recognition site (Fig. 1K), a signature of mutagenic diploid Xenopus tropicalis, whose genome sequence has been NHEJ. Taken together, these experiments show that ZFN mRNA determined (2). Whereas embryological manipulations and gain- injection into the two-cell embryo yields tadpoles without de- of-function experiments are major strengths of Xenopus, reverse tectable developmental defects that exhibit both genetic and genetics is currently limited to the use of antisense reagents that phenotypic mosaicism for the ZFN-targeted locus and trait, provide transient and often incomplete gene knockdown (3). The respectively. To determine whether this approach can be used to disrupt an ability to introduce targeted, heritable mutations that disrupt endogenous gene, we designed ZFNs that target the noggin locus. gene function has remained elusive. Noggin is a bone morphogenetic protein (BMP) antagonist that Here, we provide a generally applicable solution to this prob- contributes to dorsal/ventral patterning during gastrulation in lem: targeted gene disruption with designed zinc-finger nucleases fi Xenopus (16). Although its function in later development has been (ZFNs). ZFNs are the fusion of the nonspeci c cleavage domain studied in human patients (17) and mice (18–21), its de- of the type IIS restriction enzyme FokI to a zinc-finger protein fi velopmental role in nonmammalian vertebrates remains poorly (4, 5) that is engineered to bind a speci c genomic locus to in- understood. Noggin is expressed at stages when knockdown via duce a targeted double-strand break (DSB). Pioneering studies morpholinos is not effective. Therefore, mutant alleles of the en- in oocytes of X. laevis (6) and subsequent work in Drosophila (7) dogenous noggin gene are required to probe its role throughout showed the mutagenic potential of a DSB induced by ZFNs amphibian development. (reviewed in refs. 10 and 11). Resolution of ZFN-induced DSBs We designed a panel of ZFNs targeting noggin, screened them via nonhomologous end joining (NHEJ) generates small inser- in a budding yeast proxy system (22), and cloned the ZFNs into tions and deletions that often produce null or hypomorphic an expression construct that allows the synthesis of an efficiently alleles (7, 9, 12). translated mRNA with a stabilizing polyadenylation signal (23). In the present work, we set out to develop an effective pro- Embryos were injected in the animal pole, and mRNA was de- tocol for gene disruption in X. tropicalis. Using ZFNs designed against a reporter transgene and the noggin locus, we optimized delivery and expression conditions and attained high frequencies Author contributions: J.J.Y., F.D.U., R.M.H., and B.Z. designed research; J.J.Y., J.M.C., Y.D., of somatic and germ-line mutations that were transmissible to F.M.F., A.H.L., C.N., and B.Z. performed research; I.A., D.Y.G., D.E.P., J.C.M., L.Z., E.J.R., and P.D.G. contributed new reagents/analytic tools; J.J.Y., J.M.C., Y.D., F.M.F., A.H.L., C.N., F.D.U., the next generation. R.M.H., and B.Z. analyzed data; and J.J.Y., F.D.U., R.M.H., and B.Z. wrote the paper. Conflict of interest statement: J.M.C., Y.D., I.A., F.M.F., A.H.L., C.N., D.Y.G., D.E.P., J.C.M., Results L.Z., E.J.R., P.D.G., F.D.U., and B.Z. are current or past employees of Sangamo Biosciences, Inc. Xenopus eggs are large and easily manipulated (13), offering the *This Direct Submission article had a prearranged editor. opportunity to deliver ZFNs via injection of mRNA, a method 1To whom correspondence should be addressed. E-mail: [email protected]. that has been successful in bringing about ZFN-driven gene This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. disruption in other organisms (10, 11). 1073/pnas.1102030108/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1102030108 PNAS Early Edition | 1of6 Downloaded by guest on October 1, 2021 A D G U.C. 20 pg eGFP ZFNs 50 pg eGFP ZFNs B E H U.C. 20 pg eGFP ZFNs 50 pg eGFP ZFNs C F I eGFP ZFN L eGFP ZFN R J 20 pg 50 pg K Gln Leu Gln Gln Pro Gln Arg Leu Tyr His Gly Arg Gln WT CAACTACAACAGCCACAACGTCTATATCATGGCCGACAAG CAACTACAACAGCCACAACGT---TATCATGGCCGACAAG( 3) 1 2 3 1 2 3 UC CAACTACA------------TCTATATCATGGCCGACAAG( 12) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) 345 bp CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAGCCACAACGT-----------CCGACAAG( 11) Deletions CAACTACAACAGCCACAAC-----TATCATGGCCGACAAG( 5) 246 bp CAACTACAACAGC--------------CATGGCCGACAAG( 14) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAGC--------------CATGGCCGACAAN( 14) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAG--------------------CCGACAAG( 20) CAACTACAACAGC--------------CATGGCCGACAAG( 14) CAACTACAACAGCCACAA--------TCATGGCCGACAAG( 8) GAACTACAACAGCCACAACGTGTGT--CATGGCCGACAAG( 6,+4) 99 bp CAACTACAACAGCCACAACAA------CA--GCCGACAAG( 12,+4) Indels CAACTACAACAGT--------------CATGGCCGACAAG( 15,+1) CAACTACAACAG----AA------------AGCCGACAAG( 19,+3) CAACTACAACAGCCACAAC----GGATCATGGCCGACAAG( 6,+2) %%NHEJ NHEJ 16 11 11 19 17 24 Insertions CAACTACAACAGCCACAACGTCTATATATCATGGCCGACA(+2) Fig. 1. Disruption of the eGFP transgene in X. tropicalis using ZFNs. (A–C) Uninjected tadpoles (U.C.). (D–F) Tadpoles injected with 20 pg of eGFP ZFN mRNA and 200 pg mCherry RNA (to monitor injection). (G–I) Heterozygous eGFP tadpoles injected with 50 pg eGFP ZFN mRNA and 200 pg mCherry RNA (tracer). (A, D, and G) Brightfield. (B, E,andH) eGFP expression of tadpoles in A, D, and G, respectively. (C, F, and I) Enlarged view of eGFP expression in B, E, and H, respectively. (J) Cel-1 digestion of eGFP amplicons. Bands migrating at 345 bp are full-length amplicons; Cel-1 cleavage products migrate at 246 and 99 bp. The fractions of modified chromatids detected by Cel-1 are quantified as percentage NHEJ. UC, uninjected control. (K) Sequence alignment of ZFN-induced mutant eGFP transgene alleles from tadpoles injected with 50 pg ZFN mRNA. Red nucleotides indicate insertions and dashes represent deletions. Horizontal bold lines at top indicate ZFN-binding sites. posited in the center of each blastomere at the two-cell stage and ded efficient genome editing in Xenopus embryos as measured by raised to stage 40, and DNA was isolated from tadpoles that sequencing noggin amplicons from injected tadpoles. exhibited broad mCherry (i.e., tracer) expression. Use of ZFNs Because no Xenopus strains carrying noggin mutations exist, we carrying a wild-type FokI endonuclease domain yielded a signif- were unable to screen for phenotypes on a heterozygous back- icant fraction of embryos with developmental defects (Fig. 2A). ground (22) and instead screened the ZFNs for activity by gen- However, this was alleviated by expressing the same zinc-finger otyping the targeted region using the Cel-1 endonuclease (Fig. DNA recognition domains fused to the obligate heterodimer 3A).