DOCSLIB.ORG

Sex Chromosome and Sex Determination Evolution in African Clawed Frogs (Xenopus and Silurana)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sex Chromosome and Sex Determination Evolution in African Clawed Frogs (Xenopus and Silurana) Sex chromosome and sex determination evolution in African clawed frogs (Xenopus and Silurana) Sex chromosome and sex determination evolution in African clawed frogs (Xenopus and Silurana) Adam J Bewick, B.Sc. Hons., B.Ed. A Thesis Submitted to the School of Graduate Studies in Partial Fulfilment of the Requirements for the Degree Doctor of Philosophy McMaster University c Copyright by Adam J Bewick, December 2012 DOCTOR OF PHILOSOPHY (2012) McMaster University (Biology) Hamilton, Ontario TITLE: Sex chromosome and sex determination evolution in African clawed frogs (Xeno- pus and Silurana) AUTHOR: Adam J Bewick, B.Sc. Hons., (Laurentian University), B.Ed. (Laurentian Uni- versity) SUPERVISOR: Dr. Ben J Evans NUMBER OF PAGES: [xi], 142 ii ABSTRACT Sex chromosomes have evolved independently multiple times in plants and animals. Ac- cording to sex chromosome evolution theory, the first step is taken when an autosomal mutation seizes a leading role in the sex determining pathway, such that heterozygotes develop into one sex, and homozygotes into the other. In the second step, sexually antag- onistic mutations are expected to accumulate in the vicinity of this gene, benefiting from linkage disequilibrium. Recombination in the heterogametic sex is suppressed because of mutations that eliminate homology between the sex chromosomes, providing epistatic inter- actions between the sex determining and sexually antagonistic genes. However, suppressed recombination also lowers the efficacy of selection causing accumulation of deleterious mutations. Additionally large segments of non-functional DNA can be deleted in the sex chromosome and can reduce their physical size. Collectively, this leads to divergence be- tween non-recombining portions of each sex chromosome, causing drastic differences at the sequence level and cytologically. However, sex chromosome degeneration is not always the case, and evolutionarily old, and young, but nondegenerate sex chromosomes have been ob- served. African clawed frogs (Xenopus and Silurana) have homomorphic sex chromosomes due to a recent turnover event. However, occasional recombination between the sex chro- mosomes may contribute to the maintenance of homomorphic sex chromosomes in African clawed frogs. Mechanisms that prevent divergence and heteromorphy of sex chromosomes may be related to polyploidization, which is frequently observed in African clawed frogs. The studies herein construct a phylogenetic framework to test alternative hypotheses for selection on sex-linked and autosomal genes involved in sex determination, map sex chro- mosomes and compare sex chromosomes across African clawed frogs. I have also explored the relationship between phenomena like recent turnover events, recombination and poly- ploidization to sex chromosome degeneration (or lack thereof). In this dissertation, I have discussed the potential for multiple mechanisms of sex determination and the unique pseu- doautosomal nature of sex chromosomes within this group of frogs. This body of work provides a comprehensive study of sex chromosomes in a group lacking phylogenetic res- olution, anura, and sheds light on the origin and evolution of sex chromosomes in other organisms. iii ACKNOWLEDGEMENTS My academic career would not exist without Ben Evans. I thank my supervisor for his commitment, relentless encouragement and guidance on successful and many unsuccessful research projects, unprecedented enthusiasm and humour, for inadvertently introducing me to my wife, and for allowing me to have a life outside of the lab. My committee members Drs. Brian Golding, JP Xu and Jonathon Stone for pushing me to know and do more. Past undergraduate supervisors Drs. Albrecht Schulte-Hostedde and Thomas Merritt for their continual support and encouragement. I am also grateful to Dr. Wilfried Haerty and Wilson Sung for contributing their time to ease my suffering with bioinformatics. Many other students (past and present) have provided support, among them Drs. Melanie Lou, Carlo Artieri and Abha Ahuja, and many more who deserved to be mentioned Members of the Evans lab that I had the privilege to interact with over many years. Dr. Freddy Chain and Mr. Iqbal Setiadi were among the first to entertain me and I am greatly honoured to have worked along side them. Mrs. Shireen Bliss, Ms. Tia Harrison, Ms. Simone Mendel and Ms. Laura Pin for their help with my frog duties and various research projects. I especially acknowledge Simone for her unwavering work ethic and dedication to research. Master Jane Shen for being brave and trying new things, Hermina Ghenu for teaching me something new every day, and Ben Furman for putting up with my antics and for being an outstanding field companion in South Africa. My family and friends for their unwavering support and curiosity of my progression in my studies. My family for always reminding me that I still have a thesis to complete. My wife Emily for emotional and academic support, and for leaning on me as much as I have leaned on her. iv DECLARATION OF ACADEMIC ACHIEVEMENT Each chapter of this thesis has been written as a separate manuscript accepted for publica- tion with the exception of Chapter 4, which is a manuscript in preparation. Data collection, programming, analysis and manuscript preparation for each chapter was primarily an in- dividual effort, with contributions in data preparation, analysis and editing from Dave W Anderson, Fred´ eric´ JJ Chain, Ben J Evans, Joseph Heled, and from collaborators at the MRC National Institute for Medical Research in London, Charles University in Prague and the Veterinary Research Institute in the Czech Republic. v TABLE OF CONTENTS I INTRODUCTION 1 1 The pipid root 6 1.1 Preface . .6 1.2 Abstract . .6 1.3 Introduction . .7 1.4 Materials and methods . 10 1.4.1 Taxon sampling and multilocus data . 10 1.4.2 Gene tree estimation . 13 1.4.3 Concatenated analysis . 13 1.4.4 Species tree estimation – BEST and *BEAST . 14 1.5 Results . 15 1.5.1 Analysis of individual and concatenated loci . 16 1.5.2 Multilocus coalescent analysis . 19 1.6 Discussion . 22 1.6.1 Biogeographical implications . 24 1.7 Conclusions . 27 1.8 Acknowledgements . 28 1.9 Supplementary information . 28 2 Evolution of the closely related, sex-related genes DM-W and DMRT1 in African clawed frogs (Xenopus) 34 2.1 Preface . 34 2.2 Abstract . 34 2.3 Introduction . 35 2.4 Methods . 38 2.4.1 Genetic samples, phylogenetic estimation, codon analysis . 38 2.4.2 Multilocus polymorphism data . 39 2.4.3 Phylogenetically biased pseudogenization . 39 2.4.4 Expression divergence . 40 2.5 Results . 41 2.5.1 DM-W arose after divergence of Xenopus and Silurana but before divergence of X. laevis and X. clivii ................. 41 vi 2.5.2 DM-W evolved under natural selection . 45 2.5.3 Biased pseudogenization of DMRT1 paralogs after allopolyploid- ization . 49 2.5.4 DMRT1α expression is regulated by distinct mechanisms over de- velopment . 52 2.6 Discussion . 54 2.6.1 Marginalized expression of DMRT1β ................ 56 2.7 Conclusions . 57 2.8 Acknowledgements . 58 2.9 Supplementary information . 58 3 A large pseudoautosomal region on the sex chromosomes of the frog Silurana tropicalis 68 3.1 Preface . 68 3.2 Abstract . 68 3.3 Introduction . 69 3.3.1 Frog sex chromosomes . 70 3.4 Methods . 72 3.4.1 Genome-wide distribution of genotypes in female and male S. trop- icalis ................................. 76 3.4.2 Expression and molecular evolution . 77 3.5 Results . 78 3.5.1 Mitochondrial DNA variation within S. tropicalis, including the “golden” strain . 78 3.5.2 Reduced representation genome-wide genotyping from RAD tags . 80 3.5.3 Genome-wide genotype patterns and nucleotide diversity similar in males and females . 80 3.5.4 Genotype patterns based on Sanger sequencing . 83 3.5.5 Gene expression and molecular evolution . 85 3.6 Discussion . 85 3.6.1 Polyploidization, dosage compensation and sex chromosome turnover . 87 3.7 Conclusions . 88 3.8 Acknowledgements . 89 3.9 Supplementary information . 89 4 The sex chromosomes of frogs 97 4.1 Preface . 97 4.2 Abstract . 97 4.3 Introduction . 98 4.4 Evidence for recent evolution of sex chromosomes in frogs . 103 vii 4.5 Low rates of recombination may be sufficient to maintain homomorphic sex chromosomes in frogs . 106 4.6 Absence of a global mechanism of dosage compensation may effect sex chromosome evolution . 108 4.7 Homomorphic sex chromosomes and the rate of polyploidization . 109 4.8 Conclusions . 112 II CONCLUSION 114 III REFERENCES 117 viii List of Figures 1.1 Relationships among pipoid frogs . .9 1.2 Gene family extinction or missing data could generate misleading phyloge- netic affinities . 12 1.3 Evolution of the Atlantic ocean and of pipoid frogs . 16 1.4 Descriptive information about data analyzed in this study . 17 1.5 Posterior probability distribution of each of the 15 possible rooted topolo- gies recovered from analysis of 114 individual alignments . 18 1.6 Consensus species trees from *BEAST analyses . 22 1.S1 Posterior densities of mutation rates from *BEAST analysis 3 with the HKY codon model . 32 1.S2 Posterior densities of relative mutation rate from *BEAST analysis 3 with the HKY codon model . 32 2.1 Regions of homology between DM-W and DMRT1 and proposed competi- tive binding during sexual differentiation of females . 36 2.2 Autosomal genes are duplicated by allopolyploidization but sex-linked genes are not . 37 2.3 Phylogenetic distribution of DM-W in Xenopus ............... 42 2.4 DM-W originated after divergence of Silurana and Xenopus ......... 44 2.S1 Phylogenetic relationships estimated using additional partial data from other DMRT1 paralogs . 62 2.S2 Alternative scenarios for evolution of DM-W ................ 67 3.1 Genotypic scenarios for sex linked regions . 77 3.2 Phylogenetic analysis of the commercially obtained samples used for RAD tags suggests an origin from a population in Nigeria . 79 3.3 Nucleotide diversity (π) in 500,000 bp windows is similar in males and females throughout much of the S.
Load more

Recommended publications
  • Para Conhecer a Terra: Memórias E Notícias De Geociências No Espaço Lusófono Autor(Es): Lopes, F.C. (Coord.); Andrade, A. I
    Para conhecer a Terra: memórias e notícias de Geociências no espaço lusófono Lopes, F.C. (coord.); Andrade, A. I. (coord.); Henriques, M. H. (coord.); Autor(es): Quinta-Ferreira, M. (coord.); Reis, R. Pena dos (coord.); Barata, M. T. (coord.) Publicado por: Imprensa da Universidade de Coimbra URL persistente: URI:http://hdl.handle.net/10316.2/24406 DOI: DOI:http://dx.doi.org/10.14195/978-989-26-0534-0 Accessed : 11-Oct-2021 03:52:55 A navegação consulta e descarregamento dos títulos inseridos nas Bibliotecas Digitais UC Digitalis, UC Pombalina e UC Impactum, pressupõem a aceitação plena e sem reservas dos Termos e Condições de Uso destas Bibliotecas Digitais, disponíveis em https://digitalis.uc.pt/pt-pt/termos. Conforme exposto nos referidos Termos e Condições de Uso, o descarregamento de títulos de acesso restrito requer uma licença válida de autorização devendo o utilizador aceder ao(s) documento(s) a partir de um endereço de IP da instituição detentora da supramencionada licença. Ao utilizador é apenas permitido o descarregamento para uso pessoal, pelo que o emprego do(s) título(s) descarregado(s) para outro fim, designadamente comercial, carece de autorização do respetivo autor ou editor da obra. Na medida em que todas as obras da UC Digitalis se encontram protegidas pelo Código do Direito de Autor e Direitos Conexos e demais legislação aplicável, toda a cópia, parcial ou total, deste documento, nos casos em que é legalmente admitida, deverá conter ou fazer-se acompanhar por este aviso. pombalina.uc.pt digitalis.uc.pt 9 789892 605111 Série Documentos A presente obra reúne um conjunto de contribuições apresentadas no I Congresso Imprensa da Universidade de Coimbra Internacional de Geociências na CPLP, que decorreu de 14 a 16 de maio de 2012 no Coimbra University Press Auditório da Reitoria da Universidade de Coimbra.
    [Show full text]
  • Effects of Emerging Infectious Diseases on Amphibians: a Review of Experimental Studies
    diversity Review Effects of Emerging Infectious Diseases on Amphibians: A Review of Experimental Studies Andrew R. Blaustein 1,*, Jenny Urbina 2 ID , Paul W. Snyder 1, Emily Reynolds 2 ID , Trang Dang 1 ID , Jason T. Hoverman 3 ID , Barbara Han 4 ID , Deanna H. Olson 5 ID , Catherine Searle 6 ID and Natalie M. Hambalek 1 1 Department of Integrative Biology, Oregon State University, Corvallis, OR 97331, USA; [email protected] (P.W.S.); [email protected] (T.D.); [email protected] (N.M.H.) 2 Environmental Sciences Graduate Program, Oregon State University, Corvallis, OR 97331, USA; [email protected] (J.U.); [email protected] (E.R.) 3 Department of Forestry and Natural Resources, Purdue University, West Lafayette, IN 47907, USA; [email protected] 4 Cary Institute of Ecosystem Studies, Millbrook, New York, NY 12545, USA; [email protected] 5 US Forest Service, Pacific Northwest Research Station, Corvallis, OR 97331, USA; [email protected] 6 Department of Biological Sciences, Purdue University, West Lafayette, IN 47907, USA; [email protected] * Correspondence [email protected]; Tel.: +1-541-737-5356 Received: 25 May 2018; Accepted: 27 July 2018; Published: 4 August 2018 Abstract: Numerous factors are contributing to the loss of biodiversity. These include complex effects of multiple abiotic and biotic stressors that may drive population losses. These losses are especially illustrated by amphibians, whose populations are declining worldwide. The causes of amphibian population declines are multifaceted and context-dependent. One major factor affecting amphibian populations is emerging infectious disease. Several pathogens and their associated diseases are especially significant contributors to amphibian population declines.
    [Show full text]
  • L. Lacey Knowles
    Curriculum Vitae L. Lacey Knowles Department of Ecology and Evolutionary Biology E-mail: [email protected] Museum of Zoology, University of Michigan Orcid ID: 0000-0002-6567-4853 Ann Arbor, MI 48109-1079 POSITIONS 2015-present, Robert B. Payne Collegiate Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2012-2015, Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2008-2012, Associate Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2003-2008, Assistant Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan ACADEMIC APPOINTMENTS: Science Communication Fellow, Museum of Natural History, University of Michigan Member, Center for statistical Genetics, University of Michigan NIH Training Program in Genome Sciences, University of Michigan EDUCATION 2001-2002 NIH Postdoctoral Fellowship (PERT: Postdoctoral Excellence in Research and Teaching) awarded through the Center for Insect Science at the University of Arizona 1999-2001 Postdoctoral Fellowship from the National Science Foundation Research Training Group in the Analysis of Biological Diversification at the University of Arizona 1999 Ph.D., Ecology and Evolution, State University of New York at Stony Brook Dissertation title: Genealogical portraits of Pleistocene speciation and diversity patterns in montane grasshoppers 1993 M.S., Zoology, University of South Florida. Thesis title: Effects of habitat structure on community assemblages of epifaunal macroinvertebrates in seagrass systems. 1989 B.S., cum laude with honors in Marine Biology, University of North Carolina, Wilmington RESEARCH INTERESTS Speciation and processes that promote divergence Phylogenomics and statistical phylogeography Evolutionary consequences of climate change HONORS AND AWARDS *Fulbright U.S.
    [Show full text]
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Inbreeding Ratio and Genetic Relationships Among Strains of the Western Clawed Frog, Xenopus Tropicalis
    RESEARCH ARTICLE Inbreeding Ratio and Genetic Relationships among Strains of the Western Clawed Frog, Xenopus tropicalis Takeshi Igawa1¤*, Ai Watanabe1, Atsushi Suzuki1, Akihiko Kashiwagi1, Keiko Kashiwagi1, Anna Noble2, Matt Guille2, David E. Simpson3, Marko E. Horb4, Tamotsu Fujii5, Masayuki Sumida1 1 Institute for Amphibian Biology, Graduate School of Science, Hiroshima University, Higashi-Hiroshima, Hiroshima, Japan, 2 School of Biological Sciences, Institute of Biomedical and Biomolecular Science, University of Portsmouth, Portsmouth, United Kingdom, 3 The Wellcome Trust/Cancer Research UK Gurdon Institute, The Henry Wellcome Building of Cancer and Developmental Biology, University of Cambridge, Cambridge, United Kingdom, 4 Bell Center for Regenerative Biology and Tissue Engineering and National Xenopus Resource, Marine Biological Laboratory, Woods Hole, MA, United States of America, 5 Department of Health Sciences, Faculty of Human Culture & Science, Prefectural University of Hiroshima, Hiroshima, Japan ¤ Current Address: Division of Development Science, Graduate School of International Development and OPEN ACCESS Cooperation, Hiroshima University, Higashi-Hiroshima, Hiroshima, Japan * [email protected] Citation: Igawa T, Watanabe A, Suzuki A, Kashiwagi A, Kashiwagi K, Noble A, et al. (2015) Inbreeding Ratio and Genetic Relationships among Strains of the Western Clawed Frog, Xenopus tropicalis. PLoS Abstract ONE 10(7): e0133963. doi:10.1371/journal. pone.0133963 The Western clawed frog, Xenopus tropicalis, is a highly promising model amphibian, espe- Editor: Gert Jan C. Veenstra, Radboud University cially in developmental and physiological research, and as a tool for understanding disease. Nijmegen, NETHERLANDS It was originally found in the West African rainforest belt, and was introduced to the research Received: January 8, 2015 community in the 1990s.
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Baez NHM 1997.Pdf (3.622Mb)
    HERP QL 668 B33 l':iif;,O0i.U'.Z06l("'^ ocxentxpc Papers Natural History Museum The University of Kansas 29 October 1997 Number 4:1^1 Redescription of the Paleogene Shelania pascuali from Patagonia and Its Bearing on the Relationships of Fossil and Recent Pipoid Frogs >. By o O Ana Maria BAez^ and Linda Trueb- o ^Departamento de Geologia, FacuUad de Ciencias Exactas, Universidad de 0) w >. > t- Buenos Aires, Pabellon II, Ciudad Universitaria, 1428 Buenos Aires, Argentina CO !-> >^ ^ £ -^ '^Division of Herpetology, Natural Histoiy Museum, and Department of P Kansas 66045-2454, J3 o, Systematics and Ecology, The University of Kansas, Lawrence, USA a o t3 o CO ^ t. CONTENTS ° CO I ABSTRACT 2 « RESUMEN 2 5S INTRODUCTION 2 Previous Paleontological Work 4 Acknowledgments 4 MATERIALS AND METHODS 5 General Methodology 5 Cladistic Methodology 5 Specimens Examined 6 STRATIGRAPHIC PROVENANCE AND AGE OF MATERIAL 6 REDESCRIPTION OF SHELANIA 8 ANALYSIS OF CHARACTERS 16 RESULTS 31 DISCUSSION 35 Taxonomic Considerations 35 Characters 36 LITERATURE CITED 37 APPENDIX 40 © Natural History Museum, The University of Kansas ISSN No. 1094-0782 — 2 Scientific Papers, Natural History Museum, The University of Kansas 1960, is redescribed on the basis of a series of 30 recently I ABSTIMCT Shdania pascuali Casamiquela, .'-\ ' . discovered specimens, which range in estimated snout-vent length from 30-100 mm, from the Paleo- y ' gene of Patagonia. This large pipoid anuran is distinguished by possessing a long, narrow braincase; an hourglass-shaped frontoparietal; a robust antorbital process on the edentate maxilla; long, straight {/) '/^ I ilia that describe a V-shape in dorsal profile; and a trunk that is long relative to the lengths of the head and limbs.
    [Show full text]
  • 71St Annual Meeting Society of Vertebrate Paleontology Paris Las Vegas Las Vegas, Nevada, USA November 2 – 5, 2011 SESSION CONCURRENT SESSION CONCURRENT
    ISSN 1937-2809 online Journal of Supplement to the November 2011 Vertebrate Paleontology Vertebrate Society of Vertebrate Paleontology Society of Vertebrate 71st Annual Meeting Paleontology Society of Vertebrate Las Vegas Paris Nevada, USA Las Vegas, November 2 – 5, 2011 Program and Abstracts Society of Vertebrate Paleontology 71st Annual Meeting Program and Abstracts COMMITTEE MEETING ROOM POSTER SESSION/ CONCURRENT CONCURRENT SESSION EXHIBITS SESSION COMMITTEE MEETING ROOMS AUCTION EVENT REGISTRATION, CONCURRENT MERCHANDISE SESSION LOUNGE, EDUCATION & OUTREACH SPEAKER READY COMMITTEE MEETING POSTER SESSION ROOM ROOM SOCIETY OF VERTEBRATE PALEONTOLOGY ABSTRACTS OF PAPERS SEVENTY-FIRST ANNUAL MEETING PARIS LAS VEGAS HOTEL LAS VEGAS, NV, USA NOVEMBER 2–5, 2011 HOST COMMITTEE Stephen Rowland, Co-Chair; Aubrey Bonde, Co-Chair; Joshua Bonde; David Elliott; Lee Hall; Jerry Harris; Andrew Milner; Eric Roberts EXECUTIVE COMMITTEE Philip Currie, President; Blaire Van Valkenburgh, Past President; Catherine Forster, Vice President; Christopher Bell, Secretary; Ted Vlamis, Treasurer; Julia Clarke, Member at Large; Kristina Curry Rogers, Member at Large; Lars Werdelin, Member at Large SYMPOSIUM CONVENORS Roger B.J. Benson, Richard J. Butler, Nadia B. Fröbisch, Hans C.E. Larsson, Mark A. Loewen, Philip D. Mannion, Jim I. Mead, Eric M. Roberts, Scott D. Sampson, Eric D. Scott, Kathleen Springer PROGRAM COMMITTEE Jonathan Bloch, Co-Chair; Anjali Goswami, Co-Chair; Jason Anderson; Paul Barrett; Brian Beatty; Kerin Claeson; Kristina Curry Rogers; Ted Daeschler; David Evans; David Fox; Nadia B. Fröbisch; Christian Kammerer; Johannes Müller; Emily Rayfield; William Sanders; Bruce Shockey; Mary Silcox; Michelle Stocker; Rebecca Terry November 2011—PROGRAM AND ABSTRACTS 1 Members and Friends of the Society of Vertebrate Paleontology, The Host Committee cordially welcomes you to the 71st Annual Meeting of the Society of Vertebrate Paleontology in Las Vegas.
    [Show full text]
  • Hypothesis As an Alternative. the Distribution Of
    Heredity (1976), 36 (3), 293-304 REASSOCIATIONPATTERNS AMONG SEGMENTAL INTERCHANGES IN MAIZE D.B. WALDEN and R. C. JANCEY Department of Plant Sciences,Universityof WesternOntario,London, Ontario N6A 3K7 Received2.iv.75 SUMMARY Data from Longley (1961) and Burnham (1969) on the cytological position of the break-points in chrornosomal rearrangements in maize were re-expressed in terms of segment lengths and analysed. After correction for the deviation of the distribution of break-points from an equidistribution, it was shown that highly significant excesses and deficits occurred among some but not all segment length classes. It was concluded that the pattern of reassociation shows: (i) that reassociation involves non-homologues whose interstitial segments are of similar length more frequently than expected; (ii) that the two interchange segments involved in a translocation are of similar length more frequently than expected. 1. INTRODUCTION AN extensive literature exists on the genetic effects and consequences of exposure to radiation and radiomimetic and radiochemical compounds. The origin of chromosomal aberrations had long been considered to be the consequence of" breakage and reunion" until Revell (1955) proposed an "exchange" hypothesis as an alternative. The distribution of the "breakage" or "exchange" events has been approximately determined in several species, with a" random "distribution being claimed by some workers and a "non-random" distribution favoured by several recent investigators (e.g. Caspersson et al., 1972). It is important for the present communication to note that most of the studies record observations made one or a few cell generations after exposure to the mutagen and that only limited information is available about the survival of the aberrations so induced.
    [Show full text]
  • Effects of Gut-Associated Yeasts on Drosophila Melanogaster Performance
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 12-6-2016 12:00 AM Effects of gut-associated yeasts on Drosophila melanogaster performance Yanira Jiménez Padilla The University of Western Ontario Supervisor Brent Sinclair The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Master of Science © Yanira Jiménez Padilla 2016 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Biology Commons Recommended Citation Jiménez Padilla, Yanira, "Effects of gut-associated yeasts on Drosophila melanogaster performance" (2016). Electronic Thesis and Dissertation Repository. 4285. https://ir.lib.uwo.ca/etd/4285 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract I used Drosophila melanogaster as a model to study the role of the gut microbiota, specifically yeasts, in animal physiology. I used Saccharomyces cerevisiae, the yeast commonly included in Drosophila diet, and Lachancea kluyveri, isolated from some Drosophila in the wild, and generated axenic (germ-free) and gnotobiotic (yeast-fed) flies. I found that L. kluyveri persists in the crop, as ascospores and vegetative cells, longer than S. cerevisiae. Some L. kluyveri vegetative cells survive passage through the gut. Egg to adult development time is reduced by 14% in vials containing live L. kluyveri or S. cerevisiae, whereas heat-killed yeasts reduced development time by 3.5-4.5%.
    [Show full text]
  • DROSOPHILA MELANOGASTER - the MODEL ORGANISM of CHOICE for the COMPLEX BIOLOGY of MULTI-CELLULAR ORGANISMS Kathleen M
    DROSOPHILA MELANOGASTER - THE MODEL ORGANISM OF CHOICE FOR THE COMPLEX BIOLOGY OF MULTI-CELLULAR ORGANISMS Kathleen M. Beckingham 1*, J. Douglas Armstrong2, Michael J. Texada1, Ravi Munjaal1, Dean A. Baker2 1 Department of Biochemistry and Cell Biology, MS-140, Rice University, Houston, Texas 77251. 2 School of Informatics, Institute for Adaptive and Neural Computation Edinburgh, EH1 2QL, UK. ABSTRACT Although the route from mutation to sequenced gene may Drosophila melanogaster has been intensely studied for almost be long and hard, genetics is an extremely powerful 100 years. The sophisticated array of genetic and molecular approach because it can be applied to much more tools that have evolved for analysis of gene function in this complex biological processes than biochemistry. Clearly organism are unique. Further, Drosophila is a complex multi- for fundamental, universal processes that can be studied cellular organism in which many aspects of development and behavior parallel those in human beings. These combined in cell-free extracts, the biochemical approach is highly advantages have permitted research in Drosophila to make effective. But for complex processes, such as seminal contributions to the understanding of fundamental developmental events or behavioral responses, in which biological processes and ensure that Drosophila will continue to many components of the whole organism are in play, provide unique insights in the genomic era. An overview of the genetics offers perhaps the only viable route to dissecting genetic methodologies available in Drosophila is given here, out the protein components. together with examples of outstanding recent contributions of Drosophila to our understanding of cell and organismal biology. The genetic approach has been used to probe gene/protein The growing contribution of Drosophila to our knowledge of function in many organisms.
    [Show full text]