Micrornas in Development and Disease

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Clin Genet 2008: 74: 296–306 # 2008 The Authors Printed in Singapore. All rights reserved Journal compilation # 2008 Blackwell Munksgaard CLINICAL GENETICS doi: 10.1111/j.1399-0004.2008.01076.x Review MicroRNAs in development and disease Erson AE, Petty EM. MicroRNAs in development and disease. AE Ersona and EM Pettyb,c # Clin Genet 2008: 74: 296–306. Blackwell Munksgaard, 2008 aDepartment of Biological Sciences, Middle East Technical University (METU), Since the discovery of microRNAs (miRNAs) in Caenorhabditis elegans, Ankara, Turkey, and bDepartment of mounting evidence illustrates the important regulatory roles for miRNAs Internal Medicine and cDepartment of in various developmental, differentiation, cell proliferation, and Human Genetics, University of Michigan, apoptosis pathways of diverse organisms. We are just beginning to MI, USA elucidate novel aspects of RNA mediated gene regulation and to understand how heavily various molecular pathways rely on miRNAs for their normal function. miRNAs are small non-protein-coding transcripts that regulate gene expression post-transcriptionally by targeting Key words: cancer – development – messenger RNAs (mRNAs). While individual miRNAs have been microRNA – viral infection specifically linked to critical developmental pathways, the deregulated Corresponding author: Elizabeth M Petty, expression of many miRNAs also has been shown to have functional Department of Internal Medicine, significance for multiple human diseases, such as cancer. We continue to University of Michigan, 5220 MSRB III, discover novel functional roles for miRNAs at a rapid pace. Here, we 1150 West Medical Center Drive, Ann summarize some of the key recent findings on miRNAs, their mode of Arbor, MI 48109-0640, USA. action, and their roles in both normal development and in human Tel.: 1(734) 763-2532; pathology. A better understanding of how miRNAs operate during the fax: 1(734) 647-7979; normal life of a cell as well as in the pathogenesis of disease when e-mail: [email protected] deregulated will provide new avenues for diagnostic, prognostic, and Received 2 May 2008, revised and therapeutic applications. accepted for publication 3 July 2008 When the Human Genome Project was com- been widely investigated in various eukaryotic or- pleted, the number of genes in our genome was ganisms (1–3). By 2002, the miRNA registry (ver- estimated to be around 20–25 000, far fewer than sion 1) had 218 miRNA entries for primates, the initially predicted 100 000. All known or pre- rodents, birds, fish, worms, flies, plants and vi- dicted protein-coding genes are thought to be ex- ruses. This number dramatically increased over pressed only from a small percentage (i.e. 1.5–2%) 6 years to 6396 as of April 2008 (version 11) (4– of the whole genome. These figures are poor in- 6). This noteworthy discovery rate during a 6-year dicators of the actual genetic complexity in hu- time period along with the increasing evidence for mans. In fact, limiting the definition of Ôgene’ to the regulatory roles of many miRNAs in various describe only protein-coding units is not compre- cellular processes, such as development and differ- hensive enough either, to define genetic complex- entiation, are clear indicators of the considerable ity. As of today, the majority of the human complexity of genetic information processing in genome is hypothesized to code for many non- cells. Current estimations predict that about protein coding structural and regulatory RNAs, 30% of all the human genes are regulated by miR- including microRNAs (miRNAs), that play criti- NAs (7) and that a single miRNA can potentially cal and vital roles in generating genomic complex- target around 200 different transcripts that may ity and diversity within Homo sapiens and, also, function in different pathways in the cell (8). between species. The nomenclature for miRNAs has yet to be miRNAs are small non-protein-coding tran- fully standardized in the literature, but, in general, scripts of 16–29 nucleotide-long RNAs that regu- miRNA genes are designated by the italicized pre- late gene expression post-transcriptionally by fix Ômir’. The unitalicized prefix ÔmiR’ is used to targeting messenger RNAs (mRNAs). Since the indicate the mature form of the miRNA. The pre- initial discovery in Caenorhabditis elegans in fixes Ômir’ or ÔmiR’ are followed in most cases by 1993, miRNA-dependent gene regulation has a dash and then a number, such as miR-127. A set 296 MiRNAs in development and disease of guidelines for miRNA annotation is suggested are also likely to be transcribed by RNA polymer- by Ambros et al. (9). ase III (11). Given the large number of recent papers in the The general miRNA biogenesis pathway (Fig. 1) scientific literature describing the functional roles involves a primary miRNA (pri-miRNA) tran- of miRNAs in biological processes such as devel- script (several hundred base pairs to several kilo- opment, differentiation, cell proliferation, and base pairs) that is subsequently cleaved by the apoptosis, it is clear that miRNAs are critical reg- nuclear RNase III enzyme, Drosha, and its partner ulatory factors important for normal health and DGCR8 (DiGeorge syndrome critical region gene are also highly relevant to disease processes. Here, 8) forming the 60–70 nucleotide-long precursor we present a brief outline of miRNA biogenesis miRNA (pre-miRNA) with a 3# overhang of two and action mechanisms with an emphasis on key nucleotides (12, 13). The pre-miRNA is then trans- roles of miRNAs in normal development and ported to the cytoplasm through the nuclear export human pathology. protein, exportin-5, together with Ran-guanosine triphosphate (14). Cytoplasmic RNase III, Dicer, and its RNA-binding partner TRBP, human immunodeficiency virus (HIV)-1 transactivating miRNA biogenesis responsive element (TAR) RNA-binding protein, Similar to mRNAs, miRNAs can be transcribed in cleave the pre-miRNA into a 20–25 nucleotide a time- and tissue-specific manner. Many miR- mature miRNA duplex. This double-stranded NAs are transcribed by RNA polymerase II and RNA then assembles into a multiprotein complex, have a poly(A) tail and a 5# cap (10). However, RNA-induced silencing complex (RISC), which is exceptions do exist. For instance, Borchert et al. composed of Dicer, TRBP, and Argonaute 2 demonstrated polymerase III dependent tran- (Ago2) (13, 15–17). Caudy and Hannon (18) also scription of a human chromosome 19 miR cluster showed presence of Ago2, Drosophila fragile X- (C19MC). miR-515-1, miR-517a, miR-517c and related protein, vasa intronic gene and the micro- miR-519a-1, as well as other miRNAs with coccal nuclease family member Tudor-SN (Dro- upstream tRNA, repeat or transposable elements, sophila CG7008) in the Drosophila RISC structure. Fig. 1. Overview of the microRNA (miRNA) biogenesis pathway. Up to several kb long pri-miRNA is usually transcribed by RNA polymerase II, has a 5#cap and 3#poly(A) tail. Pri-miRNAs fold into stem loop structures that are cleaved by nuclear RNase III Drosha and its RNA-binding partner DGCR8 (DiGeorge syndrome critical region gene 8) into 60–70 nucleotide long pre-miRNA, leaving a two-nucleotide 3# overhang which is then transported to the nucleus through exportin 5, Ran- GTP. Cytoplasmic RNase III, Dicer, and its RNA-binding partner TRBP cleave the pre-miRNA into a 20–25 nucleotide mature miRNA duplex. The double-stranded RNA then assembles into the RNA-induced silencing complex (RISC). One of the strands is degraded, whereas the strand harboring the mature miRNA and the RISC complex is directed to the target mRNA. At this point, different routes are known to exist for gene silencing; translational repression or mRNA degradation (see text for details). 297 Erson and Petty RISC brings the target mRNA and the mature miR-1224 and miR-1225) in mammals and 16 pri- miRNA strand (also known as the Ôguide’ strand) mate-specific mirtrons have been identified (29). together while causing removal of the Ôpassenger’ miRNAs can also be found in exons of non-coding strand (19). The selection of the guide or the pas- RNAs [e.g. miR-155 is encoded within an exon of senger strands is currently thought to be based on the non-coding RNA known as B-cell integration the thermodynamic characteristics of the strands. cluster] (30, 31). It has been generally accepted that the less stable Relatively less is known about the transcrip- strand becomes the guide strand and is the target tional regulation of intergenic or intronic (if dif- mRNA-binding miRNA while the more stable pas- ferent than the host gene) miRNAs. Some recent senger strand is removed from the complex for deg- data showed that c-myc induced transcription of radation. On the contrary, however, Ro et al. (20) a miRNA cluster, miR-17-92 (32), (33) and p53 provides evidence that both strands of the miRNA induced expression of miR-34 genes (reviewed in duplex (sister strands) can indeed be functional and 34). Not surprisingly, expression of miRNAs is possibly co-accumulate in a tissue-dependent man- also shown to be affected by epigenetic mecha- ner to target different mRNA populations. How- nisms. Saito et al. (35) demonstrated increased ever, the mechanism of how such specific expression of miR-127, along with 16 of 313 other regulation takes place is yet to be examined. human miRNAs examined, after DNA methyla- Interestingly, there seems to be additional fine tion and histone deactylase inhibitor treatments. tuning mechanisms to manage the biogenesis of After treatment, proto-oncogene BCL6, a poten- miRNAs. For example, Lin 28, a developmentally tial target of miR-127, was translationally down- regulated RNA-binding protein, has been recently regulated, reportedly because of the increased shown to selectively block let-7 miRNA process- expression of the miR-127 (also see 36 for a review ing (potentially by binding to the terminal loop of epigenetically regulated miRNAs).
Recommended publications
  • The Malignant Phenotype in Breast Cancer Is Driven by Eif4a1-Mediated Changes in the Translational Landscape

    The Malignant Phenotype in Breast Cancer Is Driven by Eif4a1-Mediated Changes in the Translational Landscape

    Citation: Cell Death and Disease (2015) 6, e1603; doi:10.1038/cddis.2014.542 OPEN & 2015 Macmillan Publishers Limited All rights reserved 2041-4889/15 www.nature.com/cddis The malignant phenotype in breast cancer is driven by eIF4A1-mediated changes in the translational landscape A Modelska1, E Turro1,2, R Russell1, J Beaton1, T Sbarrato3, K Spriggs4, J Miller1, S Gräf1,2,5, E Provenzano6,7, F Blows8, P Pharoah6,8, C Caldas1,6 and J Le Quesne*,1,3 Human mRNA DeXD/H-box helicases are ubiquitous molecular motors that are required for the majority of cellular processes that involve RNA metabolism. One of the most abundant is eIF4A, which is required during the initiation phase of protein synthesis to unwind regions of highly structured mRNA that would otherwise impede the scanning ribosome. Dysregulation of protein synthesis is associated with tumorigenesis, but little is known about the detailed relationships between RNA helicase function and the malignant phenotype in solid malignancies. Therefore, immunohistochemical analysis was performed on over 3000 breast tumors to investigate the relationship among expression of eIF4A1, the helicase-modulating proteins eIF4B, eIF4E and PDCD4, and clinical outcome. We found eIF4A1, eIF4B and eIF4E to be independent predictors of poor outcome in ER-negative disease, while in contrast, the eIF4A1 inhibitor PDCD4 was related to improved outcome in ER-positive breast cancer. Consistent with these data, modulation of eIF4A1, eIF4B and PCDC4 expression in cultured MCF7 cells all restricted breast cancer cell growth and cycling. The eIF4A1-dependent translatome of MCF7 cells was defined by polysome profiling, and was shown to be highly enriched for several classes of oncogenic genes, including G-protein constituents, cyclins and protein kinases, and for mRNAs with G/C-rich 5′UTRs with potential to form G-quadruplexes and with 3′UTRs containing microRNA target sites.
  • Gene Section Review

    Gene Section Review

    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
  • Distinct Roles of Different Fragments of PDCD4 in Regulating the Metastatic Behavior of B16 Melanoma Cells

    Distinct Roles of Different Fragments of PDCD4 in Regulating the Metastatic Behavior of B16 Melanoma Cells

    INTERNATIONAL JOURNAL OF ONCOLOGY 42: 1725-1733, 2013 Distinct roles of different fragments of PDCD4 in regulating the metastatic behavior of B16 melanoma cells DI WANG, SHU GUO, SI-YUAN HAN, NAN XU, JIA-YAN GUO and QING SUN Department of Plastic Surgery, The First Hospital of China Medical University, Shenyang, Liaoning 110001, P.R. China Received December 12, 2012; Accepted January 29, 2013 DOI: 10.3892/ijo.2013.1841 Abstract. Melanoma is an aggressive cutaneous malignancy. In mice (7,8). As shown in Fig. 1, full length human PDCD4 this study, we demonstrated that the levels of the programmed contains an N-terminal putative RNA-binding domain cell death 4 (PDCD4) protein and mRNA were lower in tumor (residues 1-140) and two tandem MA3 domains, designated tissues compared with normal tissues. In order to further as nMA3 (residues 164-275) and cMA3 (residues 327-440) investigate the effects of PDCD4 and its fragments in B16 (9). The two MA3 domains have very similar structure and melanoma cells, we established B16 clones with expression of eIF4A-binding surfaces (10). The molecular basis for PDCD4- different PDCD4 fragments. Intact PDCD4, PDCD4∆164-469 mediated suppression has been linked to its high affinity and PDCD4∆327-440 expression, respectively, decreased MA-3 domains (11,12). NMR binding analysis has shown proliferation and migration and increased apoptosis in B16 that both MA3 domains of PDCD4 interacted with eIF4A cells in vitro. We found that intact PDCD4, PDCD4∆164-469 and prevented translation (10,11). However, another study has or PDCD4∆327-440 can inhibit the activity of MMP-2 and the demonstrated that the cMA3 domain alone is sufficient for expression of CXCR4.
  • Identification of Mirnas and Their Targets Through High-Throughput

    Identification of Mirnas and Their Targets Through High-Throughput

    Chen et al. BMC Plant Biology (2016) 16:80 DOI 10.1186/s12870-016-0770-z RESEARCH ARTICLE Open Access Identification of miRNAs and their targets through high-throughput sequencing and degradome analysis in male and female Asparagus officinalis Jingli Chen1†, Yi Zheng2†, Li Qin1†, Yan Wang1, Lifei Chen1, Yanjun He1, Zhangjun Fei2,3 and Gang Lu1* Abstract Background: MicroRNAs (miRNAs), a class of non-coding small RNAs (sRNAs), regulate various biological processes. Although miRNAs have been identified and characterized in several plant species, miRNAs in Asparagus officinalis have not been reported. As a dioecious plant with homomorphic sex chromosomes, asparagus is regarded as an important model system for studying mechanisms of plant sex determination. Results: Two independent sRNA libraries from male and female asparagus plants were sequenced with Illumina sequencing, thereby generating 4.13 and 5.88 million final clean reads, respectively. Both libraries predominantly contained 24-nt sRNAs, followed by 21-nt sRNAs. Further analysis identified 154 conserved miRNAs, which belong to 26 families, and 39 novel miRNA candidates seemed to be specific to asparagus. Comparative profiling revealed that 63 miRNAs exhibited significant differential expression between male and female plants, which was confirmed by real-time quantitative PCR analysis. Among them, 37 miRNAs were significantly up-regulated in the female library, whereas the others were preferentially expressed in the male library. Furthermore, 40 target mRNAs representing 44 conserved and seven novel miRNAs were identified in asparagus through high-throughput degradome sequencing. Functional annotation showed that these target mRNAs were involved in a wide range of developmental and metabolic processes.
  • Wo 2008/070082 A2

    Wo 2008/070082 A2

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date PCT (10) International Publication Number 12 June 2008 (12.06.2008) WO 2008/070082 A2 (51) International Patent Classification: (74) Agents: CLAUSS, Isabelle, M. et al.; Patent Group, FO A6IK 48/00 (2006.01) LEY HOAG LLP, 155 Seaport Blvd., Boston, MA 02210- 2600 (US). (21) International Application Number: PCT/US2007/024845 (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (22) International Filing Date: AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY,BZ, CA, CH, 4 December 2007 (04.12.2007) CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, (25) Filing Language: English IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY,MA, MD, ME, MG, MK, MN, MW, (26) Publication Language: English MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PG, PH, PL, (30) Priority Data: PT, RO, RS, RU, SC, SD, SE, SG, SK, SL, SM, SV, SY, 60/872,764 4 December 2006 (04. 12.2006) US TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW (71) Applicants (for all designated States except US): THE JOHNS HOPKINS UNIVERSITY [US/US]; 3400 North (84) Designated States (unless otherwise indicated, for every Charles Street, Baltimore, MD 21218 (US). OHIO STATE kind of regional protection available): ARIPO (BW, GH, UNIVERSITY [US/US]; 1320 Kinnear Road, Columbus, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, OH 43212 (US).
  • A Systems-Wide Screen Identifies Substrates of the SCF Ubiquitin Ligase

    A Systems-Wide Screen Identifies Substrates of the SCF Ubiquitin Ligase

    RESEARCH RESOURCE PROTEOMICS A systems-wide screen identifies substrates of the SCFbTrCP ubiquitin ligase Teck Yew Low,1,2 Mao Peng,1,2* Roberto Magliozzi,3* Shabaz Mohammed,1,2† Daniele Guardavaccaro,3 Albert J. R. Heck1,2‡ Cellular proteins are degraded by the ubiquitin-proteasome system (UPS) in a precise and timely fashion. Such precision is conferred by the high substrate specificity of ubiquitin ligases. Identification of substrates of ubiquitin ligases is crucial not only to unravel the molecular mechanisms by which the UPS controls protein degradation but also for drug discovery purposes because many established UPS substrates are implicated in disease. We developed a combined bioinformatics and affinity purification– mass spectrometry (AP-MS) workflow for the system-wide identification of substrates of SCFbTrCP,a member of the SCF family of ubiquitin ligases. These ubiquitin ligases are characterized by a multi- subunit architecture typically consisting of the invariable subunits Rbx1, Cul1, and Skp1, and one of 69 F-box proteins. The F-box protein of this member of the family is bTrCP. SCFbTrCP binds, through the WD40 b repeats of TrCP, to the DpSGXX(X)pS diphosphorylated motif in its substrates. We recovered 27 pre- Downloaded from viously reported SCFbTrCP substrates, of which 22 were verified by two independent statistical proto- cols, thereby confirming the reliability of this approach. In addition to known substrates, we identified 221 proteins that contained the DpSGXX(X)pS motif and also interacted specifically with the WD40 repeats of bTrCP. Thus, with SCFbTrCP, as the example, we showed that integration of structural infor- mation, AP-MS, and degron motif mining constitutes an effective method to screen for substrates of ubiquitin ligases.
  • The Role of Micrornas in Oral Squamous Cell Carcinoma Pathogenesis: a Literature Review

    The Role of Micrornas in Oral Squamous Cell Carcinoma Pathogenesis: a Literature Review

    Applied Cancer Research. 2013;33(4):198-205. REVIEW The role of microRNAS in oral squamous cell carcinoma pathogenesis: a literature review Anne Maria Guimarães Lessa1, Ludmila Faro Valverde2, Rosane Borges Dias2, Maria Cecília Mathias Machado1, Jean Nunes dos Santos3, Clarissa Araújo Gurgel Rocha3 ABSTRACT In this review, we summarize the main aspects related to the involvement of microRNAs (miRNAs) in oral carcinogenesis. miRNAs are small non-protein-coding RNAs that function such as regulators of gene expression. They regulate various biological processes such as growth, differentiation and apoptosis and have been widely studied in carcinogenesis. miRNAs may exhibit oncogenic or tumor suppressor activity in cancer, depending on the biological context and the cell type. The altered expression patterns of miRNA in cancer could serve as molecular biomarkers for tumor diagnosis, prognosis and disease-specific prediction of therapeutic responses. The literature indicates that up-regulation of miR-21, miR-221, miR-184 and under expression of miR-133a, miR-375 and let-7b are the principal profile in oral squamous cell carcinomas. Keywords: gene expression; microRNAS; MIRN133 microRNA, human; MIRN184 microRNA, human; MIRN21 microRNA, human; MIRN221 microRNA, human; MIRN375 microRNA, human; mirnlet7 microRNA, human; mouth mucosa; mouth neoplasms; tumor markers, biological. INTRODUCTION years later, Reinhart et al.12 observed that another C. elegans heterochronic gene, let-7, was also represented by a small Cells have developed several biological mechanisms to non-coding RNA capable of starting the temporal cascade of ensure that mitosis, differentiation and death occur in a coor- regulatory genes through an RNA-RNA interaction with the 3 dinated manner and disturbances in genes related with these untranslated region (UTR) of target genes.
  • Full-Text (PDF)

    Full-Text (PDF)

    Original Article Iran J Ped Hematol Oncol. 2019, Vol9, No4, 49-56 Effect of Estradiol on miR-21& miR-155 Expression in promyelocytic leukemia-derived cell line NB4 Robab Naghibzadeh MSc1, Narges Obeidi PhD1,2,*, Alireza Farsinejd PhD3,Gholamreza Khamisipour PhD1, Masoud TohidFar PhD4 1. Department of Hematology, School of Para Medicine, Bushehr University of Medical Sciences, Bushehr, Iran 2. Blood Transfusion Organization, Bushehr, Iran 3. Department of Hematology and Medical Laboratory Sciences, Faculty of Allied Medical Sciences, Kerman University of Medical Sciences, Kerman, Iran 4. Department of Hematology and Medical Laboratory Sciences, Faculty of Allied Medical Sciences, ShahidBeheshti University of Medical Sciences, Tehran, Iran *Corresponding author:Dr Narges Obeidi, Department of Hematology, School of Para Medicine, Bushehr University of Medical Sciences, Bushehr, Iran. E-mail: [email protected]. Orchid ID:0000-0001-8087-2850 Received: 25 March 2019 Accepted: 10 November 2019 Abstract Background: Due to the estrogen participation in modulating the proliferation and commitment of stem cells and the effects of miR-21 and miR-155 expression on reduced proliferation and colony formation of acute myeloid leukemia (AML), the aim of the present study was to evaluate the effect of estradiol on expression of miR-21 and miR-155 in the NB4 cell line, as an acute promyelocytic leukemia (APL). Materials and Methods: In the present experiment, NB4 cells were treated with different quantities of estradiol (5, 25, 50, 75, 100, 150, 200, 250 μg/ml) and vehicle control for 24 and 48 hours. Viability, apoptosis, and cellular proliferation were estimated by trypan blue exclusion, flow cytometry, and MTT assays, respectively.
  • Structure of the C-Terminal MA-3 Domain of the Tumour Suppressor Protein Pdcd4and Characterization of Its Interaction with Eif4a

    Structure of the C-Terminal MA-3 Domain of the Tumour Suppressor Protein Pdcd4and Characterization of Its Interaction with Eif4a

    Oncogene (2007) 26, 4941–4950 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc ORIGINAL ARTICLE Structure of the C-terminal MA-3 domain of the tumour suppressor protein Pdcd4and characterization of its interaction with eIF4A LC Waters1, V Veverka1,MBo¨ hm2, T Schmedt2, PT Choong1, FW Muskett1, K-HKlempnauer 2 and MD Carr1 1Department of Biochemistry, University of Leicester, Leicester, UK and 2Institut fu¨r Biochemie, Westfa¨lische-Wilhelms-Universita¨t Mu¨nster, Mu¨nster, Germany Programmed cell death protein 4(Pdcd4)is a novel 2004; Bitomsky et al., 2004). The protein was initially tumour suppressor protein, which is involved in the control discovered in a screen for genes activated during of eukaryotic transcription and translation. The regula- apoptosis (Shibahara et al., 1995) and then subsequently tion of translation involves specific interactions with identified as a tumour suppressor in studies of a mouse eukaryotic initiation factor (eIF)4A and eIF4G, which keratinocyte model of tumour promotion, in which high are mediated via the two tandem MA-3 domains. We have levels of Pdcd4 were found to render cells resistant to determined the structure of the C-terminal MA-3 domain transformation by the tumour promoter 12-O-tetrade- of Pdcd4(Pdcd4MA-3 C), characterized its interaction canoyl-phorbol-13-acetate (TPA) (Cmarik et al., 1999). with eIF4A and compared the features of nuclear Pdcd4 has been shown to inhibit the activation of AP1- magnetic resonance (NMR) spectra obtained from the responsive promoters by c-Jun, providing a possible single domain and tandem MA-3 region.
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas

    Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas

    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
  • Exploring the Regulatory Mechanism of the Notch Ligand Receptor Jagged1 Via the Aryl Hydrocarbon Receptor in Breast Cancer Sean Alan Piwarski

    Exploring the Regulatory Mechanism of the Notch Ligand Receptor Jagged1 Via the Aryl Hydrocarbon Receptor in Breast Cancer Sean Alan Piwarski

    Marshall University Marshall Digital Scholar Theses, Dissertations and Capstones 2018 Exploring the Regulatory Mechanism of the Notch Ligand Receptor Jagged1 Via the Aryl Hydrocarbon Receptor in Breast Cancer Sean Alan Piwarski Follow this and additional works at: https://mds.marshall.edu/etd Part of the Biological Phenomena, Cell Phenomena, and Immunity Commons, Medical Molecular Biology Commons, Medical Toxicology Commons, and the Oncology Commons EXPLORING THE REGULATORY MECHANISM OF THE NOTCH LIGAND RECEPTOR JAGGED1 VIA THE ARYL HYDROCARBON RECEPTOR IN BREAST CANCER A dissertation submitted to the Graduate College of Marshall University In partial fulfillment of the requirements for the degree of Doctor of Philosophy In Biomedical Sciences by Sean Alan Piwarski Approved by Dr. Travis Salisbury, Committee Chairperson Dr. Gary Rankin Dr. Monica Valentovic Dr. Richard Egleton Dr. Todd Green Marshall University July 2018 APPROVAL OF DISSERTATION We, the faculty supervising the work of Sean Alan Piwarski, affirm that the dissertation, Exploring the Regulatory Mechanism of the Notch Ligand Receptor JAGGED1 via the Aryl Hydrocarbon Receptor in Breast Cancer, meets the high academic standards for original scholarship and creative work established by the Biomedical Sciences program and the Graduate College of Marshall University. This work also conforms to the editorial standards of our discipline and the Graduate College of Marshall University. With our signatures, we approve the manuscript for publication. ii © 2018 SEAN ALAN PIWARSKI ALL RIGHTS RESERVED iii DEDICATION To my mom and dad, This dissertation is a product of your hard work and sacrifice as amazing parents. I could never have accomplished something of this magnitude without your love, support, and constant encouragement.
  • Therapeutic Evaluation of Micrornas by Molecular Imaging Thillai V

    Therapeutic Evaluation of Micrornas by Molecular Imaging Thillai V

    Theranostics 2013, Vol. 3, Issue 12 964 Ivyspring International Publisher Theranostics 2013; 3(12):964-985. doi: 10.7150/thno.4928 Review Therapeutic Evaluation of microRNAs by Molecular Imaging Thillai V. Sekar1, Ramkumar Kunga Mohanram1, 2, Kira Foygel1, and Ramasamy Paulmurugan1 1. Molecular Imaging Program at Stanford, Bio-X Program, Department of Radiology, Stanford University School of Medicine, Stanford, California, USA. 2. Current address: SRM Research Institute, SRM University, Kattankulathur– 603 203, Tamilnadu, India Corresponding author: Ramasamy Paulmurugan, Ph.D. Department of Radiology, Stanford University School of Medicine, 1501, South California Avenue, #2217, Palo Alto, CA 94304. Phone: 650-725-6097; Fax: 650-721-6921. Email: [email protected] © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.07.26; Accepted: 2013.09.22; Published: 2013.12.06 Abstract MicroRNAs (miRNAs) function as regulatory molecules of gene expression with multifaceted activities that exhibit direct or indirect oncogenic properties, which promote cell proliferation, differentiation, and the development of different types of cancers. Because of their extensive functional involvement in many cellular processes, under both normal and pathological conditions such as various cancers, this class of molecules holds particular interest for cancer research. MiRNAs possess the ability to act as tumor suppressors or oncogenes by regulating the expression of different apoptotic proteins, kinases, oncogenes, and other molecular mechanisms that can cause the onset of tumor development.