DOCSLIB.ORG

Wo 2008/070082 A2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Wo 2008/070082 A2 (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date PCT (10) International Publication Number 12 June 2008 (12.06.2008) WO 2008/070082 A2 (51) International Patent Classification: (74) Agents: CLAUSS, Isabelle, M. et al.; Patent Group, FO A6IK 48/00 (2006.01) LEY HOAG LLP, 155 Seaport Blvd., Boston, MA 02210- 2600 (US). (21) International Application Number: PCT/US2007/024845 (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (22) International Filing Date: AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY,BZ, CA, CH, 4 December 2007 (04.12.2007) CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, (25) Filing Language: English IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY,MA, MD, ME, MG, MK, MN, MW, (26) Publication Language: English MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PG, PH, PL, (30) Priority Data: PT, RO, RS, RU, SC, SD, SE, SG, SK, SL, SM, SV, SY, 60/872,764 4 December 2006 (04. 12.2006) US TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW (71) Applicants (for all designated States except US): THE JOHNS HOPKINS UNIVERSITY [US/US]; 3400 North (84) Designated States (unless otherwise indicated, for every Charles Street, Baltimore, MD 21218 (US). OHIO STATE kind of regional protection available): ARIPO (BW, GH, UNIVERSITY [US/US]; 1320 Kinnear Road, Columbus, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, OH 43212 (US). ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (AT,BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, (72) Inventors; and FR, GB, GR, HU, IE, IS, IT, LT,LU, LV,MC, MT, NL, PL, (75) Inventors/Applicants (for US only): GEORGANTAS, PT, RO, SE, SI, SK, TR), OAPI (BF, BJ, CF, CG, CI, CM, Robert [US/US]; 324 Stevenson Lane, Apt C2, Tow- GA, GN, GQ, GW, ML, MR, NE, SN, TD, TG). son, MD 21204 (US). CIVIN, Curt, I. [US/US]; 7516 LΗ irondelle Club Road, Towson, MD 21204-6417 (US). Published: CALIN, George, Adrian [US/US]; Columbus, OH (US). — without international search report and to be republished CROCE, Carlo, Maria [US/US]; Columbus, OH (US). upon receipt of that report (54) Title: STEM-PROGENITOR CELL SPECIFIC MICRO-RIBONUCLEIC ACIDS AND USES THEREOF (57) Abstract: Provided herein are methods and compositions for modulating the differentiation of incompletely differentiated cells, such as stem-progenitor cells, e.g., hematopoietic stem- progenitor cells. A method may comprise contacting a cell with an agononist or an antagonist of a miRNA comprising a nucleotide sequence from SEQ ID NO: 1-34. STEM-PROGENITOR CELL SPECIFIC MICRO-RIBONUCLEIC ACIDS AND USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 60/872,764, filed on December 4, 2006, the content of which is specifically incorporated by reference herein in its entirety. GOVERNMENTAL SUPPORT This invention was made with governmental support under grant numbers CA70970 and CA60441, awarded by the U.S. National Institutes of Health. The government has certain rights in this invention. BACKGROUND MicroRNAs (miRNAs) consist of a class of epigenetic elements that inhibit translation of mRNA to protein and also may result in gene silencing through chromatin remodeling (I). miRNAs have been identified in many organisms, including plants, Drosophila, rats, mice, and humans, where they have been shown to control major cellular processes, including metabolism, differentiation, and development (2). miRNAs have been implicated in the differentiation of mammalian blood cell lineages. miRNA-181 seems to bias mouse lymphoid progenitors toward B lymphoid development, and miRNA-146and - 223 bias toward T lymphopoiesis (3_). miRNA-221 and -222 are critically involved in the negative control of human erythropoiesis (4) and miRNA-223 in the down-regulation of mouse granulopoiesis (5). Given that miRNAs regulate normal cellular functions, it is not surprising that miRNAs also are involved in carcinogenesis. miRNAs have been identified at deleted or amplified genomic regions or translocation breakpoints in human cancers (6); e.g., miRNA-15 and -16 are the critical genetic elements deleted from 13ql4 chromosomal region in a subset ofchronic lymphocytic leukemia cases (7). SUMMARY OF THE INVENTION Provided herein are methods of modulating the differentiation or proliferation of an incompletely differentiated cell, e.g., a stem-progenitor cell, such as a hematopoietic cell. A method may comprise contacting a cell with a miRNA of one or more of SEQ ID NOS: 1 to 34 (Table 1). Contacting may comprise providing an miRNA to said cell, or providing an expression construct encoding said miRNA to said cell. The cell may be located in an animal subject, such as a human, or the cell may be contacted in vitro, wherein the method may comprise further culturing of said cell with or without reintroduction into an animal. In yet another embodiment, there is provided a method of modulating the proliferation or differentiation of a cell, e.g., a hematopoietic cell, comprising contacting said cell with an agent that is an antagonist of the function or expression of the miRNAs of SEQ ID NOS: 1-34 (Tables 1 and 6). The cell may be contacted in vitro, wherein the method may comprise further culturing of said cell, with or without reintroduction into an animal. The agent may be a peptide, protein, DNA, RNA, antisense DNA, antisense RNA or small molecule. In a further embodiment, there is provided a method of modulating differentiation of a cell, e.g., a hematopoietic cell, comprising inhibiting the function of one or more of the miRNAs of SEQ ID NOS: 1-34 (Tables 1 and 6). Inhibiting the function may comprise contacting the cell with one or more modified or unmodified antisense constructs directed to one or more of the miRNAs of SEQ ID NOS: 1-34. The cell may be located in an animal subject, such as a human, or the cell may be contacted in vitro, followed by culturing said cell in vitro, with or without reintroduction into an animal. In still a further embodiment, there is provided a method of modulating differentiation of a cell, e.g., a hematopoietic cell, comprising providing to said cell an agonist of one or more of the miRNAs of SEQ ID NOS: 1-34 (Tables 1 and 6). The agonist may be one or more of the miRNAs of SEQ ID NOS: 1-34. The agonist may also be an expression cassette encoding one or more of the miRNAs of SEQ ID NOS: 1-34. The agonist may be a peptide, protein, nucleic acid, or small molecule that stimulates the expression of one or more of the miRNAs of SEQ ID NOS: 1-34. The cell may be located in an animal subject, such as a human, or the cell may be contacted in vitro, and may be followed by culturing said cell in vitro, with or without reintroduction into the animal. Provided herein are method for modulating the differentiation of a cell, e.g., a stem- progenitor cell (SPC). A method may comprise contacting a stem-progenitor cell with one or more nucleic acids, wherein each nucleic acid comprises a nucleotide sequence that is at least about 90% identical to one or more of SEQ ID NOs: 1-34 or the complement thereof. Modulating the differentiation of a stem-progenitor cell may be inhibiting the differentiation of a stem-progenitor cell, in which case, the stem-progenitor cell is contacted with one or more nucleic acids, wherein each nucleic acid comprises a nucleotide sequence that is at least about 90% identical to one or more of SEQ ID NOs: 1-34. Modulating the differentiation of a stem-progenitor cell may be stimulating the differentiation of a stem- progenitor cell, in which case, the stem-progenitor cell is contacted with one or more nucleic acids, wherein each nucleic acid comprises a nucleotide sequence that is at least about 90% identical to one or more of the complements of SEQ ID NOs: 1-34. In one embodiment, the stem-progenitor cell is a hematopoietic stem-progenitor cell and the SEQ ID NOs are selected from the group consisting of the sequences of mir-128a, mir-181a, mir- 146, mir-155, mir-24a, mir-17, mir-16, mir-103, mir-107, mir-223, mir-221 and mir-222 or the complement thereof. The hematopoietic stem-progenitor cell may be a CD34+ cell. In one embodiment, the differentiation of a hematopoietic stem-progenitor cell beyond the stage of multipotent progenitor cell (MPP) and/or before the stage of common lymphoid progenitor (CLP) or common myeloid progenitor (CMP) is inhibited, and the SEQ ID NOs are selected from the group consisting of mir- 128a, mir-181a, mir-146, mir- 155, mir-24a, and mir-17. In one embodiment, the differentiation of a hematopoietic stem- progenitor cell beyond the stage of MPP andor before the stage of CLP is inhibited, and the SEQ ID NO is that of mir-146. In one embodiment, the differentiation of a hematopoietic stem-progenitor cell beyond the stage of MPP and/or before the stage of CMP is inhibited, and the SEQ ID NOs are selected from the group consisting of mir-155, mir-24a or mir-17. In one embodiment, the differentiation of a hematopoietic stem-progenitor cell beyond the stage of CMP and/or before the stage of B/Mac bi-potential is inhibited, and the SEQ ID NOs are those of mir-103 or mir-107.
Load more

Recommended publications
  • Genetic Variations in the PSMA6 and PSMC6 Proteasome Genes Are Associated with Multiple Sclerosis and Response to Interferon‑Β Therapy in Latvians
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 21: 478, 2021 Genetic variations in the PSMA6 and PSMC6 proteasome genes are associated with multiple sclerosis and response to interferon‑β therapy in Latvians NATALIA PARAMONOVA1, JOLANTA KALNINA1, KRISTINE DOKANE1, KRISTINE DISLERE1, ILVA TRAPINA1, TATJANA SJAKSTE1 and NIKOLAJS SJAKSTE1,2 1Genomics and Bioinformatics, Institute of Biology of The University of Latvia; 2Department of Medical Biochemistry of The University of Latvia, LV‑1004 Riga, Latvia Received July 8, 2020; Accepted December 8, 2020 DOI: 10.3892/etm.2021.9909 Abstract. Several polymorphisms in genes related to the Introduction ubiquitin‑proteasome system exhibit an association with pathogenesis and prognosis of various human autoimmune Multiple sclerosis (MS) is a lifelong demyelinating disease of diseases. Our previous study reported the association the central nervous system. The clinical onset of MS tends to between multiple sclerosis (MS) and the PSMA3‑rs2348071 be between the second and fourth decade of life. Similarly to polymorphism in the Latvian population. The current study other autoimmune diseases, women are affected 3‑4 times more aimed to evaluate the PSMA6 and PSMC6 genetic variations, frequently than men (1). About 10% of MS patients experience their interaction between each other and with the rs2348071, a primary progressive MS form characterized by the progres‑ on the susceptibility to MS risk and response to therapy in sion of neurological disability from the onset. In about 90% the Latvian population. PSMA6‑rs2277460, ‑rs1048990 and of MS patients, the disease undergoes the relapse‑remitting PSMC6‑rs2295826, ‑rs2295827 were genotyped in the MS MS course (RRMS); in most of these patients, the condition case/control study and analysed in terms of genotype‑protein acquires secondary progressive course (SPMS) (2).
    [Show full text]
  • A Species-Specific Retrotransposon Drives a Conserved Cdk2ap1 Isoform Essential for Preimplantation Development
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.24.436683; this version posted March 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: A species-specific retrotransposon drives a conserved Cdk2ap1 isoform essential for preimplantation development Authors: Andrew Modzelewski1†, Wanqing Shao2†, Jingqi Chen1, Angus Lee1, Xin Qi1, Mackenzie Noon1, Kristy Tjokro1, Gabriele Sales3, Anne Biton4, Terence Speed5, Zhenyu Xuan6, Ting Wang2#, Davide Risso3# and Lin He1# Affiliations: 1 Division of Cellular and Developmental Biology, MCB department, University of California at Berkeley, Berkeley, CA, USA. 2 Department of Genetics, Washington University School of Medicine, St. Louis, Missouri, USA 3 Department of Statistical Sciences, University of Padova, Italy. 4 Division of Biostatistics, University of California at Berkeley, Berkeley, CA 94720, USA. 5 Bioinformatics Division, WEHI, Parkville, VIC 3052, Australia. 6 Department of Biological Sciences, The University of Texas at Dallas, Richardson Texas, USA # Correspondence to: [email protected], [email protected] and [email protected] †These authors contributed equally. Abstract: Retrotransposons mediate gene regulation in multiple developmental and pathological processes. Here, we characterized the transient retrotransposon induction in preimplantation development of eight mammalian species. While species-specific in sequences, induced retrotransposons exhibit a similar preimplantation profile, conferring gene regulatory activities particularly through LTR retrotransposon promoters. We investigated a mouse-specific MT2B2 retrotransposon promoter, which generates an N-terminally truncated, preimplantation-specific Cdk2ap1ΔN isoform to promote cell proliferation. Cdk2ap1ΔN functionally contrasts to the canonical Cdk2ap1, which represses cell proliferation and peaks in mid-gestation stage.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
    [Show full text]
  • A Chromosome Level Genome of Astyanax Mexicanus Surface Fish for Comparing Population
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title 2 A chromosome level genome of Astyanax mexicanus surface fish for comparing population- 3 specific genetic differences contributing to trait evolution. 4 5 Authors 6 Wesley C. Warren1, Tyler E. Boggs2, Richard Borowsky3, Brian M. Carlson4, Estephany 7 Ferrufino5, Joshua B. Gross2, LaDeana Hillier6, Zhilian Hu7, Alex C. Keene8, Alexander Kenzior9, 8 Johanna E. Kowalko5, Chad Tomlinson10, Milinn Kremitzki10, Madeleine E. Lemieux11, Tina 9 Graves-Lindsay10, Suzanne E. McGaugh12, Jeff T. Miller12, Mathilda Mommersteeg7, Rachel L. 10 Moran12, Robert Peuß9, Edward Rice1, Misty R. Riddle13, Itzel Sifuentes-Romero5, Bethany A. 11 Stanhope5,8, Clifford J. Tabin13, Sunishka Thakur5, Yamamoto Yoshiyuki14, Nicolas Rohner9,15 12 13 Authors for correspondence: Wesley C. Warren ([email protected]), Nicolas Rohner 14 ([email protected]) 15 16 Affiliation 17 1Department of Animal Sciences, Department of Surgery, Institute for Data Science and 18 Informatics, University of Missouri, Bond Life Sciences Center, Columbia, MO 19 2 Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 20 3 Department of Biology, New York University, New York, NY 21 4 Department of Biology, The College of Wooster, Wooster, OH 22 5 Harriet L. Wilkes Honors College, Florida Atlantic University, Jupiter FL 23 6 Department of Genome Sciences, University of Washington, Seattle, WA 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.06.189654; this version posted July 6, 2020.
    [Show full text]
  • Identification of Mirnas and Their Targets Through High-Throughput
    Chen et al. BMC Plant Biology (2016) 16:80 DOI 10.1186/s12870-016-0770-z RESEARCH ARTICLE Open Access Identification of miRNAs and their targets through high-throughput sequencing and degradome analysis in male and female Asparagus officinalis Jingli Chen1†, Yi Zheng2†, Li Qin1†, Yan Wang1, Lifei Chen1, Yanjun He1, Zhangjun Fei2,3 and Gang Lu1* Abstract Background: MicroRNAs (miRNAs), a class of non-coding small RNAs (sRNAs), regulate various biological processes. Although miRNAs have been identified and characterized in several plant species, miRNAs in Asparagus officinalis have not been reported. As a dioecious plant with homomorphic sex chromosomes, asparagus is regarded as an important model system for studying mechanisms of plant sex determination. Results: Two independent sRNA libraries from male and female asparagus plants were sequenced with Illumina sequencing, thereby generating 4.13 and 5.88 million final clean reads, respectively. Both libraries predominantly contained 24-nt sRNAs, followed by 21-nt sRNAs. Further analysis identified 154 conserved miRNAs, which belong to 26 families, and 39 novel miRNA candidates seemed to be specific to asparagus. Comparative profiling revealed that 63 miRNAs exhibited significant differential expression between male and female plants, which was confirmed by real-time quantitative PCR analysis. Among them, 37 miRNAs were significantly up-regulated in the female library, whereas the others were preferentially expressed in the male library. Furthermore, 40 target mRNAs representing 44 conserved and seven novel miRNAs were identified in asparagus through high-throughput degradome sequencing. Functional annotation showed that these target mRNAs were involved in a wide range of developmental and metabolic processes.
    [Show full text]
  • The Genetics of Bipolar Disorder
    Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF.
    [Show full text]
  • The Role of Micrornas in Oral Squamous Cell Carcinoma Pathogenesis: a Literature Review
    Applied Cancer Research. 2013;33(4):198-205. REVIEW The role of microRNAS in oral squamous cell carcinoma pathogenesis: a literature review Anne Maria Guimarães Lessa1, Ludmila Faro Valverde2, Rosane Borges Dias2, Maria Cecília Mathias Machado1, Jean Nunes dos Santos3, Clarissa Araújo Gurgel Rocha3 ABSTRACT In this review, we summarize the main aspects related to the involvement of microRNAs (miRNAs) in oral carcinogenesis. miRNAs are small non-protein-coding RNAs that function such as regulators of gene expression. They regulate various biological processes such as growth, differentiation and apoptosis and have been widely studied in carcinogenesis. miRNAs may exhibit oncogenic or tumor suppressor activity in cancer, depending on the biological context and the cell type. The altered expression patterns of miRNA in cancer could serve as molecular biomarkers for tumor diagnosis, prognosis and disease-specific prediction of therapeutic responses. The literature indicates that up-regulation of miR-21, miR-221, miR-184 and under expression of miR-133a, miR-375 and let-7b are the principal profile in oral squamous cell carcinomas. Keywords: gene expression; microRNAS; MIRN133 microRNA, human; MIRN184 microRNA, human; MIRN21 microRNA, human; MIRN221 microRNA, human; MIRN375 microRNA, human; mirnlet7 microRNA, human; mouth mucosa; mouth neoplasms; tumor markers, biological. INTRODUCTION years later, Reinhart et al.12 observed that another C. elegans heterochronic gene, let-7, was also represented by a small Cells have developed several biological mechanisms to non-coding RNA capable of starting the temporal cascade of ensure that mitosis, differentiation and death occur in a coor- regulatory genes through an RNA-RNA interaction with the 3 dinated manner and disturbances in genes related with these untranslated region (UTR) of target genes.
    [Show full text]
  • Full-Text (PDF)
    Original Article Iran J Ped Hematol Oncol. 2019, Vol9, No4, 49-56 Effect of Estradiol on miR-21& miR-155 Expression in promyelocytic leukemia-derived cell line NB4 Robab Naghibzadeh MSc1, Narges Obeidi PhD1,2,*, Alireza Farsinejd PhD3,Gholamreza Khamisipour PhD1, Masoud TohidFar PhD4 1. Department of Hematology, School of Para Medicine, Bushehr University of Medical Sciences, Bushehr, Iran 2. Blood Transfusion Organization, Bushehr, Iran 3. Department of Hematology and Medical Laboratory Sciences, Faculty of Allied Medical Sciences, Kerman University of Medical Sciences, Kerman, Iran 4. Department of Hematology and Medical Laboratory Sciences, Faculty of Allied Medical Sciences, ShahidBeheshti University of Medical Sciences, Tehran, Iran *Corresponding author:Dr Narges Obeidi, Department of Hematology, School of Para Medicine, Bushehr University of Medical Sciences, Bushehr, Iran. E-mail: [email protected]. Orchid ID:0000-0001-8087-2850 Received: 25 March 2019 Accepted: 10 November 2019 Abstract Background: Due to the estrogen participation in modulating the proliferation and commitment of stem cells and the effects of miR-21 and miR-155 expression on reduced proliferation and colony formation of acute myeloid leukemia (AML), the aim of the present study was to evaluate the effect of estradiol on expression of miR-21 and miR-155 in the NB4 cell line, as an acute promyelocytic leukemia (APL). Materials and Methods: In the present experiment, NB4 cells were treated with different quantities of estradiol (5, 25, 50, 75, 100, 150, 200, 250 μg/ml) and vehicle control for 24 and 48 hours. Viability, apoptosis, and cellular proliferation were estimated by trypan blue exclusion, flow cytometry, and MTT assays, respectively.
    [Show full text]
  • Micrornas in Development and Disease
    Clin Genet 2008: 74: 296–306 # 2008 The Authors Printed in Singapore. All rights reserved Journal compilation # 2008 Blackwell Munksgaard CLINICAL GENETICS doi: 10.1111/j.1399-0004.2008.01076.x Review MicroRNAs in development and disease Erson AE, Petty EM. MicroRNAs in development and disease. AE Ersona and EM Pettyb,c # Clin Genet 2008: 74: 296–306. Blackwell Munksgaard, 2008 aDepartment of Biological Sciences, Middle East Technical University (METU), Since the discovery of microRNAs (miRNAs) in Caenorhabditis elegans, Ankara, Turkey, and bDepartment of mounting evidence illustrates the important regulatory roles for miRNAs Internal Medicine and cDepartment of in various developmental, differentiation, cell proliferation, and Human Genetics, University of Michigan, apoptosis pathways of diverse organisms. We are just beginning to MI, USA elucidate novel aspects of RNA mediated gene regulation and to understand how heavily various molecular pathways rely on miRNAs for their normal function. miRNAs are small non-protein-coding transcripts that regulate gene expression post-transcriptionally by targeting Key words: cancer – development – messenger RNAs (mRNAs). While individual miRNAs have been microRNA – viral infection specifically linked to critical developmental pathways, the deregulated Corresponding author: Elizabeth M Petty, expression of many miRNAs also has been shown to have functional Department of Internal Medicine, significance for multiple human diseases, such as cancer. We continue to University of Michigan, 5220 MSRB III, discover novel functional roles for miRNAs at a rapid pace. Here, we 1150 West Medical Center Drive, Ann summarize some of the key recent findings on miRNAs, their mode of Arbor, MI 48109-0640, USA. action, and their roles in both normal development and in human Tel.: 1(734) 763-2532; pathology.
    [Show full text]
  • Exploring the Regulatory Mechanism of the Notch Ligand Receptor Jagged1 Via the Aryl Hydrocarbon Receptor in Breast Cancer Sean Alan Piwarski
    Marshall University Marshall Digital Scholar Theses, Dissertations and Capstones 2018 Exploring the Regulatory Mechanism of the Notch Ligand Receptor Jagged1 Via the Aryl Hydrocarbon Receptor in Breast Cancer Sean Alan Piwarski Follow this and additional works at: https://mds.marshall.edu/etd Part of the Biological Phenomena, Cell Phenomena, and Immunity Commons, Medical Molecular Biology Commons, Medical Toxicology Commons, and the Oncology Commons EXPLORING THE REGULATORY MECHANISM OF THE NOTCH LIGAND RECEPTOR JAGGED1 VIA THE ARYL HYDROCARBON RECEPTOR IN BREAST CANCER A dissertation submitted to the Graduate College of Marshall University In partial fulfillment of the requirements for the degree of Doctor of Philosophy In Biomedical Sciences by Sean Alan Piwarski Approved by Dr. Travis Salisbury, Committee Chairperson Dr. Gary Rankin Dr. Monica Valentovic Dr. Richard Egleton Dr. Todd Green Marshall University July 2018 APPROVAL OF DISSERTATION We, the faculty supervising the work of Sean Alan Piwarski, affirm that the dissertation, Exploring the Regulatory Mechanism of the Notch Ligand Receptor JAGGED1 via the Aryl Hydrocarbon Receptor in Breast Cancer, meets the high academic standards for original scholarship and creative work established by the Biomedical Sciences program and the Graduate College of Marshall University. This work also conforms to the editorial standards of our discipline and the Graduate College of Marshall University. With our signatures, we approve the manuscript for publication. ii © 2018 SEAN ALAN PIWARSKI ALL RIGHTS RESERVED iii DEDICATION To my mom and dad, This dissertation is a product of your hard work and sacrifice as amazing parents. I could never have accomplished something of this magnitude without your love, support, and constant encouragement.
    [Show full text]
  • Bioinformatics Analysis of the CDK2 Functions in Neuroblastoma
    MOLECULAR MEDICINE REPORTS 17: 3951-3959, 2018 Bioinformatics analysis of the CDK2 functions in neuroblastoma LIJUAN BO1*, BO WEI2*, ZHANFENG WANG2, DALIANG KONG3, ZHENG GAO2 and ZHUANG MIAO2 Departments of 1Infections, 2Neurosurgery and 3Orthopaedics, China-Japan Union Hospital of Jilin University, Changchun, Jilin 130033, P.R. China Received December 20, 2016; Accepted November 14, 2017 DOI: 10.3892/mmr.2017.8368 Abstract. The present study aimed to elucidate the poten- childhood cancer mortality (1,2). Despite intensive myeloabla- tial mechanism of cyclin-dependent kinase 2 (CDK2) in tive chemotherapy, survival rates for neuroblastoma have not neuroblastoma progression and to identify the candidate substantively improved; relapse is common and frequently genes associated with neuroblastoma with CDK2 silencing. leads to mortality (3,4). Like most human cancers, this child- The microarray data of GSE16480 were obtained from the hood cancer can be inherited; however, the genetic aetiology gene expression omnibus database. This dataset contained remains to be elucidated (3). Therefore, an improved under- 15 samples: Neuroblastoma cell line IMR32 transfected standing of the genetics and biology of neuroblastoma may with CDK2 shRNA at 0, 8, 24, 48 and 72 h (n=3 per group; contribute to further cancer therapies. total=15). Significant clusters associated with differen- In terms of genetics, neuroblastoma tumors from patients tially expressed genes (DEGs) were identified using fuzzy with aggressive phenotypes often exhibit significant MYCN C-Means algorithm in the Mfuzz package. Gene ontology and proto-oncogene, bHLH transcription factor (MYCN) amplifi- pathway enrichment analysis of DEGs in each cluster were cation and are strongly associated with a poor prognosis (5).
    [Show full text]
  • Therapeutic Evaluation of Micrornas by Molecular Imaging Thillai V
    Theranostics 2013, Vol. 3, Issue 12 964 Ivyspring International Publisher Theranostics 2013; 3(12):964-985. doi: 10.7150/thno.4928 Review Therapeutic Evaluation of microRNAs by Molecular Imaging Thillai V. Sekar1, Ramkumar Kunga Mohanram1, 2, Kira Foygel1, and Ramasamy Paulmurugan1 1. Molecular Imaging Program at Stanford, Bio-X Program, Department of Radiology, Stanford University School of Medicine, Stanford, California, USA. 2. Current address: SRM Research Institute, SRM University, Kattankulathur– 603 203, Tamilnadu, India Corresponding author: Ramasamy Paulmurugan, Ph.D. Department of Radiology, Stanford University School of Medicine, 1501, South California Avenue, #2217, Palo Alto, CA 94304. Phone: 650-725-6097; Fax: 650-721-6921. Email: [email protected] © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.07.26; Accepted: 2013.09.22; Published: 2013.12.06 Abstract MicroRNAs (miRNAs) function as regulatory molecules of gene expression with multifaceted activities that exhibit direct or indirect oncogenic properties, which promote cell proliferation, differentiation, and the development of different types of cancers. Because of their extensive functional involvement in many cellular processes, under both normal and pathological conditions such as various cancers, this class of molecules holds particular interest for cancer research. MiRNAs possess the ability to act as tumor suppressors or oncogenes by regulating the expression of different apoptotic proteins, kinases, oncogenes, and other molecular mechanisms that can cause the onset of tumor development.
    [Show full text]