DOCSLIB.ORG

Therapeutic Evaluation of Micrornas by Molecular Imaging Thillai V

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Therapeutic Evaluation of Micrornas by Molecular Imaging Thillai V Theranostics 2013, Vol. 3, Issue 12 964 Ivyspring International Publisher Theranostics 2013; 3(12):964-985. doi: 10.7150/thno.4928 Review Therapeutic Evaluation of microRNAs by Molecular Imaging Thillai V. Sekar1, Ramkumar Kunga Mohanram1, 2, Kira Foygel1, and Ramasamy Paulmurugan1 1. Molecular Imaging Program at Stanford, Bio-X Program, Department of Radiology, Stanford University School of Medicine, Stanford, California, USA. 2. Current address: SRM Research Institute, SRM University, Kattankulathur– 603 203, Tamilnadu, India Corresponding author: Ramasamy Paulmurugan, Ph.D. Department of Radiology, Stanford University School of Medicine, 1501, South California Avenue, #2217, Palo Alto, CA 94304. Phone: 650-725-6097; Fax: 650-721-6921. Email: [email protected] © Ivyspring International Publisher. This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/). Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. Received: 2013.07.26; Accepted: 2013.09.22; Published: 2013.12.06 Abstract MicroRNAs (miRNAs) function as regulatory molecules of gene expression with multifaceted activities that exhibit direct or indirect oncogenic properties, which promote cell proliferation, differentiation, and the development of different types of cancers. Because of their extensive functional involvement in many cellular processes, under both normal and pathological conditions such as various cancers, this class of molecules holds particular interest for cancer research. MiRNAs possess the ability to act as tumor suppressors or oncogenes by regulating the expression of different apoptotic proteins, kinases, oncogenes, and other molecular mechanisms that can cause the onset of tumor development. In contrast to current cancer medicines, miRNA-based therapies function by subtle repression of gene expression on a large number of oncogenic factors, and therefore are anticipated to be highly efficacious. Given their unique mechanism of action, miRNAs are likely to yield a new class of targeted therapeutics for a variety of cancers. More than thousand miRNAs have been identified to date, and their molecular mechanisms and functions are well studied. Furthermore, they are established as compelling therapeutic targets in a variety of cellular complications. However, the notion of using them as therapeutic tool was proposed only recently, given that modern imaging methods are just beginning to be deployed for miRNA re- search. In this review, we present a summary of various molecular imaging methods, which are instrumental in revealing the therapeutic potential of miRNAs, especially in various cancers. Im- aging methods have recently been developed for monitoring the expression levels of miRNAs and their target genes by fluorescence-, bioluminescence- and chemiluminescence-based imaging techniques. Mature miRNAs bind to the untranslated regions (UTRs) of the target mRNAs and regulate target genes expressions. This concept has been used for the development of fluorescent reporter-based imaging strategies to monitor the functional status of endogenous miRNAs, or the respective miRNAs transiently co-expressed in cells. Bioluminescence-based imaging strategies have been used to investigate various stages of miRNA processing and its involvement in different cellular processes. Similarly, chemiluminsecence methods were developed for in vitro miRNA imaging such as monitoring their therapeutic roles in various cancer cell lines. Key words: miRNAs, molecular Imaging Introduction nucleotides in length spliced from hair-pin loop tran- scripts of pre-miRNAs, which are ∼60 to 80 nucleo- MicroRNAs tides in length. MicroRNAs are coded by approxi- MicroRNAs (miRNA) are single stranded, evo- mately 1% genome in many species [1, 2], and by ap- lutionarily conserved non-coding RNAs of 19 to 25 proximately 3% in the human genome. MicroRNAs http://www.thno.org Theranostics 2013, Vol. 3, Issue 12 965 function as regulatory molecules of gene expression in by messenger degradation or blocking translation cells. MicroRNAs have been shown to regulate the initiation [7]. The miRNA encoding gene sequences expression of a variety of target genes that are in- are mostly located in the intergenic regions. However, volved in different cellular processes, which include some of the miRNA genes are also identified from the cell proliferation, apoptosis, differentiation, stem cell intronic regions of some well-known genes in both the development, and genes that are associated with sense and antisense orientations [8]. MiRNAs are en- various human diseases, including cancer [3]. MiRNA coded either independently, or as a cluster of several coding genes are transcribed into long primary tran- miRNAs under the same promoter [9]. scripts called pri-miRNA by RNA polymerase II, with Functional roles of miRNAs in normal cells, local hairpin structures and flanking sequences. and cells in different pathological conditions Drosha and RNase III are two other nucleases which trim the flanking sequence and produce the precursor MicroRNAs of different types are expressed by miRNA known as pre-miRNA [4]. This entire process cells to maintain cellular homeostasis. By contrast, of pre-miRNA processing occurs inside the nucleus dysregulated expressions of various miRNAs are (Figure 1). Subsequently, the pre-miRNA is actively found in cells at different pathological conditions. It is transported to cytoplasm through nuclear pore com- well known that microRNAs are implicated in various plex by exportin-5, one of the nuclear transport re- human diseases. According to miRbase [18], 1,921 ceptors [5]. Following the export, pre-miRNA is mature miRNAs were identified in human cells. So cleaved by Dicer, the cytoplasmic RNase III [6], into far, 349 miRNAs have been identified to be associated mature miRNA of ~22-bp duplex, and thereafter, ef- with over 163 different human diseases [10], with fector complexes that are termed as ‘miRNP’ (miR- most of them being associated with various cancers. NA-containing ribonucleoprotein complex) or ‘miR- In cancer cells, dysregulated miRNAs are mainly in- ISC’ (miRNA-containing RNA-induced silencing volved in regulating cell differentiation, proliferation, complex) are formed. The 22-bp duplex is not stable in and apoptosis. Apart from cancer, microRNAs are the effector complex; one strand of the duplex, possi- also reported to be associated with cardiovascular bly the one with unstable base pairs at the 5’-end, diseases [11], neurological diseases [12], viral diseases remains active and directs the RISC complex to target [13], and metabolic disorders [14]. mRNA and provides the regulatory silencing effects Figure 1. Schematic representation of miRNA processing and various modes of Imaging. http://www.thno.org Theranostics 2013, Vol. 3, Issue 12 966 MicroRNAs in cancer sis [18]. MiR-21 has been implicated in the develop- ment of glioblastoma, and it is also recognized as an Despite the substantial progress in understand- anti-apoptotic miRNA due to its ability in blocking ing the complex signaling network in cancer, effective genes responsible for controlling apoptosis [19]. therapies remain scarce due to unpredictable disrup- tion of oncogenic pathways, drug resistance, and Tumor suppressor miRNAs drug-induced toxicity. Because cancer is a complex MicroRNAs possess the ability to act as tumor disease that lacks effective therapy, there is an urgent suppressors by regulating the expression of onco- need for researchers and clinicians to combine drugs genes, apoptotic proteins, kinases, and other molecu- targeting more than one pathway and develop novel lar mechanisms that can cause the onset of tumor de- therapeutic strategies. The discovery of microRNAs velopment. MicroRNA let-7 was identified as a tumor provides new hope for accomplishing this task with suppressor in different types of tumors, such as breast the promising success rate. Supported by solid evi- cancer [20], colorectal cancer [21], lung cancer [22], dence for their critical role in cancer and bolstered by and leiomyoma [23]. MiR-122 from let-7 family, and a unique mechanism of action, miRNAs are likely to miR-101, are shown to function as tumor-suppressors yield a new class of targeted therapeutics. In contrast in hepatocellular carcinoma (HCC) [24]. Recently, to current cancer medicines, miRNA-based therapies miR-409-3p was recognized as a tumor suppressor by function by subtle repression of gene expression on a targeting transcriptional regulator PHF10 in gastric large number of oncogenic factors, and therefore are cancer [25]. MiR-508-3p and miR-509-3p were re- anticipated to be highly efficacious. After completion ported as tumor suppressors in renal cell carcinoma of target validation for several candidates, the devel- (RCC) mainly because their overexpression has been opment of therapeutic miRNAs is now moving to a shown to significantly suppress the proliferation of new stage that involves pharmacological drug deliv- RCC, induce cellular apoptosis, and inhibit tumor cell ery, preclinical toxicology, and regulatory guidelines, migrations in vitro [26]. Similarly, miR-1, miR-206 and using powerful molecular imaging techniques that miR-29 were shown to play a role of tumor suppres- can monitor processes inside the cell and study their sion in rhabdomyosarcoma [27]. Downregulation of complex pathways. these miRNAs stabilizes the expression
Load more

Recommended publications
  • Non-Coding Rnas As Cancer Hallmarks in Chronic Lymphocytic Leukemia
    International Journal of Molecular Sciences Review Non-Coding RNAs as Cancer Hallmarks in Chronic Lymphocytic Leukemia Linda Fabris 1, Jaroslav Juracek 2 and George Calin 1,* 1 Department of Translational Molecular Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA; [email protected] 2 Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA; [email protected] * Correspondence: [email protected] Received: 24 July 2020; Accepted: 10 September 2020; Published: 14 September 2020 Abstract: The discovery of non-coding RNAs (ncRNAs) and their role in tumor onset and progression has revolutionized the way scientists and clinicians study cancers. This discovery opened new layers of complexity in understanding the fine-tuned regulation of cellular processes leading to cancer. NcRNAs represent a heterogeneous group of transcripts, ranging from a few base pairs to several kilobases, that are able to regulate gene networks and intracellular pathways by interacting with DNA, transcripts or proteins. Deregulation of ncRNAs impinge on several cellular responses and can play a major role in each single hallmark of cancer. This review will focus on the most important short and long non-coding RNAs in chronic lymphocytic leukemia (CLL), highlighting their implications as potential biomarkers and therapeutic targets as they relate to the well-established hallmarks of cancer. The key molecular events in the onset of CLL will be contextualized, taking into account the role of the “dark matter” of the genome. Keywords: chronic lymphocytic leukemia; lncRNA; miRNA; hallmarks 1. Introduction: Current Status of Chronic Lymphocytic Leukemia Research Chronic lymphocytic leukemia (CLL) is the most common leukemia in adults in the Western world, representing more than 30% of all leukemia cases [1].
    [Show full text]
  • Microrna-33A Regulates Cholesterol Synthesis and Cholesterol Efflux
    Kostopoulou et al. Arthritis Research & Therapy (2015) 17:42 DOI 10.1186/s13075-015-0556-y RESEARCH ARTICLE Open Access MicroRNA-33a regulates cholesterol synthesis and cholesterol efflux-related genes in osteoarthritic chondrocytes Fotini Kostopoulou1,2, Konstantinos N Malizos2,3, Ioanna Papathanasiou1 and Aspasia Tsezou1,2,4* Abstract Introduction: Several studies have shown that osteoarthritis (OA) is strongly associated with metabolism-related disorders, highlighting OA as the fifth component of the metabolic syndrome (MetS). On the basis of our previous findings on dysregulation of cholesterol homeostasis in OA, we were prompted to investigate whether microRNA-33a (miR-33a), one of the master regulators of cholesterol and fatty acid metabolism, plays a key role in OA pathogenesis. Methods: Articular cartilage samples were obtained from 14 patients with primary OA undergoing total knee replacement surgery. Normal cartilage was obtained from nine individuals undergoing fracture repair surgery. Bioinformatics analysis was used to identify miR-33a target genes. miR-33a and sterol regulatory element-binding protein 2 (SREBP-2) expression levels were investigated using real-time PCR, and their expression was also assessed after treatment with transforming growth factor-β1(TGF-β1) in cultured chondrocytes.Aktphosphorylationafter treatment with both TGF-β1 and miR-33a inhibitor or TGF-β1 and miR-33a mimic was assessed by Western blot analysis. Furthermore, we evaluated the effect of miR-33a mimic and miR-33a inhibitor on Smad7,anegative regulator of TGF-β signaling, on cholesterol efflux-related genes, ATP-binding cassette transporter A1 (ABCA1), apolipoprotein A1 (ApoA1)andliverXreceptors(LXRα and LXRβ), as well as on matrix metalloproteinase-13 (MMP-13), using real-time PCR.
    [Show full text]
  • The Malignant Phenotype in Breast Cancer Is Driven by Eif4a1-Mediated Changes in the Translational Landscape
    Citation: Cell Death and Disease (2015) 6, e1603; doi:10.1038/cddis.2014.542 OPEN & 2015 Macmillan Publishers Limited All rights reserved 2041-4889/15 www.nature.com/cddis The malignant phenotype in breast cancer is driven by eIF4A1-mediated changes in the translational landscape A Modelska1, E Turro1,2, R Russell1, J Beaton1, T Sbarrato3, K Spriggs4, J Miller1, S Gräf1,2,5, E Provenzano6,7, F Blows8, P Pharoah6,8, C Caldas1,6 and J Le Quesne*,1,3 Human mRNA DeXD/H-box helicases are ubiquitous molecular motors that are required for the majority of cellular processes that involve RNA metabolism. One of the most abundant is eIF4A, which is required during the initiation phase of protein synthesis to unwind regions of highly structured mRNA that would otherwise impede the scanning ribosome. Dysregulation of protein synthesis is associated with tumorigenesis, but little is known about the detailed relationships between RNA helicase function and the malignant phenotype in solid malignancies. Therefore, immunohistochemical analysis was performed on over 3000 breast tumors to investigate the relationship among expression of eIF4A1, the helicase-modulating proteins eIF4B, eIF4E and PDCD4, and clinical outcome. We found eIF4A1, eIF4B and eIF4E to be independent predictors of poor outcome in ER-negative disease, while in contrast, the eIF4A1 inhibitor PDCD4 was related to improved outcome in ER-positive breast cancer. Consistent with these data, modulation of eIF4A1, eIF4B and PCDC4 expression in cultured MCF7 cells all restricted breast cancer cell growth and cycling. The eIF4A1-dependent translatome of MCF7 cells was defined by polysome profiling, and was shown to be highly enriched for several classes of oncogenic genes, including G-protein constituents, cyclins and protein kinases, and for mRNAs with G/C-rich 5′UTRs with potential to form G-quadruplexes and with 3′UTRs containing microRNA target sites.
    [Show full text]
  • Ablation of Mir-144 Increases Vimentin Expression and Atherosclerotic Plaque Formation Quan He1, Fangfei Wang1, Takashi Honda1, Kenneth D
    www.nature.com/scientificreports OPEN Ablation of miR-144 increases vimentin expression and atherosclerotic plaque formation Quan He1, Fangfei Wang1, Takashi Honda1, Kenneth D. Greis2 & Andrew N. Redington1* It has been suggested that miR-144 is pro-atherosclerotic via efects on reverse cholesterol transportation targeting the ATP binding cassette protein. This study used proteomic analysis to identify additional cardiovascular targets of miR-144, and subsequently examined the role of a newly identifed regulator of atherosclerotic burden in miR-144 knockout mice receiving a high fat diet. To identify afected secretory proteins, miR-144 treated endothelial cell culture medium was subjected to proteomic analysis including two-dimensional gel separation, trypsin digestion, and nanospray liquid chromatography coupled to tandem mass spectrometry. We identifed 5 gel spots representing 19 proteins that changed consistently across the biological replicates. One of these spots, was identifed as vimentin. Atherosclerosis was induced in miR-144 knockout mice by high fat diet and vascular lesions were quantifed by Oil Red-O staining of the serial sectioned aortic root and from en-face views of the aortic tree. Unexpectedly, high fat diet induced extensive atherosclerosis in miR-144 knockout mice and was accompanied by severe fatty liver disease compared with wild type littermates. Vimentin levels were reduced by miR-144 and increased by antagomiR-144 in cultured cardiac endothelial cells. Compared with wild type, ablation of the miR-144/451 cluster increased plasma vimentin, while vimentin levels were decreased in control mice injected with synthetic miR-144. Furthermore, increased vimentin expression was prominent in the commissural regions of the aortic root which are highly susceptible to atherosclerotic plaque formation.
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
    [Show full text]
  • Cancer Stem Cells in Pancreatic Cancer
    Cancers 2010, 2, 1629-1641; doi:10.3390/cancers2031629 OPEN ACCESS cancers ISSN 2072-6694 www.mdpi.com/journal/cancers Review Cancer Stem Cells in Pancreatic Cancer Qi Bao †, Yue Zhao †, Andrea Renner, Hanno Niess, Hendrik Seeliger, Karl-Walter Jauch and Christiane J. Bruns * Department of Surgery, Ludwig Maximilian University of Munich, Klinikum Grosshadern, Marchioninistr. 15, D-81377, Munich, Germany; E-Mails: [email protected] (Q.B.); [email protected] (Y.Z.); [email protected] (A.R.); [email protected] (H.N.); [email protected] (H.S.); [email protected] (K.W.J.) † These authors contributed equally to this work. * Author to whom correspondence should be addressed; Tel.: +49-89-7095-3570; Fax: +49-89-7095-8894; E-Mail: [email protected]. Received: 2 July 2010; in revised form: 29 July 2010 / Accepted: 18 August 2010 / Published: 19 August 2010 Abstract: Pancreatic cancer is an aggressive malignant solid tumor well-known by early metastasis, local invasion, resistance to standard chemo- and radiotherapy and poor prognosis. Increasing evidence indicates that pancreatic cancer is initiated and propagated by cancer stem cells (CSCs). Here we review the current research results regarding CSCs in pancreatic cancer and discuss the different markers identifying pancreatic CSCs. This review will focus on metastasis, microRNA regulation and anti-CSC therapy in pancreatic cancer. Keywords: cancer stem cells; pancreatic cancer; signaling pathways; metastasis; CSC-related therapy; microRNAs 1. Introduction Stem cells are a subpopulation of cells that have the capability to differentiate into multiple cell types and maintain their self-renewal activity.
    [Show full text]
  • Distinct Roles of Different Fragments of PDCD4 in Regulating the Metastatic Behavior of B16 Melanoma Cells
    INTERNATIONAL JOURNAL OF ONCOLOGY 42: 1725-1733, 2013 Distinct roles of different fragments of PDCD4 in regulating the metastatic behavior of B16 melanoma cells DI WANG, SHU GUO, SI-YUAN HAN, NAN XU, JIA-YAN GUO and QING SUN Department of Plastic Surgery, The First Hospital of China Medical University, Shenyang, Liaoning 110001, P.R. China Received December 12, 2012; Accepted January 29, 2013 DOI: 10.3892/ijo.2013.1841 Abstract. Melanoma is an aggressive cutaneous malignancy. In mice (7,8). As shown in Fig. 1, full length human PDCD4 this study, we demonstrated that the levels of the programmed contains an N-terminal putative RNA-binding domain cell death 4 (PDCD4) protein and mRNA were lower in tumor (residues 1-140) and two tandem MA3 domains, designated tissues compared with normal tissues. In order to further as nMA3 (residues 164-275) and cMA3 (residues 327-440) investigate the effects of PDCD4 and its fragments in B16 (9). The two MA3 domains have very similar structure and melanoma cells, we established B16 clones with expression of eIF4A-binding surfaces (10). The molecular basis for PDCD4- different PDCD4 fragments. Intact PDCD4, PDCD4∆164-469 mediated suppression has been linked to its high affinity and PDCD4∆327-440 expression, respectively, decreased MA-3 domains (11,12). NMR binding analysis has shown proliferation and migration and increased apoptosis in B16 that both MA3 domains of PDCD4 interacted with eIF4A cells in vitro. We found that intact PDCD4, PDCD4∆164-469 and prevented translation (10,11). However, another study has or PDCD4∆327-440 can inhibit the activity of MMP-2 and the demonstrated that the cMA3 domain alone is sufficient for expression of CXCR4.
    [Show full text]
  • Micrornas Mediated Regulation of the Ribosomal Proteins and Its Consequences on the Global Translation of Proteins
    cells Review microRNAs Mediated Regulation of the Ribosomal Proteins and Its Consequences on the Global Translation of Proteins Abu Musa Md Talimur Reza 1,2 and Yu-Guo Yuan 1,3,* 1 Jiangsu Co-Innovation Center of Prevention and Control of Important Animal Infectious Diseases and Zoonoses, College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China; [email protected] 2 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawi´nskiego5a, 02-106 Warsaw, Poland 3 Jiangsu Key Laboratory of Zoonosis/Joint International Research Laboratory of Agriculture and Agri-Product Safety, The Ministry of Education of China, Yangzhou University, Yangzhou 225009, China * Correspondence: [email protected]; Tel.: +86-514-8797-9228 Abstract: Ribosomal proteins (RPs) are mostly derived from the energy-consuming enzyme families such as ATP-dependent RNA helicases, AAA-ATPases, GTPases and kinases, and are important structural components of the ribosome, which is a supramolecular ribonucleoprotein complex, composed of Ribosomal RNA (rRNA) and RPs, coordinates the translation and synthesis of proteins with the help of transfer RNA (tRNA) and other factors. Not all RPs are indispensable; in other words, the ribosome could be functional and could continue the translation of proteins instead of lacking in some of the RPs. However, the lack of many RPs could result in severe defects in the biogenesis of ribosomes, which could directly influence the overall translation processes and global expression of the proteins leading to the emergence of different diseases including cancer. While microRNAs (miRNAs) are small non-coding RNAs and one of the potent regulators of the post-transcriptional 0 gene expression, miRNAs regulate gene expression by targeting the 3 untranslated region and/or coding region of the messenger RNAs (mRNAs), and by interacting with the 50 untranslated region, Citation: Reza, A.M.M.T.; Yuan, Y.-G.
    [Show full text]
  • Oncomir Mir-125B Regulates Hematopoiesis by Targeting the Gene Lin28a
    Oncomir miR-125b regulates hematopoiesis by targeting the gene Lin28A Aadel A. Chaudhuria,1, Alex Yick-Lun Soa,1, Arnav Mehtaa, Aarathi Minisandrama, Nikita Sinhaa, Vanessa D. Jonssonb, Dinesh S. Raoc, Ryan M. O’Connelld, and David Baltimorea,2 Departments of aBiology and bComputing and Mathematical Sciences, California Institute of Technology, Pasadena, CA 91125; cDepartment of Pathology and Laboratory Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095; and dDepartment of Pathology, University of Utah, Salt Lake City, UT 84112 Contributed by David Baltimore, January 23, 2012 (sent for review October 29, 2011) MicroRNA-125b (miR-125b) is up-regulated in patients with leukemia. regulation of miR-125b has profound effects on normal hema- Overexpression of miR-125b alone in mice causes a very aggressive, topoiesis, and Lin28A overexpression mimics those effects. transplantable myeloid leukemia. Before leukemia, these mice do not display elevation of white blood cells in the spleen or bone marrow; Results rather, the hematopoietic compartment shows lineage-skewing, with miR-125b Ectopic Expression Favors Myeloid Differentiation and myeloid cell numbers dramatically increased and B-cell numbers Causes a Highly Invasive Myeloid Leukemia. Previously, we showed severely diminished. miR-125b exerts this effect by up-regulating the that overexpression of miR-125b in bone marrow-transplanted number of common myeloid progenitors while inhibiting develop- recipient mice causes a myeloid leukemia 4–6 mo after bone ment of pre-B cells. We applied a miR-125b sponge loss of function marrow reconstitution (5). Here, we found that the neoplastic system in vivo to show that miR-125b physiologically regulates myeloid cells infiltrate nonhematopoietic organs, including the hematopoietic development.
    [Show full text]
  • The Oncogenic Role of Mir-155 in Breast Cancer
    Published OnlineFirst June 26, 2012; DOI: 10.1158/1055-9965.EPI-12-0173 Cancer Epidemiology, MiniReview Biomarkers & Prevention The Oncogenic Role of miR-155 in Breast Cancer Sam Mattiske, Rachel J. Suetani, Paul M. Neilsen, and David F. Callen Abstract miR-155isanoncogenicmiRNAwithwelldescribedrolesinleukemia.However,additionalrolesof miR-155 in breast cancer progression have recently been described. A thorough literature search was conducted to review all published data to date, examining the role of miR-155 in breast cancer. Data on all validated miR-155 target genes was collated to identify biologic pathways relevant to miR-155 and breast cancer progression. Publications describing the clinical relevance, functional characterization, and regu- lation of expression of miR-155 in the context of breast cancer are reviewed. A total of 147 validated miR- 155 target genes were identified from the literature. Pathway analysis of these genes identified likely roles in apoptosis, differentiation, angiogenesis, proliferation, and epithelial–mesenchymal transition. The large number of validated miR-155 targets presented here provide many avenues of interest as to the clinical potential of miR-155. Further investigation of these target genes will be required to elucidate the specific mechanisms and functions of miR-155 in breast cancer. This is the first review examining the role of miR- 155 in breast cancer progression. The collated data of target genes and biologic pathways of miR-155 identified in this review suggest new avenues of research for this oncogenic miRNA. Cancer Epidemiol Biomarkers Prev; 21(8); 1236–43. Ó2012 AACR. Introduction found to regulate levels of LIN-14 protein (7, 8). Since this miRNAs are small noncoding RNAs that control discovery, there have been over 500 miRNAs described, expression of target genes by either inhibiting protein regulating a wide range of genes and cellular processes, translation or directly targeting mRNA transcripts of although the total predicted number of unique miRNAs target genes for degradation (1).
    [Show full text]
  • Identification of Mirnas and Their Targets Through High-Throughput
    Chen et al. BMC Plant Biology (2016) 16:80 DOI 10.1186/s12870-016-0770-z RESEARCH ARTICLE Open Access Identification of miRNAs and their targets through high-throughput sequencing and degradome analysis in male and female Asparagus officinalis Jingli Chen1†, Yi Zheng2†, Li Qin1†, Yan Wang1, Lifei Chen1, Yanjun He1, Zhangjun Fei2,3 and Gang Lu1* Abstract Background: MicroRNAs (miRNAs), a class of non-coding small RNAs (sRNAs), regulate various biological processes. Although miRNAs have been identified and characterized in several plant species, miRNAs in Asparagus officinalis have not been reported. As a dioecious plant with homomorphic sex chromosomes, asparagus is regarded as an important model system for studying mechanisms of plant sex determination. Results: Two independent sRNA libraries from male and female asparagus plants were sequenced with Illumina sequencing, thereby generating 4.13 and 5.88 million final clean reads, respectively. Both libraries predominantly contained 24-nt sRNAs, followed by 21-nt sRNAs. Further analysis identified 154 conserved miRNAs, which belong to 26 families, and 39 novel miRNA candidates seemed to be specific to asparagus. Comparative profiling revealed that 63 miRNAs exhibited significant differential expression between male and female plants, which was confirmed by real-time quantitative PCR analysis. Among them, 37 miRNAs were significantly up-regulated in the female library, whereas the others were preferentially expressed in the male library. Furthermore, 40 target mRNAs representing 44 conserved and seven novel miRNAs were identified in asparagus through high-throughput degradome sequencing. Functional annotation showed that these target mRNAs were involved in a wide range of developmental and metabolic processes.
    [Show full text]
  • Development of Novel Therapeutic Agents by Inhibition of Oncogenic Micrornas
    International Journal of Molecular Sciences Review Development of Novel Therapeutic Agents by Inhibition of Oncogenic MicroRNAs Dinh-Duc Nguyen and Suhwan Chang * ID Department of Biomedical Sciences, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505, Korea; [email protected] * Correspondence: [email protected] Received: 21 November 2017; Accepted: 22 December 2017; Published: 27 December 2017 Abstract: MicroRNAs (miRs, miRNAs) are regulatory small noncoding RNAs, with their roles already confirmed to be important for post-transcriptional regulation of gene expression affecting cell physiology and disease development. Upregulation of a cancer-causing miRNA, known as oncogenic miRNA, has been found in many types of cancers and, therefore, represents a potential new class of targets for therapeutic inhibition. Several strategies have been developed in recent years to inhibit oncogenic miRNAs. Among them is a direct approach that targets mature oncogenic miRNA with an antisense sequence known as antimiR, which could be an oligonucleotide or miRNA sponge. In contrast, an indirect approach is to block the biogenesis of miRNA by genome editing using the CRISPR/Cas9 system or a small molecule inhibitor. The development of these inhibitors is straightforward but involves significant scientific and therapeutic challenges that need to be resolved. In this review, we summarize recent relevant studies on the development of miRNA inhibitors against cancer. Keywords: antimiR; antagomiR; miRNA-sponge; oncomiR; CRISPR/Cas9; cancer therapeutics 1. Introduction Cancer has been the leading cause of death and a major health problem worldwide for many years; basically, it results from out-of-control cell proliferation. Traditionally, several key proteins have been identified and found to affect signaling pathways regulating cell cycle progression, apoptosis, and gene transcription in various types of cancers [1,2].
    [Show full text]