DOCSLIB.ORG

Fau and Its Ubiquitin-Like Domain (FUBI) Transforms Human Osteogenic Sarcoma (HOS) Cells to Anchorage-Independence

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Fau and Its Ubiquitin-Like Domain (FUBI) Transforms Human Osteogenic Sarcoma (HOS) Cells to Anchorage-Independence Oncogene (2003) 22, 1817–1821 & 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00 www.nature.com/onc fau and its ubiquitin-like domain (FUBI) transforms human osteogenic sarcoma (HOS) cells to anchorage-independence Toby G Rossman1,2, Melissa A Visalli1 and Elena V Komissarova1 1The Nelson Institute of Environmental Medicine, New York University School of Medicine, 57 Old Forge Road, Tuxedo, NY 10987, USA; 2The NYU Cancer Institute, New York University School of Medicine, 57 Old Forge Road, Tuxedo, NY 10987, USA Arsenite is the most likelycarcinogenic form of arsenic in sarcoma virus (FBR-MuSV), originally isolated from a the environment. Previously, expression cloning for radiation-induced mouse osteosarcoma (Finkel et al., cDNAs whose overexpression confers arsenite-resistance 1976).The complete mouse fau cDNA sequence is in Chinese hamster V79 cells identified two genes: fau and inversely inserted as the fox sequence in FBR-MuSV. a novel gene, asr2. The fau gene encodes a ubiquitin-like The expression of the fox sequence as antisense of the protein (here called FUBI) fused to the ribosomal S30 fau gene increases the transforming capability of FBR- protein. Since the expression of the fox sequence MuSV, presumably by inactivating fau expression (antisense to fau) increased the tumorigenicityof a mouse (Michiels et al., 1993). Because of this, it has been sarcoma virus, it was proposed that fau might be a tumor suggested that the fau gene functions as a tumor suppressor gene. We intended to test its abilityto block suppressor gene. arsenite-induced transformation of human osteogenic We recently found that extremely low concentrations sarcoma (HOS) cells to anchorage-independence. Instead, of arsenite are able to transform nontumorigenic human we found that overexpressing fau itself was able to osteogenic sarcoma (HOS) cells to anchorage-indepen- transform HOS cells. When the two domains were dence (Rossman et al., 2001). These cells exhibit a flat expressed separately, only FUBI was transforming and morphology and can be transformed to anchorage- onlythe S30 domain conferred arsenite resistance. An independence by both viral and other chemical carcino- incidental finding was the transforming activityof the gens (Rhim et al., 1975; Rani and Kumar, 1992; Lin and selectable marker, hyg. FUBI belongs to the ubiquitin-like Costa, 1994; Miller et al., 1998). If fau is a tumor protein group that is capable of forming conjugates to suppressor gene, its overexpression might be expected to other proteins, although none have so far been identified. inhibit transformation of these cells by arsenite and Alternatively, FUBI may act as a substitute or inhibitor of other agents. ubiquitin, to which it is most closelyrelated, or to close Figure 1 shows the Northern analysis of the fau ubiquitin-like relatives UCRP, FAT10, and/or Nedd8. expression in HOS cells and the various transfectant Oncogene (2003) 22, 1817–1821. doi:10.1038/sj.onc.1206283 lines constructed.HOS cells and HOS cells transfected with pZeo vector alone show a similar level of fau Keywords: transformation; fau; ubiquitin-like protein; expression (lanes 1 and 2).HOS cells transfected with arsenic; hygromycin; ribosomal protein pZeo-fau, containing full-length Chinese hamster fau cDNA, show increased fau expression, as expected (lane 3).HOS cells transfected with pZeo-FUBI and pZeo- S30, which are expected to express the ubiquitin-like Previously, we identified two genes whose overexpres- domain and the S30 domain of Chinese hamster fau, sion confers resistance to the human carcinogen arsenite respectively, show expression of faster migrating bands in Chinese hamster V79 cells: the novel gene asr2 and in addition to the normal fau band (lanes 4 and 5), the fau gene (Rossman and Wang, 1999).The fau gene consistent with expression of the domains of interest. encodes a 133 amino-acid protein consisting of a 74 Overexpression of fau was previously found to confer amino-acid ubiquitin-like protein (here called FUBI) arsenite resistance to Chinese hamster V79 cells (Ross- fused to a 59 amino-acid ribosomal protein S30.S30 is man and Wang, 1999).Figure 2 shows that full-length released by post-translational cleavage of Fau and is fau expression also confers arsenite-resistance to HOS then incorporated into the small ribosomal subunit.The cells (LC50 ¼ 2.9 mm for the fau transfectant compared fau gene was identified as the cellular homologue of with 1.1 mm for HOS).A more modest increase in the fox sequence in the Finkel–Biskis–Reilly murine arsenite-resistance is seen in cells expressing only the S30 domain (LC50 ¼ 1.7 mm).In contrast, expression of only *Correspondence: TG Rossman, The Nelson Institute of Environ- the FUBI domain resulted in increased sensitivity to mental Medicine, New York University School of Medicine, 57 Old arsenite (LC ¼ 0.4 mm).Cells transfected with vector Forge Road, Tuxedo, NY 10987, USA; 50 E-mail: [email protected] alone show arsenite sensitivity identical to HOS (data Received 12 August 2002; revised 2 November 2002; accepted 29 not shown).Colony size decreases with arsenite toxicity November 2002 in all cells. Transformation by fau and FUBI TG Rossman et al 1818 Figure 1 Northern analysis of fau, S30 and FUBI expression in HOS transfectants.Lane 1: HOS cells; lane 2: HOS-pZeo (HOS transfected with pZeo vector alone); lane 3: HOS-pZeo-fau; lane 4: HOS-pZeo-FUBI; lane 5: HOS-pZeo-S30.pZeo is a modification of pCEP-VP (Rossman and Wang, 1999).The hyg gene and the HSV-1 TK promoter were cut at the Nar1 and RsrII sites.A zeocin cassette, containing the SV40 promoter, EM-7 promoter, zeocin resistance gene (zeo), and SV40 polyadenylation sequences, was PCR amplified from pcDNA4/HisMaxA (Invitrogen, San Diego, CA, USA) with Nar1/RsrII sites and cloned into pCEP-VP.The fau cDNA in pCEP-VP was digested with Nar1 and RsrII and inserted into pZeo.The FUBI domain (a 217 base pair fragment) and the S30 domain (a 205 base pair fragment) of the fau gene were separately PCR amplified using the following primers: FUBI: 50GTCGGTACCATGCAGCTCTTTGT and 30CCTACATGCGA CCAGCTACT.S30: 5 0GGTACCATGTTGGGAGGTAAAGTT and 30GAAGGACTTACGCGGCGCATTA.The PCR products were cloned into pZeo and sequenced to ensure accuracy (Seq- Wright, Houston, TX, USA).Plasmid DNA was isolated by acidic phenol extraction (Wang and Rossman, 1994) and transfected into HOS (HOS TE85, American Type Culture Collection) by the Figure 2 Sensitivity (clonal survival) to arsenite of HOS cells and calcium phosphate procedure (Sambrook et al., 1989). Transformed HOS transfectants.HOS ( J); HOS(pZeo-fau) (), HOS(pZeo- cells were selected in medium containing 100 mg/ml Zeocin (Invitro- FUBI) (&); HOS(pZeo-S30) (’).HOS cells were cultured in a- gen, CA, USA).For Northern blot, total RNA was isolated using MEM (Gibco Life Technologies) containing 10% fetal bovine TRI reagent (Molecular Research Center, Inc., Cincinnati, OH, serum (Gibco) in 5% CO2 at 371C.For clonal survival assays, cells USA).Poly A + RNA was then isolated using oligo(dT)-cellulose were seeded at a density of 500 cells/60 mm dish with arsenite columns (Molecular Research Center, Inc.). The RNA was added 18 h later.Visible colonies develop in 7 days.Colonies were electrophoresed in a 1.5% agarose gel containing 3.5% formalde- fixed with methanol and stained with 0.5% crystal violet/50% hyde, transferred onto a nylon membrane and hybridized to 32P- methanol.All assays were performed in triplicate.Error bars are labelled fau and human G3PDH (housekeeping gene) probes (High for standard error of the mean Prime kit, Roche).The mRNA was detected using Genestorm phosphoimager (Molecular Dynamics) Table 1 Transformation of HOS cells by the hygromycin-resistance gene in pCEP-VP, and by fau and its FUBI domain À5 HOS cells have a low (1.2  10 ) spontaneous Cells Transformation frequency  10À4 transformation frequency.The pCEP-VP vector, which a contains the hygromycin-resistance hyg gene as select- HOS 0.12 HOS-pCEP-VP 263.8a able marker, was found to transform HOS cells to HOS-pZeo 0a anchorage-independence (Table 1).Aminoglycoside HOS-pZeo-fau 23.6a phosphoryltransferases such as hyg have structural HOS-pZeo-FUBI 284.8b similarities to eucaryotic protein kinases, are inhibited HOS-pZeo-S30 0.12a by similar agents, and sometimes demonstrate measur- Individual clones of HOS or of the transfectants (selected in able protein kinase activity (Wright et al., 1998). In hygromycin for HOS-pCEP-VP or in zeocin for the other transfec- contrast, no transformation occurred when the hyg gene tants) were isolated, expanded, and assayed for anchorage-indepen- was replaced with zeocin-resistance as a selectable dent growth marker in pZeo.Expression of full-length fau causes aAverage of four clones b significant transformation (Table 1, Figure 3).When its Average of five clones two domains are expressed separately, it is clear that the transforming activity resides in the FUBI domain (Table 1).Four independently isolated transfectant 1998).Although fau had been assumed to act as a tumor clones expressing full-length fau and five independently suppressor gene, it appears that overexpressed fau may isolated clones expressing its FUBI domain showed itself have oncogenic activity.Transcription factor significant transforming ability, whereas none of the E2F1, which regulates cyclins A and E as well as other four independently isolated clones expressing S30 did. genes involved in cell cycle control, has also been shown In cells of the mesenchymal lineage, growth
Load more

Recommended publications
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Effects of Stressors on Differential Gene Expression And
    EFFECTS OF STRESSORS ON DIFFERENTIAL GENE EXPRESSION AND SECONDARY METABOLITES BY AXINELLA CORRUGATA by Jennifer Grima A Thesis Submitted to the Faculty of Charles E. Schmidt College of Science in Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida May 2013 ACKNOWLEDGEMENTS This thesis was made possible by the help and support of my mentors and friends. Without their guidance and expertise, I would not have been able to accomplish all that I have. Their belief and encouragement in my efforts have motivated and inspired me along through this journey and into a new era in my life. First and foremost, I am grateful to Dr. Shirley Pomponi for taking on the role as my advisor and giving me the opportunity to experience life as a researcher. Not only has she guided me in my scientific studies, she has become a wonderful, lifelong friend. Dr. Pomponi and Dr. Amy Wright have also provided financial support that enabled me to conduct the research and complete this thesis. I would also like to acknowledge Dr. Amy Wright for her willingness to tender advice on all things chemistry related as well as providing me with the space, equipment, and supplies to conduct the chemical analyses. I am grateful to Dr. Esther Guzman who not only served as a committee member, but has also been readily available to help me in any endeavor, whether it be research or personal related. She is truly one of kind with her breadth of knowledge in research and her loyal and caring character.
    [Show full text]
  • DNA·RNA Triple Helix Formation Can Function As a Cis-Acting Regulatory
    DNA·RNA triple helix formation can function as a cis-acting regulatory mechanism at the human β-globin locus Zhuo Zhoua, Keith E. Gilesa,b,c, and Gary Felsenfelda,1 aLaboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; bUniversity of Alabama at Birmingham Stem Cell Institute, University of Alabama at Birmingham, Birmingham, AL 35294; and cDepartment of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL 35294 Contributed by Gary Felsenfeld, February 4, 2019 (sent for review January 4, 2019; reviewed by James Douglas Engel and Sergei M. Mirkin) We have identified regulatory mechanisms in which an RNA tran- of the criteria necessary to establish the presence of a triplex script forms a DNA duplex·RNA triple helix with a gene or one of its structure, we first describe and characterize triplex formation at regulatory elements, suggesting potential auto-regulatory mecha- the FAU gene in human erythroid K562 cells. FAU encodes a nisms in vivo. We describe an interaction at the human β-globin protein that is a fusion containing fubi, a ubiquitin-like protein, locus, in which an RNA segment embedded in the second intron of and ribosomal protein S30. Although fubi function is unknown, the β-globin gene forms a DNA·RNA triplex with the HS2 sequence posttranslational processing produces S30, a component of the within the β-globin locus control region, a major regulator of glo- 40S ribosome. We used this system to refine methods necessary bin expression. We show in human K562 cells that the triplex is to detect triplex formation and to distinguish it from R-loop stable in vivo.
    [Show full text]
  • Genes with 5' Terminal Oligopyrimidine Tracts Preferentially Escape Global Suppression of Translation by the SARS-Cov-2 NSP1 Protein
    Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Genes with 5′ terminal oligopyrimidine tracts preferentially escape global suppression of translation by the SARS-CoV-2 Nsp1 protein Shilpa Raoa, Ian Hoskinsa, Tori Tonna, P. Daniela Garciaa, Hakan Ozadama, Elif Sarinay Cenika, Can Cenika,1 a Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712, USA 1Corresponding author: [email protected] Key words: SARS-CoV-2, Nsp1, MeTAFlow, translation, ribosome profiling, RNA-Seq, 5′ TOP, Ribo-Seq, gene expression 1 Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Viruses rely on the host translation machinery to synthesize their own proteins. Consequently, they have evolved varied mechanisms to co-opt host translation for their survival. SARS-CoV-2 relies on a non-structural protein, Nsp1, for shutting down host translation. However, it is currently unknown how viral proteins and host factors critical for viral replication can escape a global shutdown of host translation. Here, using a novel FACS-based assay called MeTAFlow, we report a dose-dependent reduction in both nascent protein synthesis and mRNA abundance in cells expressing Nsp1. We perform RNA-Seq and matched ribosome profiling experiments to identify gene-specific changes both at the mRNA expression and translation level. We discover that a functionally-coherent subset of human genes are preferentially translated in the context of Nsp1 expression. These genes include the translation machinery components, RNA binding proteins, and others important for viral pathogenicity. Importantly, we uncovered a remarkable enrichment of 5′ terminal oligo-pyrimidine (TOP) tracts among preferentially translated genes.
    [Show full text]
  • Accepted Version
    Article A catalog of genetic loci associated with kidney function from analyses of a million individuals WUTTKE, Matthias, et al. Abstract Chronic kidney disease (CKD) is responsible for a public health burden with multi-systemic complications. Through trans-ancestry meta-analysis of genome-wide association studies of estimated glomerular filtration rate (eGFR) and independent replication (n?=?1,046,070), we identified 264 associated loci (166 new). Of these, 147 were likely to be relevant for kidney function on the basis of associations with the alternative kidney function marker blood urea nitrogen (n?=?416,178). Pathway and enrichment analyses, including mouse models with renal phenotypes, support the kidney as the main target organ. A genetic risk score for lower eGFR was associated with clinically diagnosed CKD in 452,264 independent individuals. Colocalization analyses of associations with eGFR among 783,978 European-ancestry individuals and gene expression across 46 human tissues, including tubulo-interstitial and glomerular kidney compartments, identified 17 genes differentially expressed in kidney. Fine-mapping highlighted missense driver variants in 11 genes and kidney-specific regulatory variants. These results provide a comprehensive priority [...] Reference WUTTKE, Matthias, et al. A catalog of genetic loci associated with kidney function from analyses of a million individuals. Nature Genetics, 2019, vol. 51, no. 6, p. 957-972 DOI : 10.1038/s41588-019-0407-x PMID : 31152163 Available at: http://archive-ouverte.unige.ch/unige:147447 Disclaimer: layout of this document may differ from the published version. 1 / 1 HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nat Genet Manuscript Author . Author manuscript; Manuscript Author available in PMC 2019 August 19.
    [Show full text]
  • UNDERGRADUATE RESEARCH SYMPOSIUM 03.31.17 March 31St, 2017
    Sev ent h Annu a l UNDERGRADUATE RESEARCH SYMPOSIUM 03.31.17 March 31st, 2017 Live Oak Pavilion and Grand Palm Room Boca Raton Campus WELCOME Welcome to the 7th Annual Undergraduate Research Sym- posium, which showcases undergraduate students at FAU who are engaged in research, scholarship and creative ac- tivities. Students present their findings through poster or visual and oral or performing arts presentations, and rep- resent all disciplines, all colleges, and all campuses of FAU. Few activities are as rewarding intellectually as research and inquiry. In addition to the acquisition of invaluable re- search skills, students learn how knowledge is created and how that knowledge can be overturned with new evidence or new perspectives. Such scholarly activities engage stu- dents in working independently, overcoming obstacles, and learning the importance of ethics and personal conduct in the research process. The Office of Undergraduate Research and Inquiry (OURI) serves as a centralized support office of both faculty and students who are engaged in undergraduate research and inquiry. We offer and support university wide programs such as undergraduate research grants, annual undergraduate research symposia, and undergraduate research journals, to name a few. We also support all departments and all col- leges across all campuses in their undergraduate research and inquiry initiatives. The Undergraduate Research Symposium is part of our University’s Quality Enhancement Plan (QEP) efforts aimed at expanding a culture of undergraduate research
    [Show full text]
  • Lorena Novoa-Aponte
    A Strain: fl/fl ∆hep Strain: fl/fl ∆hep AnalysisAAV: ofLuc the ironLuc chaperonePCBP1-WT PCBP1PCBP1-∆Fe interactome:PCBP1-∆RNA PCBP1 variant intersection of DNA repair and iron traffickingAAV: Luc Luc WT ∆Fe ∆RNA PCBP1 −40 Lorena Novoa-Aponte a*, Sarju J. Patel a, Olga Protchenko a, James Wohlschlegel b, Caroline C. Philpott a −40 PCBP1, IHC PCBP1, GAPDH - a Genetics and Metabolism Section,a NIDDK, NIH, Bethesda, MD, USA. b Department of Biological Chemistry, UCLA, Los Angeles, CA, USA C.C. Philpott, et al. *[email protected] 80 B P = 0.0262 60 40 1. Iron is essential but toxic 2. Increased DNA damage in cells lacking PCBP1 ns H&E ? + 20 C.C. Philpott, et al. Iron is used as an essential cofactor by several enzymes involved in DNA ⦿ Increased TUNEL in cells and tissue livers from mice lacking PCBP1. ? replication and repair. However, unchaperoned iron promotes redox ⦿ PCBP1 binds both, iron and single-stranded nucleicTG, nmol/mg protein 0 acids. stress that may affect DNA stability. Strain: Δhep Δhep Δhep ? ⦿ The iron binding activity of PCBP1 controls suppressionAAV: of DNA damage C WT ∆Fe ∆RNA PCBP1 variant ? Iron storage HEK293 cells Mouse Liver ? A 8 siNT+P1var 100 ? A 8 var siPCBP1 2 ? Mammals use the iron siNT+P1 ns var Fe-S cluster assembly 6 siPCBP1+P1siPCBP1 80 ADI1 TUNEL chaperone PCBP1 to var ? 6 siPCBP1+P1 metalate several iron- 60 = 0.0468 = 0.0354 = 0.0465 cell / mm population P P P population + dependent enzymes + 4 + 4 ? 40 Degradation of HIF1α Fig. 3. Iron chaperone-mediated handling of cytosolic labile iron pool.
    [Show full text]
  • Transcriptomic and Epigenomic Characterization of the Developing Bat Wing
    ARTICLES OPEN Transcriptomic and epigenomic characterization of the developing bat wing Walter L Eckalbar1,2,9, Stephen A Schlebusch3,9, Mandy K Mason3, Zoe Gill3, Ash V Parker3, Betty M Booker1,2, Sierra Nishizaki1,2, Christiane Muswamba-Nday3, Elizabeth Terhune4,5, Kimberly A Nevonen4, Nadja Makki1,2, Tara Friedrich2,6, Julia E VanderMeer1,2, Katherine S Pollard2,6,7, Lucia Carbone4,8, Jeff D Wall2,7, Nicola Illing3 & Nadav Ahituv1,2 Bats are the only mammals capable of powered flight, but little is known about the genetic determinants that shape their wings. Here we generated a genome for Miniopterus natalensis and performed RNA-seq and ChIP-seq (H3K27ac and H3K27me3) analyses on its developing forelimb and hindlimb autopods at sequential embryonic stages to decipher the molecular events that underlie bat wing development. Over 7,000 genes and several long noncoding RNAs, including Tbx5-as1 and Hottip, were differentially expressed between forelimb and hindlimb, and across different stages. ChIP-seq analysis identified thousands of regions that are differentially modified in forelimb and hindlimb. Comparative genomics found 2,796 bat-accelerated regions within H3K27ac peaks, several of which cluster near limb-associated genes. Pathway analyses highlighted multiple ribosomal proteins and known limb patterning signaling pathways as differentially regulated and implicated increased forelimb mesenchymal condensation in differential growth. In combination, our work outlines multiple genetic components that likely contribute to bat wing formation, providing insights into this morphological innovation. The order Chiroptera, commonly known as bats, is the only group of To characterize the genetic differences that underlie divergence in mammals to have evolved the capability of flight.
    [Show full text]
  • Research Article Sex Difference of Ribosome in Stroke-Induced Peripheral Immunosuppression by Integrated Bioinformatics Analysis
    Hindawi BioMed Research International Volume 2020, Article ID 3650935, 15 pages https://doi.org/10.1155/2020/3650935 Research Article Sex Difference of Ribosome in Stroke-Induced Peripheral Immunosuppression by Integrated Bioinformatics Analysis Jian-Qin Xie ,1,2,3 Ya-Peng Lu ,1,3 Hong-Li Sun ,1,3 Li-Na Gao ,2,3 Pei-Pei Song ,2,3 Zhi-Jun Feng ,3 and Chong-Ge You 2,3 1Department of Anesthesiology, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China 2Laboratory Medicine Center, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, China 3The Second Clinical Medical College of Lanzhou University, Lanzhou, Gansu 730030, China Correspondence should be addressed to Chong-Ge You; [email protected] Received 13 April 2020; Revised 8 October 2020; Accepted 18 November 2020; Published 3 December 2020 Academic Editor: Rudolf K. Braun Copyright © 2020 Jian-Qin Xie et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ischemic stroke (IS) greatly threatens human health resulting in high mortality and substantial loss of function. Recent studies have shown that the outcome of IS has sex specific, but its mechanism is still unclear. This study is aimed at identifying the sexually dimorphic to peripheral immune response in IS progression, predicting potential prognostic biomarkers that can lead to sex- specific outcome, and revealing potential treatment targets. Gene expression dataset GSE37587, including 68 peripheral whole blood samples which were collected within 24 hours from known onset of symptom and again at 24-48 hours after onset (20 women and 14 men), was downloaded from the Gene Expression Omnibus (GEO) datasets.
    [Show full text]
  • A New Tool to Probe Protein Synthesis in Human Cells Through Capture and Identification of the Eif4e-Mrna Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.18.047571; this version posted April 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. capCLIP: a new tool to probe protein synthesis in human cells through capture and identification of the eIF4E-mRNA interactome. Kirk B. Jensen,1,2,* B. Kate Dredge,3 John Toubia,3,4 Xin Jin,1,5 Valentina Iadevaia,6 Gregory J. Goodall3,7 and Christopher G. Proud1,2 1Lifelong Health, South Australian Health & Medical Research Institute, North Terrace, Adelaide 5000, Australia 2School of Biological Sciences, Faculty of Sciences, University of Adelaide, Adelaide 5005, Australia 3Centre for Cancer Biology, SA Pathology and University of South Australia, Adelaide, SA 5000, Australia 4ACRF Cancer Genomics Facility, Centre for Cancer Biology, SA Pathology and University of South Australia, Frome Road, Adelaide SA 5000, Australia 5School of Medicine and Pharmacy, Ocean University of China, 5 Yushan Road, Qingdao, China; 6School of Biosciences and Medicine, University of Surrey, Guildford, Surrey GU2 7XH, United Kingdom. 7Adelaide Medical School, Faculty of Health and Medical Sciences, University of Adelaide, Adelaide 5005, Australia * Corresponding author: telephone +61 8 8128 4908; [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.18.047571; this version posted April 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Translation initiation of eukaryotic mRNAs commences with recognition of the m7G cap by the cap- binding protein eIF4E and the subsequent recruitment of additional translation initiation factors to the mRNA’s 5′ end.
    [Show full text]
  • Global Analysis of LARP1 Translation Targets Reveals Tunable and Dynamic Features of 5′ TOP Motifs
    Global analysis of LARP1 translation targets reveals tunable and dynamic features of 5′ TOP motifs Lucas Philippea,1, Antonia M. G. van den Elzena,1, Maegan J. Watsona, and Carson C. Thoreena,2 aDepartment of Cellular and Molecular Physiology, Yale School of Medicine, New Haven, CT 06510 Edited by Alan G. Hinnebusch, National Institutes of Health, Bethesda, MD, and approved January 29, 2020 (received for review July 25, 2019) Terminal oligopyrimidine (TOP) motifs are sequences at the 5′ ends recent findings have hinted that the RNA-binding protein La- of mRNAs that link their translation to the mTOR Complex 1 related protein 1 (LARP1) may have a central role (8–10). (mTORC1) nutrient-sensing signaling pathway. They are com- LARP1 is a large protein (150 kDa) with several RNA-binding monly regarded as discrete elements that reside on ∼100 mRNAs domains. Its central region contains a La motif (LaM) domain that mostly encode translation factors. However, the full spectrum that defines the La-related protein (LARP) superfamily, along of TOP sequences and their prevalence throughout the transcrip- with an adjacent RNA recognition motif-like (RRM-L) domain. tome remain unclear, primarily because of uncertainty over the Its C terminus encodes a domain known as the DM15 region. This mechanism that detects them. Here, we globally analyzed trans- domain is unique to LARP1 and its closely related homolog lation targets of La-related protein 1 (LARP1), an RNA-binding pro- LARP1B, and is therefore also known as the LARP1 domain (11). tein and mTORC1 effector that has been shown to repress TOP Several observations suggest that LARP1 directly represses TOP mRNA translation in a few specific cases.
    [Show full text]
  • Changes of Gene Expression in Euglena Gracilis Obtained During the 29Th DLR Parabolic Flight Campaign
    www.nature.com/scientificreports OPEN Changes of Gene Expression in Euglena gracilis Obtained During the 29th DLR Parabolic Flight Received: 9 April 2019 Accepted: 2 September 2019 Campaign Published: xx xx xxxx Julia Krüger1, Peter Richter1, Julia Stoltze1, Sebastian M. Strauch 1,2, Marcus Krüger 3, Viktor Daiker1, Binod Prasad1, Sophia Sonnewald 4, Stephen Reid4 & Michael Lebert1 Parabolic fight maneuvers of Novespace’s Airbus A310 ZERO-G produce subsequent phases of hypergravity (about 20 s), microgravity (about 22 s) and another 20 s hypergravity on experiments located in the experiment area of the aircraft. The 29th DLR parabolic fight campaign consisted of four consecutive fight days with thirty-one parabolas each day. Euglena gracilis cells were fxed with TRIzol during diferent acceleration conditions at the frst and the last parabola of each fight. Samples were collected and analyzed with microarrays for one-color gene expression analysis. The data indicate signifcant changes in gene expression in E. gracilis within short time. Hierarchical clustering shows that changes induced by the diferent accelerations yield reproducible efects at independent fight days. Transcription difered between the frst and last parabolas indicating adaptation efects in the course of the fight. Diferent gene groups were found to be afected in diferent phases of the parabolic fight, among others, genes involved in signal transduction, calcium signaling, transport mechanisms, metabolic pathways, and stress-response as well as membrane and cytoskeletal proteins. In addition, transcripts of other areas, e.g., DNA and protein modifcation, were altered. The study contributes to the understanding of short-term efects of microgravity and diferent accelerations on cells at a molecular level.
    [Show full text]