Oncogene (2003) 22, 1817–1821 & 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00 www.nature.com/onc fau and its ubiquitin-like domain (FUBI) transforms human osteogenic sarcoma (HOS) cells to anchorage-independence Toby G Rossman1,2, Melissa A Visalli1 and Elena V Komissarova1 1The Nelson Institute of Environmental Medicine, New York University School of Medicine, 57 Old Forge Road, Tuxedo, NY 10987, USA; 2The NYU Cancer Institute, New York University School of Medicine, 57 Old Forge Road, Tuxedo, NY 10987, USA Arsenite is the most likelycarcinogenic form of arsenic in sarcoma virus (FBR-MuSV), originally isolated from a the environment. Previously, expression cloning for radiation-induced mouse osteosarcoma (Finkel et al., cDNAs whose overexpression confers arsenite-resistance 1976).The complete mouse fau cDNA sequence is in Chinese hamster V79 cells identified two genes: fau and inversely inserted as the fox sequence in FBR-MuSV. a novel gene, asr2. The fau gene encodes a ubiquitin-like The expression of the fox sequence as antisense of the protein (here called FUBI) fused to the ribosomal S30 fau gene increases the transforming capability of FBR- protein. Since the expression of the fox sequence MuSV, presumably by inactivating fau expression (antisense to fau) increased the tumorigenicityof a mouse (Michiels et al., 1993). Because of this, it has been sarcoma virus, it was proposed that fau might be a tumor suggested that the fau gene functions as a tumor suppressor gene. We intended to test its abilityto block suppressor gene. arsenite-induced transformation of human osteogenic We recently found that extremely low concentrations sarcoma (HOS) cells to anchorage-independence. Instead, of arsenite are able to transform nontumorigenic human we found that overexpressing fau itself was able to osteogenic sarcoma (HOS) cells to anchorage-indepen- transform HOS cells. When the two domains were dence (Rossman et al., 2001). These cells exhibit a flat expressed separately, only FUBI was transforming and morphology and can be transformed to anchorage- onlythe S30 domain conferred arsenite resistance. An independence by both viral and other chemical carcino- incidental finding was the transforming activityof the gens (Rhim et al., 1975; Rani and Kumar, 1992; Lin and selectable marker, hyg. FUBI belongs to the ubiquitin-like Costa, 1994; Miller et al., 1998). If fau is a tumor protein group that is capable of forming conjugates to suppressor gene, its overexpression might be expected to other proteins, although none have so far been identified. inhibit transformation of these cells by arsenite and Alternatively, FUBI may act as a substitute or inhibitor of other agents. ubiquitin, to which it is most closelyrelated, or to close Figure 1 shows the Northern analysis of the fau ubiquitin-like relatives UCRP, FAT10, and/or Nedd8. expression in HOS cells and the various transfectant Oncogene (2003) 22, 1817–1821. doi:10.1038/sj.onc.1206283 lines constructed.HOS cells and HOS cells transfected with pZeo vector alone show a similar level of fau Keywords: transformation; fau; ubiquitin-like protein; expression (lanes 1 and 2).HOS cells transfected with arsenic; hygromycin; ribosomal protein pZeo-fau, containing full-length Chinese hamster fau cDNA, show increased fau expression, as expected (lane 3).HOS cells transfected with pZeo-FUBI and pZeo- S30, which are expected to express the ubiquitin-like Previously, we identified two genes whose overexpres- domain and the S30 domain of Chinese hamster fau, sion confers resistance to the human carcinogen arsenite respectively, show expression of faster migrating bands in Chinese hamster V79 cells: the novel gene asr2 and in addition to the normal fau band (lanes 4 and 5), the fau gene (Rossman and Wang, 1999).The fau gene consistent with expression of the domains of interest. encodes a 133 amino-acid protein consisting of a 74 Overexpression of fau was previously found to confer amino-acid ubiquitin-like protein (here called FUBI) arsenite resistance to Chinese hamster V79 cells (Ross- fused to a 59 amino-acid ribosomal protein S30.S30 is man and Wang, 1999).Figure 2 shows that full-length released by post-translational cleavage of Fau and is fau expression also confers arsenite-resistance to HOS then incorporated into the small ribosomal subunit.The cells (LC50 ¼ 2.9 mm for the fau transfectant compared fau gene was identified as the cellular homologue of with 1.1 mm for HOS).A more modest increase in the fox sequence in the Finkel–Biskis–Reilly murine arsenite-resistance is seen in cells expressing only the S30 domain (LC50 ¼ 1.7 mm).In contrast, expression of only *Correspondence: TG Rossman, The Nelson Institute of Environ- the FUBI domain resulted in increased sensitivity to mental Medicine, New York University School of Medicine, 57 Old arsenite (LC ¼ 0.4 mm).Cells transfected with vector Forge Road, Tuxedo, NY 10987, USA; 50 E-mail: [email protected] alone show arsenite sensitivity identical to HOS (data Received 12 August 2002; revised 2 November 2002; accepted 29 not shown).Colony size decreases with arsenite toxicity November 2002 in all cells. Transformation by fau and FUBI TG Rossman et al 1818 Figure 1 Northern analysis of fau, S30 and FUBI expression in HOS transfectants.Lane 1: HOS cells; lane 2: HOS-pZeo (HOS transfected with pZeo vector alone); lane 3: HOS-pZeo-fau; lane 4: HOS-pZeo-FUBI; lane 5: HOS-pZeo-S30.pZeo is a modification of pCEP-VP (Rossman and Wang, 1999).The hyg gene and the HSV-1 TK promoter were cut at the Nar1 and RsrII sites.A zeocin cassette, containing the SV40 promoter, EM-7 promoter, zeocin resistance gene (zeo), and SV40 polyadenylation sequences, was PCR amplified from pcDNA4/HisMaxA (Invitrogen, San Diego, CA, USA) with Nar1/RsrII sites and cloned into pCEP-VP.The fau cDNA in pCEP-VP was digested with Nar1 and RsrII and inserted into pZeo.The FUBI domain (a 217 base pair fragment) and the S30 domain (a 205 base pair fragment) of the fau gene were separately PCR amplified using the following primers: FUBI: 50GTCGGTACCATGCAGCTCTTTGT and 30CCTACATGCGA CCAGCTACT.S30: 5 0GGTACCATGTTGGGAGGTAAAGTT and 30GAAGGACTTACGCGGCGCATTA.The PCR products were cloned into pZeo and sequenced to ensure accuracy (Seq- Wright, Houston, TX, USA).Plasmid DNA was isolated by acidic phenol extraction (Wang and Rossman, 1994) and transfected into HOS (HOS TE85, American Type Culture Collection) by the Figure 2 Sensitivity (clonal survival) to arsenite of HOS cells and calcium phosphate procedure (Sambrook et al., 1989). Transformed HOS transfectants.HOS ( J); HOS(pZeo-fau) (), HOS(pZeo- cells were selected in medium containing 100 mg/ml Zeocin (Invitro- FUBI) (&); HOS(pZeo-S30) (’).HOS cells were cultured in a- gen, CA, USA).For Northern blot, total RNA was isolated using MEM (Gibco Life Technologies) containing 10% fetal bovine TRI reagent (Molecular Research Center, Inc., Cincinnati, OH, serum (Gibco) in 5% CO2 at 371C.For clonal survival assays, cells USA).Poly A + RNA was then isolated using oligo(dT)-cellulose were seeded at a density of 500 cells/60 mm dish with arsenite columns (Molecular Research Center, Inc.). The RNA was added 18 h later.Visible colonies develop in 7 days.Colonies were electrophoresed in a 1.5% agarose gel containing 3.5% formalde- fixed with methanol and stained with 0.5% crystal violet/50% hyde, transferred onto a nylon membrane and hybridized to 32P- methanol.All assays were performed in triplicate.Error bars are labelled fau and human G3PDH (housekeeping gene) probes (High for standard error of the mean Prime kit, Roche).The mRNA was detected using Genestorm phosphoimager (Molecular Dynamics) Table 1 Transformation of HOS cells by the hygromycin-resistance gene in pCEP-VP, and by fau and its FUBI domain À5 HOS cells have a low (1.2  10 ) spontaneous Cells Transformation frequency  10À4 transformation frequency.The pCEP-VP vector, which a contains the hygromycin-resistance hyg gene as select- HOS 0.12 HOS-pCEP-VP 263.8a able marker, was found to transform HOS cells to HOS-pZeo 0a anchorage-independence (Table 1).Aminoglycoside HOS-pZeo-fau 23.6a phosphoryltransferases such as hyg have structural HOS-pZeo-FUBI 284.8b similarities to eucaryotic protein kinases, are inhibited HOS-pZeo-S30 0.12a by similar agents, and sometimes demonstrate measur- Individual clones of HOS or of the transfectants (selected in able protein kinase activity (Wright et al., 1998). In hygromycin for HOS-pCEP-VP or in zeocin for the other transfec- contrast, no transformation occurred when the hyg gene tants) were isolated, expanded, and assayed for anchorage-indepen- was replaced with zeocin-resistance as a selectable dent growth marker in pZeo.Expression of full-length fau causes aAverage of four clones b significant transformation (Table 1, Figure 3).When its Average of five clones two domains are expressed separately, it is clear that the transforming activity resides in the FUBI domain (Table 1).Four independently isolated transfectant 1998).Although fau had been assumed to act as a tumor clones expressing full-length fau and five independently suppressor gene, it appears that overexpressed fau may isolated clones expressing its FUBI domain showed itself have oncogenic activity.Transcription factor significant transforming ability, whereas none of the E2F1, which regulates cyclins A and E as well as other four independently isolated clones expressing S30 did. genes involved in cell cycle control, has also been shown In cells of the mesenchymal lineage, growth