DNA Sequence; Operator; Repressor; Regulatory Region; Dyad Symmetry; Plasmid Pbr322; Sl Nuclease Mapping)

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Gene, 23 (1983) 149-156 149 Elsevier Overlapping divergent promoters control expression of TnlO tetracycline resistance (DNA sequence; operator; repressor; regulatory region; dyad symmetry; plasmid pBR322; Sl nuclease mapping) Kevin P. Bertrand *, Kathleen Posh, Lewis V. Wray Jr. ** and William S. Reznikoff ** Department of Microbiology, University of California, Irvine, CA 92717 (U.S.A.) Tel. (714) 833- 6115, and ** Depart- ment of Biochemistry, University of Wisconsin, Madison, WI 53706 (U.S.A.) Tel. (608) 262 - 3608 (Received February 7th, 1983) (Accpeted February l&h, 1983) SUMMARY We have previously examined the genetic organization and regulation of the TnZO tetracycline-resistance determinant in Escherichia coli K-12. The structural genes for retA, the TnlO tetracycline-resistance function, and for tetR, the TnlO lef repressor, are transcribed in opposite directions from promoters in a regulatory region located between the two structural genes. Expression of both t&I and t&R is induced by tetracycline. Here we report the DNA sequence of the TnlO tet regulatory region. The locations of the tetA and tetR promoters within this region were defined by Sl nuclease mapping of the 5’ ends of in vivo tet RNA. The t&4 and tetR promoters overlap; the transcription start points are separated by 36 bp. We propose that two similar regions of dyad symmetry within the TnlO tet regulatory region are operator sites at which tet repressor binds to tet DNA, thereby in~biting transcription initiation at the ietA and tetR promoters. The TnlO ret regulatory region and the pBR322 tet regulatory region show significant DNA sequence homology (53%). INTRODUCTION tance (Franklin, 1967; Robertson and Reeve, 1972). Although the mechanism of Tc resistance is The transposable element TnZO determines not completely understood, recent studies indicate high-level Tc resistance in E. coii and other enteric that active efflux of Tc is a major component of bacteria (Foster et al., 1975; Kleckner et al., 1975). the resistance mechanism (MeMurray et al., 1980; Expression of TnZO Tc resistance is regulated; Ball et al., 1980). The TnZO Tc resistance determi- exposure of resistant bacteria to subinhibitory nant (tet) directs the synthesis of two proteins, a levels of Tc induces maximal expression of resis- 36-kDal membrane protein that is essential for Tc resistance (Levy and McMurray, 1974; Levy et al., 1977, Jorgensen and Reznikoff, 1979) and a 25-kDa * Address correspondence and reprint requests to: Kevin P. Bertrand. repressor protein that, in the absence of Tc, in- Abbreviations: bp, base pairs; kDa1, kilodaltons; Tc, tetra- hibits synthesis of the 36-kDa resistance protein cycline. (Yang et al., 1976; Wray et al., 1981). The repres- 0378-l 119/83/SO3.~ @ 1983 Elsevier Science Publishers B.V. 150 sor protein also negatively regulates its own HincII site (K.P. Bertrand, L.V. Wray Jr. and W.S. synthesis (Wray et al., 1981; Beck et al., 1982). Reznikoff, in preparation); similar experiments in- The structural genes for the 36kDal and 25-kDa1 dicate that the tetR promoter and operator(s) are proteins, designated tetA and fetR, respectively, within a 451-bp Ah1 restriction fragment that have been localized within an approx. 2200-bp spans the HincII site (K.P. Postle, T. Nguyen and region of TnlO (Jorgensen and Reznikoff, 1979; K.P. Bertrand, in preparation). (v) Finally, binding Coleman and Foster, 1981); genetic analyses sug- studies with purified tetR repressor indicate that gest that tetA and tetR are transcribed from diver- the ter operator(s) are within a 287-bp AluI-HaeIII gent promoters located between the two genes restriction fragment that spans the H&c11 site (Wray et al., 1981). Here we report the DNA (Hillen et al., 1982). sequence of the region that contains the tetA and tetR promoters and the operator sites(s) at which tetR repressor acts. Several lines of evidence suggest that the tetA MATERIALS AND METHODS regulatory region and the tetR regulatory region are located in the immediate vicinity of a HincII (a) DNA sequencing restriction site at the junction of 695-bp and 1275- bp HincII restriction fragments (Fig. 1): (i) Dele- The DNA sequence of the let regulatory region tions of the region to the right of the H&II site of plasmid pRT29 (Jorgensen and Reznikoff, 1979) do not appear to alter the tetR structural gene, was determined by the procedures of Maxam and although these deletions influence the level of tetR Gilbert (1980). pRT29 contains a single Tn 10 Hpa I expression (Wray et al., 1981). (ii) Deletions of the fragment that is comprised of 695-bp and 1275-bp region to the left of the HincII site do not appear HincII fragments (Fig. 1); the plasmid has a unique to alter the t&A structural gene, although these X&I site within the tet regulatory region. Follow- deletions, likewise, influence the level of tetA ex- ing treatment by bacterial alkaline phosphatase, pression (Wray et al., 1981). (iii) The HincII site is the 5’ ends of X&I-linearized plasmid DNA were partially protected from HincII cleavage by puri- labeled with T4 polynucleotide kinase and [y- fied RNA polymerase (Jorgensen and Reznikoff, 32P IA TP. The 3’ ends of XbaI-linearized plasmid 1979) and purified tetR repressor protein (Hillen DNA were labeled with the Klenow fragment of et al., 1982). (iv) Genetic fusions of the tetA regu- E. coli DNA polymerase I and [ cr- 32P ]dATP in the latory region to the iacZ structural gene indicate presence of dCTP, dGTP, and dTTP. Following that the tefA promoter and operator(s), are within BspI digestion, the labeled fragments were isolated a 158-bp TaqI restriction fragment that spans the and subjected to sequence analysis. The sequence in the region of the XbaI site (bp 60-65, Fig. 2) was verified by analysis of the BfpI-HincIf frag- ment labeled at its HincII end (bp 87-92). TnlO (b) Sl nuclease analysis of tet RNA 1275 891 II 2790 d * E. cofi K- 12 C600 harboring the Tn 10 tet WR WA plasmid pRT29 was grown in LB broth containing Reprsssor lbswsnca 10 pg/ml tetracycline hydrochloride (Sigma). LB Fig. 1. Physical maps of the TnlO element. (Top) TnlO consists of two 1400-bp inverted repeat sequences (IS10 left and ISlO broth contained per liter: 10 g tryptone (Difco), 8 right) flanking a 6400-bp central region (Halling et al., 1982). g NaCl and 5 g yeast extract (Difco). At an Asso of (Bottom) The 2790-bp Rg/II fragment within the central region 0.35 the cells were rapidly chilled and, following of TnlO spans tbe terR repressor and tetA resistance genes; terR addition of 20 ,ccg/ml chloramphenicol (Sigma), is located within the 695-bp HincII fragment; retA is located harvested by centrifugation. The cells were lysed largely within the 1275bp HincII fragment; fetR and retA are transcribed from promoters located near the HincII site be- by addition of 300 pg/ml lysozyme (Sigma) and tween the structural genes. 1% sodium dodecyl sulfate, the lysate was ex- 151 tracted with phenol, and nucleic acids in the aque- RESULTS ous phase were precipitated with ethanol. The DNA probes for tetA and tetR RNA were pre- We determined the DNA sequence of a 201-bp pared by digestion of pRT29 DNA with XbaI + region spanning the HincII restriction site in the NcoI and HinfI, respectively. The 136-bp XbaI- tet regulatory region, including the 158-bp Z’uqI NcoI fragment and the 1130-bp HinfI fragment restriction fragment that, on the basis of genetic were eluted from 8% polyacrylamide gels, treated evidence, contains the tetA promoter and opera- with bacterial alkaline phosphatase (Bethesda Re- tor(s) (Fig. 2). The 5’ ends of tetA and tetR RNA search Laboratories) and 5’-end-labeled with [y- were localized within this region by Sl nuclease 32P]ATP (3000 Ci/mmol, Amersham). The DNA mapping (Fig. 3) (Berk and Sharp, 1977; Favaloro strands of the labeled fragments were separated in et al., 1980; Treisman and Kamen, 1981). Total an 8% polyacrylamide gel as described by Maxam unlabeled RNA was isolated from E. cofi strain and Gilbert (1980), except that the sample buffer C600 containing plasmid pRT29, then annealed to consisted of 10 mM HEPES, pH 8, 0.5% xylene single-stranded 5’-end-labeled DNA nrobes that cyanol, and 0.5% bromphenol blue in 98% de- span the tet regulatory region. The RNA-DNA ionized formamide. The separated strands were hybrids were treated with Sl nuclease, and the identified by DNA sequencing. Annealing of un- DNA components of the Sl-resistant hybrids were labeled RNA to 5’-end-labeled single-stranded sized on polyacrylamide gels (Fig. 3). The slight DNA and Sl nuclease treatment were performed heterogeneity (2-3 bases) in the lengths of the as described by Favaloro et al. (1980) and Treis- Sl-resistant DNAs may reflect actual heterogene- man and Kamen (198 1). In particular, the hybridi- ity in the 5’ ends of the tet RNAs. However, it zations were at 30°C for 16 h, and the hybrids seems more likely that this heterogeneity is prim- were treated with 600 units/ml Sl nuclease (Sigma) arily an artifact of the Sl nuclease procedure, since at 15’C for 1 h. The Sl nuclease-resistant DNA the relative amounts of the Sl-resistant fragments and sequence reactions of appropriate 5’-end- vary with the concentration of Sl nuclease em- labeled fragments were run in parallel on thin 8% ployed. Assuming that the 5’ ends of the RNAs polyacrylamide/urea gels (Maxam and Gilbert, detected by the Sl nuclease procedure do define 1980). transcription initiation sites, the principal right- _GlL __H_i_n_f-l - 20 _A-l-u-l -! ! !c! 40 60- --ma 1 TCGATTCCGACCTCATTAAGCAGCTCTAATGCGCTGTTAATCACTTTACTTTTATCTAATCTAGACATCATT AGCTAAGGCTGGAGTAATTCGTCGAGATTACGCGACGCGACAATTAGTGAAATGAAAATAGATTAGATCTGTAGTAA I le Gly Val Glu Asn Lcu Lw Glu Lar Ala Ser Asn I le Val Lys Ser Lys Asg Lar Aq Ser Met -35 -10 RBS tat A &I _l_H-i_n_c-I-1- ’ 100 -1120 1 AATTCCTAATTTTTGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCCCTATCA~TGATAGAGAAAA TTAAGGATTAAAAACAACTGTGAGATAGTAACTATCTCAATAAAATGGTG~G~C~T~TTT 1 1 I 1 -- tet R RBS -10 -35 160 18) m kt kn Ser Ser Thr Lys l ie Ala Lar Vai I le Tt !r Leu Lar kp Ala t4zt GTGAAATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGG CACTTTACTTATCAAT~~TGTTTC_~_C-G-T-A ACCATTAA-T_G-C-A ATGAGCTACGGTACC -_- ____-_- Tad Nm l Fig.
Recommended publications
  • A Region of Phage Lambda Required for Antitermination of Transcription

    A Region of Phage Lambda Required for Antitermination of Transcription

    Cell, Vol. 31, 61-70, November 1982, Copyright 0 1982 by MIT Analysis of nutR; A Region of Phage Lambda Required for Antitermination of Transcription Eric R. Olson, Eric L. Flamm* and 1971; Friedman and Baron, 1974; Keppel et al., David I. Friedman 1974; Friedman et al., 1976, 1981; Greenblatt et al., Department of Microbiology and Immunology 1980). The sites include putative sites of pN action, The University of Michigan Medical School called nut (Salstrom and Szybalski, 1978; Rosenberg Ann Arbor, Michigan 48109 et al., 1978), as well as termination signals (Roberts, 1969; Rosenberg et al., 1978; Rosenberg and Court, 1979). Summary Consideration of the nature of the various factors involved in pN action formed the basis for the following The N gene product of coliphage lambda acts with model of pN action (discussed by Friedman and host factors (Nus) through sites (not) to render Gottesman, 1982). Transcription initiating at the early subsequent downstream transcription resistant to promoters PR and P, extends through the n&R and a variety of termination signals. These sites, not!? nutl sites, respectively (Figure 1). At these sites RNA and nutL, are downstream, respectively, from the polymerase is modified, rendering continuing tran- early promoters PR and PL. Thus a complicated set scription resistant to termination signals. The nature of molecular interactions are likely to occur at the of the promoter appears to play no role in pN action, nut sites. We have selected mutations in the nutR since placement of the n&R region downstream from region that reduce the effectiveness of pN in alter- the bacterial gal operon promoter results in termina- ing transcription initiating at the PR promoter.
  • A Framework for Automated Enrichment of Functionally Significant Inverted Repeats in Whole Genomes

    A Framework for Automated Enrichment of Functionally Significant Inverted Repeats in Whole Genomes

    Missouri University of Science and Technology Scholars' Mine Computer Science Faculty Research & Creative Works Computer Science 01 Feb 2010 A Framework for Automated Enrichment of Functionally Significant Inverted Repeats in Whole Genomes Cyriac Kandoth Fikret Ercaļ Missouri University of Science and Technology, [email protected] Ronald L. Frank Missouri University of Science and Technology, [email protected] Follow this and additional works at: https://scholarsmine.mst.edu/comsci_facwork Part of the Biology Commons, and the Computer Sciences Commons Recommended Citation C. Kandoth et al., "A Framework for Automated Enrichment of Functionally Significant Inverted Repeats in Whole Genomes," BMC Bioinformatics, vol. 11, no. SUPPL. 6, BioMed Central Ltd., Feb 2010. The definitive version is available at https://doi.org/10.1186/1471-2105-11-S6-S20 This Article - Conference proceedings is brought to you for free and open access by Scholars' Mine. It has been accepted for inclusion in Computer Science Faculty Research & Creative Works by an authorized administrator of Scholars' Mine. This work is protected by U. S. Copyright Law. Unauthorized use including reproduction for redistribution requires the permission of the copyright holder. For more information, please contact [email protected]. Kandoth et al. BMC Bioinformatics 2010, 11(Suppl 6):S20 http://www.biomedcentral.com/1471-2105/11/S6/S20 PROCEEDINGS Open Access A framework for automated enrichment of functionally significant inverted repeats in whole genomes Cyriac Kandoth1*, Fikret Ercal1†, Ronald L Frank2† From Seventh Annual MCBIOS Conference. Bioinformatics: Systems, Biology, Informatics and Computation Jonesboro, AR, USA. 19-20 February 2010 Abstract Background: RNA transcripts from genomic sequences showing dyad symmetry typically adopt hairpin-like, cloverleaf, or similar structures that act as recognition sites for proteins.
  • The Regulatory Region of the Divergent Argecbh Operon in Escherichia Coli K-12

    The Regulatory Region of the Divergent Argecbh Operon in Escherichia Coli K-12

    Volume 10 Number 24 1982 Nucleic Acids Research The regulatory region of the divergent argECBH operon in Escherichia coli K-12 Jacques Piette*, Raymond Cunin*, Anne Boyen*, Daniel Charlier*, Marjolaine Crabeel*, Franpoise Van Vliet*, Nicolas Glansdorff*, Craig Squires+ and Catherine L.Squires + *Nficrobiology, Vrije Universiteit Brussel, and Research Institute of the CERIA, 1, Ave. E. Giyson, B-1070 Brussels, Belgium, and +Department of Biological Sciences, Columbia University, New York, NY 10027, USA Received 24 September 1982; Revised and Accepted 24 November 1982 ABSTRACT The nucleotide sequence of the control region of the divergent argECBH operon has been established in the wild type and in mutants affecting expression of these genes. The argE and argCBH promoters face each other and overlap with an operator region containing two domains which may act as distinct repressor binding sites. A long leader sequence - not involved in attenuation - precedes argCBH. Overlapping of the argCBH promoter and the region involved in ribosome mobilization for argE translation explains the dual effect of some mutations. Mutations causing semi-constitutive expression of argE improve putative promoter sequences within argC. Implications of these results regarding control mechanisms in amino acid biosynthesis and their evolution are discussed. INTRODUCTION Divergently transcribed groups of functionally related genes are not exceptional in Escherichia coli (1-10). In only a few instances, however, are the sites responsible for the expression and the regulation of the flanking genes organized in an inte- grated fashion such that the gene cluster constitutes a bipolar operon, with an internal operator region flanked by promoters facing each other. The argECBH cluster (Fig.1) is one of the earliest reported examples of such a pattern.
  • A History of CRISPR-CAS

    A History of CRISPR-CAS

    JB Accepted Manuscript Posted Online 22 January 2018 J. Bacteriol. doi:10.1128/JB.00580-17 Copyright © 2018 American Society for Microbiology. All Rights Reserved. 1 2 3 History of CRISPR-Cas from encounter with a mysterious Downloaded from 4 repeated sequence to genome editing technology 5 6 Yoshizumi Ishino,1, 2,* Mart Krupovic,1 Patrick Forterre1, 3 7 http://jb.asm.org/ 8 1Unité de Biologie Moléculaire du Gène chez les Extrêmophiles, Département de 9 Microbiologie, Institut Pasteur, F-75015, Paris, France, 2Department of 10 Bioscience and Biotechnology, Faculty of Agriculture, Kyushu University, on March 9, 2018 by UNIV OF COLORADO 11 Fukuoka 812-8581, Japan. 3Institute of Integrative Cellular Biology, Université 12 Paris Sud, 91405 Orsay, Cedex France 13 14 15 Running title: Discovery and development of CRISPR-Cas research 16 17 * Correspondence to 18 Prof. Yoshizumi Ishino 19 Department of Bioscience and Biotechnology, 20 Faculty of Agriculture, Kyushu University, 21 Fukuoka 812-8581, Japan 22 [email protected] 1 23 ABSTRACT 24 CRISPR-Cas systems are well known acquired immunity systems that are 25 widespread in Archaea and Bacteria. The RNA-guided nucleases from Downloaded from 26 CRISPR-Cas systems are currently regarded as the most reliable tools for 27 genome editing and engineering. The first hint of their existence came in 1987, 28 when an unusual repetitive DNA sequence, which subsequently defined as a 29 cluster of regularly interspersed short palindromic repeats (CRISPR), was http://jb.asm.org/ 30 discovered in the Escherichia coli genome during the analysis of genes involved 31 in phosphate metabolism.
  • FARE, a New Family of Foldback Transposons in Arabidopsis

    FARE, a New Family of Foldback Transposons in Arabidopsis

    Copyright 2000 by the Genetics Society of America FARE, a New Family of Foldback Transposons in Arabidopsis Aaron J. Windsor and Candace S. Waddell Department of Biology, McGill University, Montreal, Quebec H3A 1B1, Canada Manuscript received June 23, 2000 Accepted for publication August 16, 2000 ABSTRACT A new family of transposons, FARE, has been identi®ed in Arabidopsis. The structure of these elements is typical of foldback transposons, a distinct subset of mobile DNA elements found in both plants and animals. The ends of FARE elements are long, conserved inverted repeat sequences typically 550 bp in length. These inverted repeats are modular in organization and are predicted to confer extensive secondary structure to the elements. FARE elements are present in high copy number, are heterogeneous in size, and can be divided into two subgroups. FARE1's average 1.1 kb in length and are composed entirely of the long inverted repeats. FARE2's are larger, up to 16.7 kb in length, and contain a large internal region in addition to the inverted repeat ends. The internal region is predicted to encode three proteins, one of which bears homology to a known transposase. FARE1.1 was isolated as an insertion polymorphism between the ecotypes Columbia and Nossen. This, coupled with the presence of 9-bp target-site duplications, strongly suggests that FARE elements have transposed recently. The termini of FARE elements and other foldback transposons are imperfect palindromic sequences, a unique organization that further distinguishes these elements from other mobile DNAs. RANSPOSABLE elements (TEs) are ubiquitous IVR ends and contain no protein coding sequences.
  • PG 4Th Semester

    PG 4Th Semester

    Paper No. : 04 Genetic engineering and recombinant DNA technology Module : 01 History of Genetic Material Principal Investigator: Dr Vibha Dhawan, Distinguished Fellow and Sr. Director The Energy and Resouurces Institute (TERI), New Delhi Co-Principal Investigator: Prof S K Jain, Professor, of Medical Biochemistry Jamia Hamdard University, New Delhi Paper Coordinator: Dr Mohan Chandra Joshi, Assistant Professor, Jamia Millia Islamia, New Delhi Content Writer: Dr Rohini Muthuswami, Associate Professor, Jawaharlal Nehru University Content Reviwer: Dr Mohan Chandra Joshi, Assistant Professor, Jamia Millia Islamia, New Delhi Genetic Engineering and Recombinant DNA Technology Biotechnology History of Genetic Material Description of Module Subject Name Biotechnology Paper Name Genetic Engineering and Recombinant DNA Technology Module Name/Title History of Genetic Material Module Id 01 Pre-requisites Objectives To understand how DNA was identified as genetic material Keywords DNA Genetic Engineering and Recombinant DNA Technology Biotechnology History of Genetic Material 1. Nature of the genetic material. In this module we will learn about how scientists discovered the identity of the genetic material. The foundation of modern biology was laid by scientists in mid-19th century. The principles of genetics were discovered by Gregor Mendel in 1865-66. The nuclein or what we term as nucleic acid was discovered and identified in 1869. The final identity of the genetic material was firmly established in 1952, two years after the structure of DNA was elucidated. We are going to follow this fascinating journey and I hope at the end of this module you learn to appreciate how scientists using the simple tools and techniques available to them established the identity of the genetic material.
  • DNA.Bending by Negative Regulatory Proteins: Gal and Lac Repressors

    DNA.Bending by Negative Regulatory Proteins: Gal and Lac Repressors

    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press DNA.bending by negative regulatory proteins: Gal and Lac repressors Christian Zwieb, Jin Kim, and Sankar Adhya 1 Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 USA The ability of two negative regulatory proteins, Gal and Lac repressors, to induce DNA bending was tested by the respective cloning of ga/and lac operator DNA sequences into a sensitive vector, pBend2, pBend2 can generate a large number of DNA fragments in each of which a cloned operator is present in circularly permuted positions along the length of the DNA. Gel electrophoresis of these DNA fragments individually complexed to a repressor shows that the Gal repressor bends both of the ga/operators, O, and O~. Similarly, the Lac repressor induces a bend to a lac operator DNA. In each case, the center of the average bent segment is located at or close to the dyad symmetry axis of the operator sequence. In view of these findings, we discuss how these negative regulatory proteins may function by a more dynamic mechanism than was perceived previously. [Key Words: DNA bending; Gal and Lac repressors; gal and lac operators] Received January 13, 1989; revised version accepted March 6, 1989. It is becoming increasingly clear that biological macro- Parker 1986; Dripps and Wartell 1987; Mizuno 1987; molecular reactions involve the formation of specific Plaskon and Wartell 1987). It was suggested by Crothers DNA-multiprotein complexes. For many of these reac- and Fried (1983)that such contortions may be essential tions, such as replication or recombination, the com- for the formation and activity of the DNA-protein tran- plexes assume a higher-order structure (Echols 1986}.
  • A Protein Involved in Minichromosome Maintenance in Yeast Binds a Transcriptional Enhancer Conserved in Eukaryotes

    A Protein Involved in Minichromosome Maintenance in Yeast Binds a Transcriptional Enhancer Conserved in Eukaryotes

    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press A protein involved in minichromosome maintenance in yeast binds a transcriptional enhancer conserved in eukaryotes Steven Passmore, Randolph Elble, and Bik-Kwoon Tye Section of Biochemistry, Molecular and Cell Biology, Comell University, Ithaca, New York 14853 USA The Saccharomyces cerevisiae MCM1 gene product is a protein with multiple functions. It is a transcription factor necessary for expression of mating-type-specific genes and is also required for the maintenance of minichromosomes. MCM1 shows DNA-binding specificities similar to those of two previously reported DNA- binding factors, pheromone/receptor transcription factor (PRTF) and general regulator of mating type (GRM)~ like PRTF, its activity can be modulated by the al protein. MCM1 binds to the dyad symmetry element 5'- CCTAATTAGG and related sequences, which we refer to as MCM1 _control _elements (MCEs). MCEs are found within the regulatory regions of a- and ,,-specific genes. Direct and indirect DNA binding assays suggest that a conserved 5'-ATTAGG in one-half of the dyad symmetry element is important for MCM1 binding whereas variants in the other half are tolerated. We have used a novel DNase I 'nicking interference' assay to investigate the interaction of MCM1 with its substrate. These data suggest that MCM1 binds as a dimer, interacting symmetrically with the ATTAGG residues in each half of the binding site. MCM1 contains striking homology to the DNA-binding domain of the human serum response factor (SRF) which mediates the transient transcriptional activation of growth-stimulated genes by binding to the serum response element (SRE).
  • Analysis of the DNA-Binding and Activation Properties of the Human Transcription Factor AP-2

    Analysis of the DNA-Binding and Activation Properties of the Human Transcription Factor AP-2

    Downloaded from genesdev.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Analysis of the DNA-binding and activation properties of the human transcription factor AP-2 Trevor Williams ~ and Robert Tjian Howard Hughes Medical Institute, Department of Molecular and Cell Biology, University of California at Berkeley, Berkeley, California 94720 USA The mammalian transcription factor AP-2 is a sequence-specific DNA-binding protein expressed in neural crest lineages and regulated by retinoic acid. Here we report a structure/function analysis of the DNA-binding and transcription activation properties of the AP-2 protein. DNA contact studies indicate that AP-2 binds as a dimer to a palindromic recognition sequence. Furthermore, cross-linking and immunoprecipitation data illustrate that AP-2 exists as a dimer even in the absence of DNA. Examination of cDNA mutants reveals that the sequences responsible for DNA binding are located in the carboxy-terminal half of the protein. In addition, a domain mediating dimerization forms an integral component of this DNA-binding structure. Expression of AP-2 in mammalian cells demonstrates that transcriptional activation requires an additional amino-terminal domain that contains an unusually high concentration of proline residues. This proline-rich activation domain also functions when attached to the heterologous DNA-binding region of the GAL4 protein. This study reveals that although AP-2 shares an underlying modular organization with other transcription factors, the regions of AP-2 involved in transcriptional activation and DNA binding/dimerization have novel sequence characteristics. [Key Words: Enhancer factor~ DNA binding~ dimerization; mammalian expression~ proline-rich activator~ palindromic binding site] Received November 15, 19901 revised version accepted January 22, 1991.
  • Escherichia Coli Σ38 Promoters Use Two up Elements Instead of a −35 Element: Resolution of a Paradox and Discovery That Σ38 Transcribes Ribosomal Promoters

    Escherichia Coli Σ38 Promoters Use Two up Elements Instead of a −35 Element: Resolution of a Paradox and Discovery That Σ38 Transcribes Ribosomal Promoters

    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.05.936344; this version posted February 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. Escherichia coli σ38 promoters use two UP elements instead of a −35 element: resolution of a paradox and discovery that σ38 transcribes ribosomal promoters Kevin S. Franco†,1, Zhe Sun†,1, Yixiong Chen1, Cedric Cagliero2, Yuhong Zuo3, Yan Ning Zhou1, Mikhail Kashlev1, Ding Jun Jin1 and Thomas D. Schneider 1,∗ version = 3.15 of sigma38.tex 2020 Jan 08 1National Institutes of Health, National Cancer Institute, Center for Cancer Research, RNA Biology Laboratory, P. O. Box B, Frederick, MD 21702-1201. (301) 846-5581; [email protected]; https://alum.mit.edu/www/toms/. 2 National Institutes of Health, National Cancer Institute, Center for Cancer Research, Gene Regulation and Chromosome Bi- ology Laboratory, P. O. Box B, Frederick, MD 21702-1201. Jecho Laboratories, Inc. 7320A Executive way, Frederick, MD 21704. 3Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06520, USA. † These authors contributed equally to this work. ∗Corresponding author. 1 Abstract In E. coli, one RNA polymerase (RNAP) transcribes all RNA species, and different regu- lons are transcribed by employing different sigma (σ) factors. RNAP containing σ38 (σS ) activates genes responding to stress conditions such as stationary phase. The structure of σ38 promoters has been controversial for more than two decades.
  • III = Chpt. 17. Transcriptional Regulation in Bacteriophage Lambda

    III = Chpt. 17. Transcriptional Regulation in Bacteriophage Lambda

    B M B 400 Part Four - III = Chpt. 17. Transcriptional regulation in bacteriophage lambda B M B 400 Part Four: Gene Regulation Section III = Chapter 17 TRANSCRIPTIONAL REGULATION IN BACTERIOPHAGE LAMBDA Not all bacteriophage lyse their host bacteria upon infection. Temperate phage reside in the host genome and do not kill the host, whereas lytic phage cause lysis of their hosts when they infect bacteria. The bacteriophage λ can choose between these two “lifestyles.” The molecular basis for this decision is one of the best understood genetic switches that has been studied, and it provides a fundamental paradigm for such molecular switches in developmental biology. This chapter reviews some of the historical observations on lysogeny in bacteriophage λ, covers the major events in lysis and lysogeny, and discusses the principal regulatory proteins and their competition for overlapping cis-regulatory sites. We will examine one of the common DNA binding domains in regulatory proteins – the helix-turn-helix, which was first identified in the λ Cro protein. Also, the use of hybrid genes to dissect complex regulatory schemes was pioneered in studies of bacteriophage λ, and that approach will be discussed in this chapter. A. Lysis versus lysogeny 1. Lytic pathway: a. Leads to many progeny virus particles and lysis of the infected cell. b. Have extensive replication of λ DNA, formation of the viral coat (head and tail proteins) with packaging of the λ DNA into phage particles, cell lysis, and release of many progeny phage. 2. Lysogenic pathway: a. The infecting phage DNA integrates into the host genome and is carried passively by the host.
  • Identification of Repressor Binding Sites Controlling Expression of Tetracycline Resistance Encoded by Tnjo LEWIS V

    Identification of Repressor Binding Sites Controlling Expression of Tetracycline Resistance Encoded by Tnjo LEWIS V

    JOURNAL OF BACTERIOLOGY, Dec. 1983, p. 1188-1191 Vol. 156, No. 3 0021-9193/83/121188-04$02.00/0 Copyright © 1983, American Society for Microbiology Identification of Repressor Binding Sites Controlling Expression of Tetracycline Resistance Encoded by TnJO LEWIS V. WRAY, JR.,t AND WILLIAM S. REZNIKOFF* Department ofBiochemistry, College ofAgricultural and Life Sciences, University of Wisconsin-Madison, Madison, Wisconsin 53706 Received 23 May 1983/Accepted 7 September 1983 The regulatory region controlling the expression of tetracycline resistance and repressor genes contains two nearly identical regions of dyad symmetry. Dele- tions of this control region were isolated by digestion with S1 nuclease. The ability of these deletions to bind the tet repressor was determined by an in vivo repressor titration assay. The results indicate that repressor specifically binds both regions of dyad symmetry. The tetracycline resistance determinant asso- MATERIALS AND METHODS ciated with the plasmid R100 is part of a trans- Materials. Growth media were prepared as de- posable genetic element called transposon TnJO scribed by Miller (24). Concentrations of antibiotics (16). Resistance does not result from the inacti- (Sigma Chemical Co.) used were 60 jig of kanamycin vation of the antibiotic (17). Instead, the resist- per ml and 100 ,g of ampicillin per ml. ance mechanism appears to involve the active Restriction enzymes were purchased from Bethesda efflux of tetracycline from the cell (1, 21). In Research Laboratories or New England Biolabs and addition, decreased ribosomal sensitivity to tet- were used as described by the manufacturer. S1 nucle- racycline may contribute to resistance ase and T4 polynucleotide kinase were obtained from (17, 28).