DOCSLIB.ORG

Translation Initiation of Bacteriophage Lambda Gene Cli Requires Integration Host Factor JAMAL MAHAJNA,1 AMOS B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Translation Initiation of Bacteriophage Lambda Gene Cli Requires Integration Host Factor JAMAL MAHAJNA,1 AMOS B JOURNAL OF BACTERIOLOGY, Jan. 1986, p. 167-174 Vol. 165, No. 1 0021-9193/86//010167-08$02.00/0 Copyright © 1986, American Society for Microbiology Translation Initiation of Bacteriophage Lambda Gene clI Requires Integration Host Factor JAMAL MAHAJNA,1 AMOS B. OPPENHEIM,1 ALISON RATTRAY,2t AND MAX GOTTESMAN2t* Department of Molecular Genetics, The Hebrew University-Hadassah Medical School, Jerusalem, Israel,' and Laboratory ofMolecular Biology, National Cancer Institute, Bethesda, Maryland 208922 Received 20 June 1985/Accepted 2 October 1985 Escherichia coli integration host factor (IHF), a DNA-binding protein, positively regulates expression of the A, clI gene. Purified IHF stimulates cII protein synthesis in vitro, suggesting a direct role for host factor in cII expression. Further evidence for a direct role for IHF was obtained with operon and gene fusions between clI and lacZ or cII and galE. Analysis of these fusions ir vivo demonstrated that IHF is essential for the initiation of cIT translation. Replacement of the entire clI coding sequence with lacZ yielded a gene fusion which was still IHF dependent. However, a cIT-galE fusion carrying a hybrid ribosome binding region expressed galE in IHF mutants. These results indicate that sequences which make cll translation IHF dependent lie between the ribosome binding region and the initiating codon of cII. Failure to translate clI activates a transcription terminator located within cIT and results in polar effects on downstream transcription. This polarity is suppressed by the A N antitermination function. When cloned into another contest, the terminator is active in both wild-type and IHF mutant strains. The amino terminus of clI is located near an IHF binding site in a region with considerable dyad symmetry. The role of IHF in cII translation may be to prevent formation of an RNA-RNA duplex that sequesters the ribosome binding site of cII. The binding of IHF might influence RNA structure by altering the rate of the dissociation of RNA from the DNA template. Integration host factor (IHF) of Escherichia coli is a MATERIALS AND METHODS heterodimeric protein composed of two small basic polypeptides, the products of the himA and hip genes (8, 15, Bacterial strains. E. coli strains were derivatives of E. coli 18, 19). It is directly required for the integration and excision Xl from the National Institutes of Health collection (21). of bacteriophage lambda from the bacterial chromosome Strains A2004 and A2062 are derivatives of strain Xl that (29). IHF promotes X site-specific recombination by binding carry the defective prophage A c1857 Nam7 53ABAMAHI and K DNA at three sites near the phage attachment site (5). K c1857 N+ ABAMAHI, respectively (12; numbered N4830 E. coli IHF- mutants also display defects in the regulation and N4831, respectively). The hip-157 and himA83 mutations of certain bacterial and phage genes (9, 11). The cII gene of were introduced by P1 cotransduction with a TnJO K is not expressed in the absence of IHF (14, 21). An IHF tetracycline resistance marker. Initial plasmid transforma- binding site is located immediately upstream of cII (5), tions were performed in strain A2097, a C600 derivative, suggesting a direct role for the factor in cIT expression (Fig. carrying the K cI857 ABAMAHI prophage and the lacZ XA21 1). Consistent with this idea is the demonstration that cII deletion. synthesis in a coupled transcription-translation system is Plasmids. Plasmids containing lacZ operon and gene fu- IHF dependent (this work and reference 23). sions were constructed with pMLB1010 and pMLB1034, Surprisingly, the role of IHF in cIT expression in vivo respectively; these are lacY- derivatives of Casadaban appears to be posttranscriptional; in a cII-galK operon strains (4; M. Berman, personal communication). Plasmid fusion, IHF is required for cIT but not for galactokinase pJM1016 (Table 1) was constructed by inserting a BglII BglII synthesis (14). In this manuscript we present evidence, DT9A fragment of pKC30cII (26) into pMLB1010. Note that based on the analyses of operon and gene fusions, that pKC30cII carries the cy3048 mutation, an A-to-G change (A confirms and extends that of Hoyt et al. (14). Our data coordinate 38350) between the Shine-Delgarno and ATG suggest that IHF is directly required for the initiation of clI sequences of cIT. The resulting plasmid carries OL PL nutL translation. N' nutR tRl cIT O' trpA lacZ. X' indicates that only the Failure to translate cII can lead to secondary polar effects amino-terminal portion of the gene is present. This synthetic on the transcription of downstream genes. This polarity operon expresses the cII, trpA, and lacZ proteins. Plasmids results from premature transcription termination at a site pJM1028 and pJM1039 were constructed as follows: Plasmid near the carboxy terminus of cIT. pJL6 (16) was cleaved with HindII, and the four-base recess We propose a model in which IHF binding near the was filled by Klenow large-fragment DNA polymerase. The beginning of cII prevents the formation of RNA duplex plasmid was then cleaved with PstI and ligated to pMLB1034 structures that occlude the ribosome binding site of the clI that had been previously digested with PstI and EcoRI, and transcript. treated with Klenow DNA polymerase as above. The result- ing plasmid, pJM1039, carries OL PL nutL N' nutR tRl clI' 'lacZ and produces a cII'-'lacZ fusion protein. A BamHI site at the and a PstI * Corresponding author. restriction located cII'-'lacZ junction t Present address: Department of Microbiology and Immunology, site in bla were used to replace the gene fusion with the SC-42, University of Washington, Seattle, WA 98195. trpA-lacZ operon fusion from pMLB1010, creating t Present address: Columbia University, Institute of Cancer Re- pJM1028. search, New York, NY 10032. Construction of pJM1019 was performed as follows: a 167 168 MAHAJNA ET AL. J. BACTERIOL. vwt4J'v pE N .QNVVA^pL cl 4AvVVopM cro nutR tRl cil 0 It O., pR%^^Ab. 0-11 .-Il 1.11, .-Il .--l 0-11 .01, a-1 .-a, .0-~ -- -..- .00 -t 2 t3 aollO-, i - I - N of TGGTGTATGCATTTATTTGCATACATTCAATCAATTGTTATCTAAGGAAATACTTACATATGGTTCGTGCAAACAAACGCAACGA ACCACATACGTAAATAAACGTATGTAAGTTAGTTAACAATAGATTCCTTTATGAATGTATACCAAGCACGTTTGTTTGCGTTGCT IHF binding region pE FIG. 1. Genetic map of the early gene region of phage A and the sequence around the clI initiation codon. The top line denotes the location of the early promoters PL and PR, which are negatively regulated by the cI repressor. The clI protein activates PE to initiate transcription of the cI repressor. Once repression is established, the cI repressor activates its own synthesis from PM (for a recent review, see reference 13). The lower portion of Fig. 1 shows the DNA sequence around the cII ribosome binding site. Sequence complementary to the 3' end of 16S RNA is shown in bold letters; the cII ATG initiation codon (at A coordinate bp 38360) is underlined, as is the IHF binding sequence (5). Dyad symmetries are marked by convergent arrows. Possible transcription termination sites for the PR transcript are indicated. All plasmids carrying the cy region described below contain the cy3048 mutation, an A-to-G change 10 bp upstream of the initiator ATG of cII. 189-base-pair (bp) Sau3a fragment (A coordinates 38475 to RI-HincIl fragment indicates unambiguously the orientation 38664) carrying the carboxy terminus of cII was isolated of the clI Sau3a fragment. from pAO41 (22) and inserted into pSC1. Plasmid pSC1 was Media and epzymes. Bacteria were grown in M56 medium constructed by the insertion of a HaeIII fragment carrying ?t supplemented with glycerol (0.5%), yeast extract (0.05%), PL? also isolated from pAO41, into a filled-in EcoRI site of amino acids (20-,g/ml; omitting methionine and cysteine), pMLB1010, upstream of the trpA-lacZ fusion. This X PL thiamine (0.005%), biotin (0.005%), and ampicillin (20 fragment carries OL PL and nutL, but does not include the ,g/ml). Enzymes were obtained from New England Biolabs translation initiation signal of gene N. The orientation of the and Bethesda Research Laboratories. Extracts for in vitro PL insert was determined by sequencing from a BglII site. translation were purchased from the Codon Co., Houston, The orientation of the Sau3a fragment present in pJM1019 Tex. was determined by restriction analysis. Plasmid pJM1019 Enzyme assays. P-Galactosidase assays were as described was cleaved with EcoRI and HincII, and the EcoRI sites by Miller (20). UDP-galactose 4-epimerase (galE) assays (which flank the PL fragment) were labeled with [a-32P]dATP were as described by Wilson and Hogness (30); galacto- using the Klenow fragment of DNA polymerase. The radio- kinase (galK) assays were as described by Adhya et al. (2). active DNA was then analyzed by electrophoresis on a 10% Analysis of protein synthesis. Strains carrying the various polyacrylamide gel and subjected to autoradiography. The plasmids were grown in supplemented minimal medium at HincII site is located asymmetrically within the fragment, 30°C to an optical density at 650 nm of 0.3. Induction was toward the amino terminus of cII. Thus, the size of the performed by transferring the culture to 42°C. At various time intervals, 200-,Il samples were labeled with 5 ,uCi of [35S]methionine (New England Nuclear Corp.) for 1 min, and incorporation was terminated by freezing in a liquid nitrogen TABLE 1. Summary of plasmid fusions' bath. The samples were then treated with 10% (wt/vol) Plasmid Genetic elements Fusion trichloroacetic acid for 15 min at 0°C. The precipitated pJM1016 PL nutL N' nutR tRl clI O' trpA lacZ Operon proteins were collected by a 10-min centrifugation in a pJM1028 PL nutL N' nutR tRl clI' trpA lacZ Operon microfuge, suspended in sample buffer, boiled for 3 min, pJM1039 PL nutL N' nutR tRI clI' 'lacZ Gene subjected to electrophoresis on a 10 to 26% sodium dodecyl pJM1019 PL nutL clI' trpA lacZ Operon sulfate-polyacrylamide gradient gel, and autoradiographed pJM1021 PL nutL N' trpA lacZ Operon as described by Shimatake and Rosenberg (26).
Load more

Recommended publications
  • A Region of Phage Lambda Required for Antitermination of Transcription
    Cell, Vol. 31, 61-70, November 1982, Copyright 0 1982 by MIT Analysis of nutR; A Region of Phage Lambda Required for Antitermination of Transcription Eric R. Olson, Eric L. Flamm* and 1971; Friedman and Baron, 1974; Keppel et al., David I. Friedman 1974; Friedman et al., 1976, 1981; Greenblatt et al., Department of Microbiology and Immunology 1980). The sites include putative sites of pN action, The University of Michigan Medical School called nut (Salstrom and Szybalski, 1978; Rosenberg Ann Arbor, Michigan 48109 et al., 1978), as well as termination signals (Roberts, 1969; Rosenberg et al., 1978; Rosenberg and Court, 1979). Summary Consideration of the nature of the various factors involved in pN action formed the basis for the following The N gene product of coliphage lambda acts with model of pN action (discussed by Friedman and host factors (Nus) through sites (not) to render Gottesman, 1982). Transcription initiating at the early subsequent downstream transcription resistant to promoters PR and P, extends through the n&R and a variety of termination signals. These sites, not!? nutl sites, respectively (Figure 1). At these sites RNA and nutL, are downstream, respectively, from the polymerase is modified, rendering continuing tran- early promoters PR and PL. Thus a complicated set scription resistant to termination signals. The nature of molecular interactions are likely to occur at the of the promoter appears to play no role in pN action, nut sites. We have selected mutations in the nutR since placement of the n&R region downstream from region that reduce the effectiveness of pN in alter- the bacterial gal operon promoter results in termina- ing transcription initiating at the PR promoter.
    [Show full text]
  • A Framework for Automated Enrichment of Functionally Significant Inverted Repeats in Whole Genomes
    Missouri University of Science and Technology Scholars' Mine Computer Science Faculty Research & Creative Works Computer Science 01 Feb 2010 A Framework for Automated Enrichment of Functionally Significant Inverted Repeats in Whole Genomes Cyriac Kandoth Fikret Ercaļ Missouri University of Science and Technology, [email protected] Ronald L. Frank Missouri University of Science and Technology, [email protected] Follow this and additional works at: https://scholarsmine.mst.edu/comsci_facwork Part of the Biology Commons, and the Computer Sciences Commons Recommended Citation C. Kandoth et al., "A Framework for Automated Enrichment of Functionally Significant Inverted Repeats in Whole Genomes," BMC Bioinformatics, vol. 11, no. SUPPL. 6, BioMed Central Ltd., Feb 2010. The definitive version is available at https://doi.org/10.1186/1471-2105-11-S6-S20 This Article - Conference proceedings is brought to you for free and open access by Scholars' Mine. It has been accepted for inclusion in Computer Science Faculty Research & Creative Works by an authorized administrator of Scholars' Mine. This work is protected by U. S. Copyright Law. Unauthorized use including reproduction for redistribution requires the permission of the copyright holder. For more information, please contact [email protected]. Kandoth et al. BMC Bioinformatics 2010, 11(Suppl 6):S20 http://www.biomedcentral.com/1471-2105/11/S6/S20 PROCEEDINGS Open Access A framework for automated enrichment of functionally significant inverted repeats in whole genomes Cyriac Kandoth1*, Fikret Ercal1†, Ronald L Frank2† From Seventh Annual MCBIOS Conference. Bioinformatics: Systems, Biology, Informatics and Computation Jonesboro, AR, USA. 19-20 February 2010 Abstract Background: RNA transcripts from genomic sequences showing dyad symmetry typically adopt hairpin-like, cloverleaf, or similar structures that act as recognition sites for proteins.
    [Show full text]
  • DNA Sequence; Operator; Repressor; Regulatory Region; Dyad Symmetry; Plasmid Pbr322; Sl Nuclease Mapping)
    Gene, 23 (1983) 149-156 149 Elsevier Overlapping divergent promoters control expression of TnlO tetracycline resistance (DNA sequence; operator; repressor; regulatory region; dyad symmetry; plasmid pBR322; Sl nuclease mapping) Kevin P. Bertrand *, Kathleen Posh, Lewis V. Wray Jr. ** and William S. Reznikoff ** Department of Microbiology, University of California, Irvine, CA 92717 (U.S.A.) Tel. (714) 833- 6115, and ** Depart- ment of Biochemistry, University of Wisconsin, Madison, WI 53706 (U.S.A.) Tel. (608) 262 - 3608 (Received February 7th, 1983) (Accpeted February l&h, 1983) SUMMARY We have previously examined the genetic organization and regulation of the TnZO tetracycline-resistance determinant in Escherichia coli K-12. The structural genes for retA, the TnlO tetracycline-resistance function, and for tetR, the TnlO lef repressor, are transcribed in opposite directions from promoters in a regulatory region located between the two structural genes. Expression of both t&I and t&R is induced by tetracycline. Here we report the DNA sequence of the TnlO tet regulatory region. The locations of the tetA and tetR promoters within this region were defined by Sl nuclease mapping of the 5’ ends of in vivo tet RNA. The t&4 and tetR promoters overlap; the transcription start points are separated by 36 bp. We propose that two similar regions of dyad symmetry within the TnlO tet regulatory region are operator sites at which tet repressor binds to tet DNA, thereby in~biting transcription initiation at the ietA and tetR promoters. The TnlO ret regulatory region and the pBR322 tet regulatory region show significant DNA sequence homology (53%).
    [Show full text]
  • The Regulatory Region of the Divergent Argecbh Operon in Escherichia Coli K-12
    Volume 10 Number 24 1982 Nucleic Acids Research The regulatory region of the divergent argECBH operon in Escherichia coli K-12 Jacques Piette*, Raymond Cunin*, Anne Boyen*, Daniel Charlier*, Marjolaine Crabeel*, Franpoise Van Vliet*, Nicolas Glansdorff*, Craig Squires+ and Catherine L.Squires + *Nficrobiology, Vrije Universiteit Brussel, and Research Institute of the CERIA, 1, Ave. E. Giyson, B-1070 Brussels, Belgium, and +Department of Biological Sciences, Columbia University, New York, NY 10027, USA Received 24 September 1982; Revised and Accepted 24 November 1982 ABSTRACT The nucleotide sequence of the control region of the divergent argECBH operon has been established in the wild type and in mutants affecting expression of these genes. The argE and argCBH promoters face each other and overlap with an operator region containing two domains which may act as distinct repressor binding sites. A long leader sequence - not involved in attenuation - precedes argCBH. Overlapping of the argCBH promoter and the region involved in ribosome mobilization for argE translation explains the dual effect of some mutations. Mutations causing semi-constitutive expression of argE improve putative promoter sequences within argC. Implications of these results regarding control mechanisms in amino acid biosynthesis and their evolution are discussed. INTRODUCTION Divergently transcribed groups of functionally related genes are not exceptional in Escherichia coli (1-10). In only a few instances, however, are the sites responsible for the expression and the regulation of the flanking genes organized in an inte- grated fashion such that the gene cluster constitutes a bipolar operon, with an internal operator region flanked by promoters facing each other. The argECBH cluster (Fig.1) is one of the earliest reported examples of such a pattern.
    [Show full text]
  • A History of CRISPR-CAS
    JB Accepted Manuscript Posted Online 22 January 2018 J. Bacteriol. doi:10.1128/JB.00580-17 Copyright © 2018 American Society for Microbiology. All Rights Reserved. 1 2 3 History of CRISPR-Cas from encounter with a mysterious Downloaded from 4 repeated sequence to genome editing technology 5 6 Yoshizumi Ishino,1, 2,* Mart Krupovic,1 Patrick Forterre1, 3 7 http://jb.asm.org/ 8 1Unité de Biologie Moléculaire du Gène chez les Extrêmophiles, Département de 9 Microbiologie, Institut Pasteur, F-75015, Paris, France, 2Department of 10 Bioscience and Biotechnology, Faculty of Agriculture, Kyushu University, on March 9, 2018 by UNIV OF COLORADO 11 Fukuoka 812-8581, Japan. 3Institute of Integrative Cellular Biology, Université 12 Paris Sud, 91405 Orsay, Cedex France 13 14 15 Running title: Discovery and development of CRISPR-Cas research 16 17 * Correspondence to 18 Prof. Yoshizumi Ishino 19 Department of Bioscience and Biotechnology, 20 Faculty of Agriculture, Kyushu University, 21 Fukuoka 812-8581, Japan 22 [email protected] 1 23 ABSTRACT 24 CRISPR-Cas systems are well known acquired immunity systems that are 25 widespread in Archaea and Bacteria. The RNA-guided nucleases from Downloaded from 26 CRISPR-Cas systems are currently regarded as the most reliable tools for 27 genome editing and engineering. The first hint of their existence came in 1987, 28 when an unusual repetitive DNA sequence, which subsequently defined as a 29 cluster of regularly interspersed short palindromic repeats (CRISPR), was http://jb.asm.org/ 30 discovered in the Escherichia coli genome during the analysis of genes involved 31 in phosphate metabolism.
    [Show full text]
  • FARE, a New Family of Foldback Transposons in Arabidopsis
    Copyright 2000 by the Genetics Society of America FARE, a New Family of Foldback Transposons in Arabidopsis Aaron J. Windsor and Candace S. Waddell Department of Biology, McGill University, Montreal, Quebec H3A 1B1, Canada Manuscript received June 23, 2000 Accepted for publication August 16, 2000 ABSTRACT A new family of transposons, FARE, has been identi®ed in Arabidopsis. The structure of these elements is typical of foldback transposons, a distinct subset of mobile DNA elements found in both plants and animals. The ends of FARE elements are long, conserved inverted repeat sequences typically 550 bp in length. These inverted repeats are modular in organization and are predicted to confer extensive secondary structure to the elements. FARE elements are present in high copy number, are heterogeneous in size, and can be divided into two subgroups. FARE1's average 1.1 kb in length and are composed entirely of the long inverted repeats. FARE2's are larger, up to 16.7 kb in length, and contain a large internal region in addition to the inverted repeat ends. The internal region is predicted to encode three proteins, one of which bears homology to a known transposase. FARE1.1 was isolated as an insertion polymorphism between the ecotypes Columbia and Nossen. This, coupled with the presence of 9-bp target-site duplications, strongly suggests that FARE elements have transposed recently. The termini of FARE elements and other foldback transposons are imperfect palindromic sequences, a unique organization that further distinguishes these elements from other mobile DNAs. RANSPOSABLE elements (TEs) are ubiquitous IVR ends and contain no protein coding sequences.
    [Show full text]
  • PG 4Th Semester
    Paper No. : 04 Genetic engineering and recombinant DNA technology Module : 01 History of Genetic Material Principal Investigator: Dr Vibha Dhawan, Distinguished Fellow and Sr. Director The Energy and Resouurces Institute (TERI), New Delhi Co-Principal Investigator: Prof S K Jain, Professor, of Medical Biochemistry Jamia Hamdard University, New Delhi Paper Coordinator: Dr Mohan Chandra Joshi, Assistant Professor, Jamia Millia Islamia, New Delhi Content Writer: Dr Rohini Muthuswami, Associate Professor, Jawaharlal Nehru University Content Reviwer: Dr Mohan Chandra Joshi, Assistant Professor, Jamia Millia Islamia, New Delhi Genetic Engineering and Recombinant DNA Technology Biotechnology History of Genetic Material Description of Module Subject Name Biotechnology Paper Name Genetic Engineering and Recombinant DNA Technology Module Name/Title History of Genetic Material Module Id 01 Pre-requisites Objectives To understand how DNA was identified as genetic material Keywords DNA Genetic Engineering and Recombinant DNA Technology Biotechnology History of Genetic Material 1. Nature of the genetic material. In this module we will learn about how scientists discovered the identity of the genetic material. The foundation of modern biology was laid by scientists in mid-19th century. The principles of genetics were discovered by Gregor Mendel in 1865-66. The nuclein or what we term as nucleic acid was discovered and identified in 1869. The final identity of the genetic material was firmly established in 1952, two years after the structure of DNA was elucidated. We are going to follow this fascinating journey and I hope at the end of this module you learn to appreciate how scientists using the simple tools and techniques available to them established the identity of the genetic material.
    [Show full text]
  • DNA.Bending by Negative Regulatory Proteins: Gal and Lac Repressors
    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press DNA.bending by negative regulatory proteins: Gal and Lac repressors Christian Zwieb, Jin Kim, and Sankar Adhya 1 Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 USA The ability of two negative regulatory proteins, Gal and Lac repressors, to induce DNA bending was tested by the respective cloning of ga/and lac operator DNA sequences into a sensitive vector, pBend2, pBend2 can generate a large number of DNA fragments in each of which a cloned operator is present in circularly permuted positions along the length of the DNA. Gel electrophoresis of these DNA fragments individually complexed to a repressor shows that the Gal repressor bends both of the ga/operators, O, and O~. Similarly, the Lac repressor induces a bend to a lac operator DNA. In each case, the center of the average bent segment is located at or close to the dyad symmetry axis of the operator sequence. In view of these findings, we discuss how these negative regulatory proteins may function by a more dynamic mechanism than was perceived previously. [Key Words: DNA bending; Gal and Lac repressors; gal and lac operators] Received January 13, 1989; revised version accepted March 6, 1989. It is becoming increasingly clear that biological macro- Parker 1986; Dripps and Wartell 1987; Mizuno 1987; molecular reactions involve the formation of specific Plaskon and Wartell 1987). It was suggested by Crothers DNA-multiprotein complexes. For many of these reac- and Fried (1983)that such contortions may be essential tions, such as replication or recombination, the com- for the formation and activity of the DNA-protein tran- plexes assume a higher-order structure (Echols 1986}.
    [Show full text]
  • A Protein Involved in Minichromosome Maintenance in Yeast Binds a Transcriptional Enhancer Conserved in Eukaryotes
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press A protein involved in minichromosome maintenance in yeast binds a transcriptional enhancer conserved in eukaryotes Steven Passmore, Randolph Elble, and Bik-Kwoon Tye Section of Biochemistry, Molecular and Cell Biology, Comell University, Ithaca, New York 14853 USA The Saccharomyces cerevisiae MCM1 gene product is a protein with multiple functions. It is a transcription factor necessary for expression of mating-type-specific genes and is also required for the maintenance of minichromosomes. MCM1 shows DNA-binding specificities similar to those of two previously reported DNA- binding factors, pheromone/receptor transcription factor (PRTF) and general regulator of mating type (GRM)~ like PRTF, its activity can be modulated by the al protein. MCM1 binds to the dyad symmetry element 5'- CCTAATTAGG and related sequences, which we refer to as MCM1 _control _elements (MCEs). MCEs are found within the regulatory regions of a- and ,,-specific genes. Direct and indirect DNA binding assays suggest that a conserved 5'-ATTAGG in one-half of the dyad symmetry element is important for MCM1 binding whereas variants in the other half are tolerated. We have used a novel DNase I 'nicking interference' assay to investigate the interaction of MCM1 with its substrate. These data suggest that MCM1 binds as a dimer, interacting symmetrically with the ATTAGG residues in each half of the binding site. MCM1 contains striking homology to the DNA-binding domain of the human serum response factor (SRF) which mediates the transient transcriptional activation of growth-stimulated genes by binding to the serum response element (SRE).
    [Show full text]
  • Analysis of the DNA-Binding and Activation Properties of the Human Transcription Factor AP-2
    Downloaded from genesdev.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Analysis of the DNA-binding and activation properties of the human transcription factor AP-2 Trevor Williams ~ and Robert Tjian Howard Hughes Medical Institute, Department of Molecular and Cell Biology, University of California at Berkeley, Berkeley, California 94720 USA The mammalian transcription factor AP-2 is a sequence-specific DNA-binding protein expressed in neural crest lineages and regulated by retinoic acid. Here we report a structure/function analysis of the DNA-binding and transcription activation properties of the AP-2 protein. DNA contact studies indicate that AP-2 binds as a dimer to a palindromic recognition sequence. Furthermore, cross-linking and immunoprecipitation data illustrate that AP-2 exists as a dimer even in the absence of DNA. Examination of cDNA mutants reveals that the sequences responsible for DNA binding are located in the carboxy-terminal half of the protein. In addition, a domain mediating dimerization forms an integral component of this DNA-binding structure. Expression of AP-2 in mammalian cells demonstrates that transcriptional activation requires an additional amino-terminal domain that contains an unusually high concentration of proline residues. This proline-rich activation domain also functions when attached to the heterologous DNA-binding region of the GAL4 protein. This study reveals that although AP-2 shares an underlying modular organization with other transcription factors, the regions of AP-2 involved in transcriptional activation and DNA binding/dimerization have novel sequence characteristics. [Key Words: Enhancer factor~ DNA binding~ dimerization; mammalian expression~ proline-rich activator~ palindromic binding site] Received November 15, 19901 revised version accepted January 22, 1991.
    [Show full text]
  • Escherichia Coli Σ38 Promoters Use Two up Elements Instead of a −35 Element: Resolution of a Paradox and Discovery That Σ38 Transcribes Ribosomal Promoters
    bioRxiv preprint doi: https://doi.org/10.1101/2020.02.05.936344; this version posted February 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. Escherichia coli σ38 promoters use two UP elements instead of a −35 element: resolution of a paradox and discovery that σ38 transcribes ribosomal promoters Kevin S. Franco†,1, Zhe Sun†,1, Yixiong Chen1, Cedric Cagliero2, Yuhong Zuo3, Yan Ning Zhou1, Mikhail Kashlev1, Ding Jun Jin1 and Thomas D. Schneider 1,∗ version = 3.15 of sigma38.tex 2020 Jan 08 1National Institutes of Health, National Cancer Institute, Center for Cancer Research, RNA Biology Laboratory, P. O. Box B, Frederick, MD 21702-1201. (301) 846-5581; [email protected]; https://alum.mit.edu/www/toms/. 2 National Institutes of Health, National Cancer Institute, Center for Cancer Research, Gene Regulation and Chromosome Bi- ology Laboratory, P. O. Box B, Frederick, MD 21702-1201. Jecho Laboratories, Inc. 7320A Executive way, Frederick, MD 21704. 3Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06520, USA. † These authors contributed equally to this work. ∗Corresponding author. 1 Abstract In E. coli, one RNA polymerase (RNAP) transcribes all RNA species, and different regu- lons are transcribed by employing different sigma (σ) factors. RNAP containing σ38 (σS ) activates genes responding to stress conditions such as stationary phase. The structure of σ38 promoters has been controversial for more than two decades.
    [Show full text]
  • III = Chpt. 17. Transcriptional Regulation in Bacteriophage Lambda
    B M B 400 Part Four - III = Chpt. 17. Transcriptional regulation in bacteriophage lambda B M B 400 Part Four: Gene Regulation Section III = Chapter 17 TRANSCRIPTIONAL REGULATION IN BACTERIOPHAGE LAMBDA Not all bacteriophage lyse their host bacteria upon infection. Temperate phage reside in the host genome and do not kill the host, whereas lytic phage cause lysis of their hosts when they infect bacteria. The bacteriophage λ can choose between these two “lifestyles.” The molecular basis for this decision is one of the best understood genetic switches that has been studied, and it provides a fundamental paradigm for such molecular switches in developmental biology. This chapter reviews some of the historical observations on lysogeny in bacteriophage λ, covers the major events in lysis and lysogeny, and discusses the principal regulatory proteins and their competition for overlapping cis-regulatory sites. We will examine one of the common DNA binding domains in regulatory proteins – the helix-turn-helix, which was first identified in the λ Cro protein. Also, the use of hybrid genes to dissect complex regulatory schemes was pioneered in studies of bacteriophage λ, and that approach will be discussed in this chapter. A. Lysis versus lysogeny 1. Lytic pathway: a. Leads to many progeny virus particles and lysis of the infected cell. b. Have extensive replication of λ DNA, formation of the viral coat (head and tail proteins) with packaging of the λ DNA into phage particles, cell lysis, and release of many progeny phage. 2. Lysogenic pathway: a. The infecting phage DNA integrates into the host genome and is carried passively by the host.
    [Show full text]