Translation Initiation of Bacteriophage Lambda Gene Cli Requires Integration Host Factor JAMAL MAHAJNA,1 AMOS B

JOURNAL OF BACTERIOLOGY, Jan. 1986, p. 167-174 Vol. 165, No. 1 0021-9193/86//010167-08$02.00/0 Copyright © 1986, American Society for Microbiology Translation Initiation of Bacteriophage Lambda Gene clI Requires Integration Host Factor JAMAL MAHAJNA,1 AMOS B. OPPENHEIM,1 ALISON RATTRAY,2t AND MAX GOTTESMAN2t* Department of Molecular Genetics, The Hebrew University-Hadassah Medical School, Jerusalem, Israel,' and Laboratory ofMolecular Biology, National Cancer Institute, Bethesda, Maryland 208922 Received 20 June 1985/Accepted 2 October 1985 Escherichia coli integration host factor (IHF), a DNA-binding protein, positively regulates expression of the A, clI gene. Purified IHF stimulates cII protein synthesis in vitro, suggesting a direct role for host factor in cII expression. Further evidence for a direct role for IHF was obtained with operon and gene fusions between clI and lacZ or cII and galE. Analysis of these fusions ir vivo demonstrated that IHF is essential for the initiation of cIT translation. Replacement of the entire clI coding sequence with lacZ yielded a gene fusion which was still IHF dependent. However, a cIT-galE fusion carrying a hybrid ribosome binding region expressed galE in IHF mutants. These results indicate that sequences which make cll translation IHF dependent lie between the ribosome binding region and the initiating codon of cII. Failure to translate clI activates a transcription terminator located within cIT and results in polar effects on downstream transcription. This polarity is suppressed by the A N antitermination function. When cloned into another contest, the terminator is active in both wild-type and IHF mutant strains. The amino terminus of clI is located near an IHF binding site in a region with considerable dyad symmetry. The role of IHF in cII translation may be to prevent formation of an RNA-RNA duplex that sequesters the ribosome binding site of cII. The binding of IHF might influence RNA structure by altering the rate of the dissociation of RNA from the DNA template.

Integration host factor (IHF) of Escherichia coli is a MATERIALS AND METHODS heterodimeric protein composed of two small basic polypeptides, the products of the himA and hip genes (8, 15, Bacterial strains. E. coli strains were derivatives of E. coli 18, 19). It is directly required for the integration and excision Xl from the National Institutes of Health collection (21). of bacteriophage lambda from the bacterial chromosome Strains A2004 and A2062 are derivatives of strain Xl that (29). IHF promotes X site-specific recombination by binding carry the defective prophage A c1857 Nam7 53ABAMAHI and K DNA at three sites near the phage attachment site (5). K c1857 N+ ABAMAHI, respectively (12; numbered N4830 E. coli IHF- mutants also display defects in the regulation and N4831, respectively). The hip-157 and himA83 mutations of certain bacterial and phage genes (9, 11). The cII gene of were introduced by P1 cotransduction with a TnJO K is not expressed in the absence of IHF (14, 21). An IHF tetracycline resistance marker. Initial plasmid transforma- binding site is located immediately upstream of cII (5), tions were performed in strain A2097, a C600 derivative, suggesting a direct role for the factor in cIT expression (Fig. carrying the K cI857 ABAMAHI prophage and the lacZ XA21 1). Consistent with this idea is the demonstration that cII deletion. synthesis in a coupled transcription-translation system is Plasmids. Plasmids containing lacZ operon and gene fu- IHF dependent (this work and reference 23). sions were constructed with pMLB1010 and pMLB1034, Surprisingly, the role of IHF in cIT expression in vivo respectively; these are lacY- derivatives of Casadaban appears to be posttranscriptional; in a cII-galK operon strains (4; M. Berman, personal communication). Plasmid fusion, IHF is required for cIT but not for galactokinase pJM1016 (Table 1) was constructed by inserting a BglII BglII synthesis (14). In this manuscript we present evidence, DT9A fragment of pKC30cII (26) into pMLB1010. Note that based on the analyses of operon and gene fusions, that pKC30cII carries the cy3048 mutation, an A-to-G change (A confirms and extends that of Hoyt et al. (14). Our data coordinate 38350) between the Shine-Delgarno and ATG suggest that IHF is directly required for the initiation of clI sequences of cIT. The resulting plasmid carries OL PL nutL translation. N' nutR tRl cIT O' trpA lacZ. X' indicates that only the Failure to translate cII can lead to secondary polar effects amino-terminal portion of the gene is present. This synthetic on the transcription of downstream genes. This polarity operon expresses the cII, trpA, and lacZ proteins. Plasmids results from premature transcription termination at a site pJM1028 and pJM1039 were constructed as follows: Plasmid near the carboxy terminus of cIT. pJL6 (16) was cleaved with HindII, and the four-base recess We propose a model in which IHF binding near the was filled by Klenow large-fragment DNA polymerase. The beginning of cII prevents the formation of RNA duplex plasmid was then cleaved with PstI and ligated to pMLB1034 structures that occlude the ribosome binding site of the clI that had been previously digested with PstI and EcoRI, and transcript. treated with Klenow DNA polymerase as above. The resulting plasmid, pJM1039, carries OL PL nutL N' nutR tRl clI' 'lacZ and produces a cII'-'lacZ fusion protein. A BamHI site at the and a PstI * Corresponding author. restriction located cII'-'lacZ junction t Present address: Department of Microbiology and Immunology, site in bla were used to replace the gene fusion with the SC-42, University of Washington, Seattle, WA 98195. trpA-lacZ operon fusion from pMLB1010, creating t Present address: Columbia University, Institute of Cancer Re- pJM1028. search, New York, NY 10032. Construction of pJM1019 was performed as follows: a 167 168 MAHAJNA ET AL. J. BACTERIOL.

vwt4J'v pE N .QNVVA^pL cl 4AvVVopM cro nutR tRl cil 0 It O., pR%^^Ab. 0-11 .-Il 1.11, .-Il .--l 0-11 .01,

a-1 .-a, .0-~ -- -..- .00 -t 2 t3 aollO-, i - I

- N of TGGTGTATGCATTTATTTGCATACATTCAATCAATTGTTATCTAAGGAAATACTTACATATGGTTCGTGCAAACAAACGCAACGA

ACCACATACGTAAATAAACGTATGTAAGTTAGTTAACAATAGATTCCTTTATGAATGTATACCAAGCACGTTTGTTTGCGTTGCT

IHF binding region pE FIG. 1. Genetic map of the early gene region of phage A and the sequence around the clI initiation codon. The top line denotes the location of the early promoters PL and PR, which are negatively regulated by the cI repressor. The clI protein activates PE to initiate transcription of the cI repressor. Once repression is established, the cI repressor activates its own synthesis from PM (for a recent review, see reference 13). The lower portion of Fig. 1 shows the DNA sequence around the cII ribosome binding site. Sequence complementary to the 3' end of 16S RNA is shown in bold letters; the cII ATG initiation codon (at A coordinate bp 38360) is underlined, as is the IHF binding sequence (5). Dyad symmetries are marked by convergent arrows. Possible transcription termination sites for the PR transcript are indicated. All plasmids carrying the cy region described below contain the cy3048 mutation, an A-to-G change 10 bp upstream of the initiator ATG of cII.

189-base-pair (bp) Sau3a fragment (A coordinates 38475 to RI-HincIl fragment indicates unambiguously the orientation 38664) carrying the carboxy terminus of cII was isolated of the clI Sau3a fragment. from pAO41 (22) and inserted into pSC1. Plasmid pSC1 was Media and epzymes. Bacteria were grown in M56 medium constructed by the insertion of a HaeIII fragment carrying ?t supplemented with glycerol (0.5%), yeast extract (0.05%), PL? also isolated from pAO41, into a filled-in EcoRI site of amino acids (20-,g/ml; omitting methionine and cysteine), pMLB1010, upstream of the trpA-lacZ fusion. This X PL thiamine (0.005%), biotin (0.005%), and ampicillin (20 fragment carries OL PL and nutL, but does not include the ,g/ml). Enzymes were obtained from New England Biolabs translation initiation signal of gene N. The orientation of the and Bethesda Research Laboratories. Extracts for in vitro PL insert was determined by sequencing from a BglII site. translation were purchased from the Codon Co., Houston, The orientation of the Sau3a fragment present in pJM1019 Tex. was determined by restriction analysis. Plasmid pJM1019 Enzyme assays. P-Galactosidase assays were as described was cleaved with EcoRI and HincII, and the EcoRI sites by Miller (20). UDP-galactose 4-epimerase (galE) assays (which flank the PL fragment) were labeled with [a-32P]dATP were as described by Wilson and Hogness (30); galacto- using the Klenow fragment of DNA polymerase. The radio- kinase (galK) assays were as described by Adhya et al. (2). active DNA was then analyzed by electrophoresis on a 10% Analysis of protein synthesis. Strains carrying the various polyacrylamide gel and subjected to autoradiography. The plasmids were grown in supplemented minimal medium at HincII site is located asymmetrically within the fragment, 30°C to an optical density at 650 nm of 0.3. Induction was toward the amino terminus of cII. Thus, the size of the performed by transferring the culture to 42°C. At various time intervals, 200-,Il samples were labeled with 5 ,uCi of [35S]methionine (New England Nuclear Corp.) for 1 min, and incorporation was terminated by freezing in a liquid nitrogen TABLE 1. Summary of plasmid fusions' bath. The samples were then treated with 10% (wt/vol) Plasmid Genetic elements Fusion trichloroacetic acid for 15 min at 0°C. The precipitated pJM1016 PL nutL N' nutR tRl clI O' trpA lacZ Operon proteins were collected by a 10-min centrifugation in a pJM1028 PL nutL N' nutR tRl clI' trpA lacZ Operon microfuge, suspended in sample buffer, boiled for 3 min, pJM1039 PL nutL N' nutR tRI clI' 'lacZ Gene subjected to electrophoresis on a 10 to 26% sodium dodecyl pJM1019 PL nutL clI' trpA lacZ Operon sulfate-polyacrylamide gradient gel, and autoradiographed pJM1021 PL nutL N' trpA lacZ Operon as described by Shimatake and Rosenberg (26). pJM1040 PL nutL N' 'lacZ Gene Isolation and analysis of RNA. Total cellular RNA from pJM1044 PR cro' trpA lacZ Operon cells induced for 20 min at 42°C was isolated by treatment pJM1042 PR cro' 'lacZ Gene with hot phenol (3). For dot-blot hybridization, the purified For details, see the text. RNA was heated in the presence of 7.5 x SSC (1x SSC is VOL. 165, 1986 IHF FOR TRANSLATION INITIATION OF A GENE clI 169

0.15 M NaCI plus 0.015 M sodium citrate)-25% formalde- hyde for 15 min at 65°C, and increasing amounts of RNA 24 were fixed to nitrocellulose filters (17, 28). The filters were probed with the 800-bp ClaI fragment covering the amino- terminal coding region of lacZ. Nuclease S1 mapping was performed as described (17). Hybridization was initiated by first incubating the RNA-DNA mixture at 80°C for 15 min, followed by incubation at 53°C for 3 h. The mixture was x digested with nuclease Si, and the protected DNA fragments 16 were separated by electrophoresis on 5% acrylamide gels containing 7 M urea. Cd) RESULTS AND DISCUSSION C) In vitro expression of clI is stimulated by IHF. The synthesis of A clI protein is greatly reduced in cells mnutant for one 8 of the genes encoding the IHF subunits, himA or hip (14, 21). -J To determine whether IHF plays a direct role in the stimu- (9 lation of cII synthesis, we assayed the effect of purified IHF 4 in vitro. Cell extracts capable of coupled transcription- translation were prepared from him' and himA bacteria. As a template for clI synthesis, we used plasmid pOG7. In this construct the expression of clI is directed by the X PL 0 10 20 30 40 50 60 promoter. A band corresponding to cII product is evident in gel analysis of the proteins made in the him' extract (Fig. 2). MINUTES AT 420C The synthesis of clI protein in extracts from himA cells was markedly reduced (Fig. 2a) or, in some experiments, unde- FIG. 3. Effect of the hip-157 mutation on 13-galactosidase synthe- tectable (Fig. 2b). The effect is quite specific: a second sis. Isogenic hip' (A\, E) and hip-157 (A, !) strains carrying the protein specified by pOG7 was synthesized in both extracts, defective prophage X c1857 Nam7 53ABAMAIHI were transformed as were the proteins encoded by pBR322 (Fig. 2a). The with plasmid pJM1028 carrying the operon fusion pL-cII'-trpA-lacZ addition of purified IHF (gift of H. Nash) to the himA extract (A, A) or the cll gene fusion plasmid pJM1039 (0, *). Both constructs carry only the first 40 bp of clI to the TaqI restriction site; strongly stimulated the synthesis of cII protein, consistent they lack the cll terminators. Cells grown in supplemented minimal with a direct role of IHF in clI expression. When purified X medium at 30°C were induced at 42°C and assayed for ,B- cI repressor, which inhibits the PL promoter, was added with galactosidase activity. IHF, no stimulation of clI protein synthesis was observed (Fig. 2c). Thus, IHF does not enhance cII expression by activating a new phage or plasmid prom(oter. The effective equivalent to that used for in vitro site-specific recombina- concentration of IHF used in these experiments was roughly tion; a 10-fold increase in IHF concentration did not further increase clI protein synthesis (data not shown). A marked stimulation of cIt synthesis by IHF in a highly a b c purified in vitro system has recently been reported (23). IHF stimulates cIlI translation. We tested the possibility pBR322 pOG7 pOG 7 pOG7 that IHF was required for clI translation by comparing gene himA+ - + - himA + + - - himA - - and operon fusions between clI and lacZ (Table 1). The IHF - + - + IH F + + expression of lacZ in both fusions was under the control of Cl-HF+ a thermoinducible X PL promoter. The fusions are present on plasmids, both of which carry the same fragments of A DNA. One fragment contains OL PL, nutL, and the amino-terminal portion of N (up to the HpaI site within gene N). The second fragment, fused, to the first, starts from the HaeIII restriction site located within cro and ends at the TaqI site within cIM. _a -- This fragment contains the genetic information for the carboxy terminus of cro, nutR, tRl, the IHF binding site, the cli ribosome binding site, and the first 13 amino acids of cMI. In plasmid pJM1039, this amino-terminal portion of cII is

-4 _j. fused to lacZ, producing a hybrid cII'-'lacZ protein. The "- I *4 3 second plasmid, pJM1028, bears the same clI DNA fragment V as an operon fusion with trpA-lacZ. The pJM1039 fusion measures both the transcription and translation of the first part of cII, while the pJM1028 fusion measures only tran- FIG. 2. Effect of IHF on in vitro synthesisof the autoradiography of I5S-labeled proteins after thelectrphortesin scription. We found that synthesis of 3-galactosidase pBR322 and pOG7 templates were used in an S;30coupledtranscrip- from the clI'-'lacZ gene fusion was dependent upon the tion-translation system. Plasmid pOG7 carries cll under the control presence of IHF in the cell, while the cII'-trpA-lacZ operon of the PL promoter (21). Cell extracts were rmade from wild-type fusion was IHF independent (Fig. 3). Dot-blot analysis of him' or himA- cells. Purified IHF and cI reepressor were added lacZ mRNA isolated from cells carrying pJM1039 or where indicated. The arrow identifies the clI Iprotein band. pJM1028 showed only a twofold effect of the hip-157 muta- 170 MAHAJNA ET AL. J. BACTERIOL.

mutations (Table 2, Fig. 5). Thus, IHF control of cII RNA concentration (Ag) expression requires a DNA sequence located between the IHF binding site and the ATG of clI. A second galE fusion 10 5 2 1 0.5 strain, lDl, in which the fusion point was immediately promoter-distal to cro, was likewise IHF independent (Table 2). As expected, gene fusions between lacZ and X genes, AS@ * other than clI, were IHF independent; pL-N'-'lacZ (pJM1040) and pR-cro'-lacZ (pJM1042) fusions were equally BOSO * active in wild-type and hip-157 mutants (data not shown). Thus, IHF is not generally required for the translation of X genes. IHF is required for the 'tomplete transcription of clI. In bacteria; transcription and translation are usually coupled. Polypeptide chain-terminating mutations are often followed C. . . by premature transcription termination, producing polar effects on downstream genes. It has been proposed that ribosomes prevent transcription termination by blocking DOS** * * access of Rho termination factor to mRNA and RNA polymerase (1). FIG. 4. Dot-blot hybridization of purified cII-lacZ fusion Failure to translate clI also leads to polar effects on mRNA. RNA was isolated from induced cells carrying the X cI857 promoter-distal genes. We introduced plasmid pJM1016, Nam7 53ABAMAHI defective prophage (see the text). Lines A and which carries genes cII, trpA, and lacZ under the control of C, RNA from hip' cells; Lines B and D, RNA from hip-157 cells. the K PL promoter, into wild-type, hip, or himA strains. The cells bore plasmid pJM1039 carrying the pL-cII'-'lacZ gehe Induction at 42°C led to the extensive synthesis of the clI, fusion (lines A and B) or pJM1028 carrying the PL cII'-trpA-1acZ trpA, and lacZ gene products in wild-type cells, but not in operon fusion (lines C and D). hip-157 mutants (Fig. 6A). Similar results were seen with the himA83 mutant (data not shown). The expression of trpA tion (Fig. 4). Taken together, these results show that the and lacZ in a pR-cro'-trpA-lacZ operon fusion (pJM1044) transcription of the 5' end of clI is not markedly affected by (Fig. 6B) or the expression of lacZ in a pL-N'-trpA-IacZ IHF but that the translation of the cII transcript depends operon fusion (pJM1021) is IHF independent (data not upon the presence of the host factor. The fact that the shown). These results indicate a strong reduction in himA fusions carry only the first 13 coding triplets of clI strongly or hip mutants of transcription within and downstream of suggests that IHF is required at an early step in the initiation cII. of clI protein synthesis. A lacZ gene fusion in which only the The effect of IHF on transcription distal to cIT in pJM1016 ATG initiator codon clI is retained is still functional only in can also be monitored by assaying ,-galactosidase activity IHF+ strains (data not shown). after thermal induction. Consistent with the protein gels Having shown that replacement of the entire cII coding shown above, the expression of lacZ in the cII-trpA-lacZ sequence did not obviate the IHF requirements for transla- operon fusion was reduced fivefold by the hip-157 mutation tion, we proceeded to test a fusion (in strain 6D7) between (Fig. 7A). cII and galE in which the fusion point lies within the Most transcription termination can be suppressed by the k Shine-Dalgarno sequences of the two genes (6). The hybrid N antitermination function (2). This is the case with the Shine-Dalgarno sequence lies just promoter-distal to the block to transcription produced by the hip-157 mutation. We intact clI IHF binding site. In contrast to the gene fusions introduced pJM1016 into an isogenic set of hip' and hip-157 described above, the 6D7 fusion was active in IHF- hosts; lysogens carrying an N+ prophage. In contrast to the results galE expression was unaffected by the himA83 or hip-157 presented above with N- prophage, both hip+ and hip-157 strains synthesized 3-galactosidase (Fig. 7B). Finally, we measured transcription directly by performing a dot-blot the mRNA TABLE 2. Effect of the himA83 and hip-157 mutations on the analysis of IacZ synthesized in wild- expression of galE and galK in PR gal fusion strains' type and hip-157 strains. Total RNA was isolated 20 min after thermal induction of N- lysogens carrying pJM1016. Enzyme units Host Fusion IHF Epimerase kinase 6D7 PR cro+ tRl galETK + 5.9 4.1 I ambda: TTCAATCAATTGTTATCTAAGGAAATACTTACATATG himA83 7.6 3.6 AAGTTAGTTAACAATAGATTCCTTTATGAATGTAT1 hip-157 5.8 3.7 ----> < . --- . lDl PR cro+ galETK + 9.3 11.5 himA83 6.3 5.8 6D 7: TTCAATCAATTGTTATCTAAtggagcgaattatg hip-157 10.8 12.1 AAGTTAGTTAACAATAGATTacctcgcttaatac FIG. 5. DNA sequence around the 6D7 cli-galE fusion point. aThe himA83 and hip-157 mnutations were introduced into strains 6D7 and Lambda sequence is shown in lDl (6) by P1 transduction. Strain 6D7 carries both cro+ and tR1; lDl is cro+ capital letters; galE sequence is in but deleted for tRl. Cells were grown in LB medium and induced at 42°C for lowercase letters. For comparison, the DNA sequence upstream of 60 min. Enzyme levels were determined as described in the text. Uninduced the initiator ATG of cII is displayed. IHF binding sites and initiator levels of epimerase were undetectable, while uninduced galactokinase levels ATGs are underlined; a cll hyphenated dyad symmetry including varied between 0.3 and 0.7 U. See Fig. 5 for the DNA sequence around the the clI Shine-Dalgarno sequence is indicated. The Shine-Dalgarno 6D7 cIl galE fusion point. sequences are shown by an overlying line. VOL. 165, 1986 IHF FOR TRANSLATION INITIATION OF X GENE cII 171

A hip + hipl57 B hip + hip157

u 3 6 9 15 u 3 6 9 15 u 2 5 10 u 2 5 10

-. Lt UN ," ," T:00£_ *4'"*.. u, .u...sSsia

W.-N'T

FIG. 6. Effect of the hip-157 mutation on gene expression. Cells carrying plasmid pJM1016, a pL-cII-trpA-IacZ operon fusion (A), or pJM1044, a pR-cro'-trpA-lacZ operon fusion (B), were induced at 42°C and pulse-labeled with [35S]methionine at 3, 6, 9, and 15 min or 2, 5, and 10 min after induction. Lane u contains samples from uninduced cells. The locations, from bottom to top, of the cll, trpA, and lacZ proteins are indicated by arrows. These proteins were not observed after heat induction of cells without plasmid (data not shown). The proteins were separated on a sodium dodecyl sulfate-polyacrylamide gel and visualized by autoradiography. The RNA was probed with labeled DNA derived from the tion termination; the entire probe is protected against Si amino terminus of lacZ. In agreement with the protein and degradation. enzyme data shown above, IHF stimulated lacZ transcrip- Our Si experiments did not distinguish between transcription 5- to 10-fold (Fig. 8). tion termination in clI and processing of a cII transcript. Identification of a transcription terminator within cIT. Tran- Evidence for the former was obtained with two operon scription distal to gene cII does not, therefore, occur in himA fusions. The first, pJM1028, identical to pJM1016 but carry- or hip mutants in the absence of N function. We have ing only the first 40 bp of cII, expressed f-galactosidase in a detected, by Si mapping, an RNA transcript with a 3'-OH hip-157 background (Fig. 3). The absence of a terminator in terminus within cII. RNA from strains containing pJM1016 this fusion is entirely consistent with the Si mapping data of was hybridized to a A DNA fragment containing tRl, clI, and Fig. 9. the beginning of gene 0. The fragment was 32P labeled at the In a second fusion, pJM1019, we introduced a 189-bp cIT 3' end of the template strand. After hybridization, the Sau3a fragment (bp 38475 to bp 38664) between X PL and nucleic acid was subjected to treatment with Si nuclease, trpA-lacZ. This fragment encodes the carboxy terminus of which degrades single-stranded DNA, and the fragments cII from amino acid 40 to 10 bp distal to the cIT TGA stop were separated by gel electrophoresis. The experiment of codon. The oop terminator is present in reverse orientation Fig. 9 indicates that transcripts terminating within cII were (with respect to PL); the oop promoter is absent. Si mapping formed in the absence of IHF and the X N antitermination placed the 3' end of the cII transcript in this region. The function. Two bands, about 40 nucleotides apart, suggest pJM1019 fusion displayed little expression of lacZ in either two transcripts ending about 240 and 280 bp from the initial hip-157 or hip' cells (Fig. 10). As expected, X N antitermina- ATG of clI. This would place the 3' ends of these transcripts tion function suppressed termination in pJM1019 and permit- on either side of the 3' end of A oop RNA, which is ted lacZ expression. The plasmid parent of pJM1019, pSC1, transcribed in the opposite direction from clI. The extensive which does not carry the cIT insertion, expressed high levels dyad symmetry in this portion of the X chromosome may of p-galactosidase in N- hip' or hip-157 strains (data not account for its termination activity. We note that such shown). We assume that the cIT termination region is active symmetry can complicate Si analysis, since the longer in pJM1019 because it is not translated. This is analogous to transcript may, in part, self-anneal rather than hybridize to cII at its normal location in the pR operon under IHF- DNA (A. Honigman and M. Cashel, personal communica- conditions. tion). Were this the case, the shorter transcript would be an Model to explain IHF control of clI translation. E. coli IHF artifact. In the presence of N function, we see no transcrip- consists of two polypeptide subunits, IHFa and IHFp, 172 MAHAJNA ET AL. J. BACTERIOL.

20 20

A B

C~T 15 15 - x x

-I .U) 0 0 U) 10 0:- 10

0 -J &) 0 5 5

0 20 40 60 0 20 40 60 MINUTES AT 420C MINUTES AT 420C FIG. 7. Transcription termination in gene cII. Isogenic hip' (A, L) and hip-157 (A, *) strains harboring (A) the defective prophage A c1857 Nam7 53ABAMAHI (A, A) or (B) the N+ derivative (O, *) were transformed with the plasmid pJM1016 carrying the pL-cII-trpA-IacZ operon fusion. Cells grown in supplemented minimal medium were induced at 42°C and assayed for P-galactosidase activity.

encoded by the himA and hip genes, respectively (8, 19, 29). RNA concentration These polypeptides closely resemble the subunits of type II (pg ) DNA-binding proteins, such as E. coli Hua and Hu,B (8, 24). Both Hu and IHF decrease the linking number of DNA 10 5 3 2 1 0.5 (H. A. Nash, personal communication). In contrast to Hu, however, IHF binds to specific DNA sequences. A consen- A * a * sus sequence for an IHF binding site, 5'-PyNPyAANNNN- TTGA/TT-3', has been proposed; the sequence 5'- TTCAATCAATTGTT-3' is present 3 bp upstream from the B cII ribosome binding site (5) (see Fig. 1). In vitro studies demonstrate that IHF binds just 5' of clI, protecting 33 bp from DNase digestion (5). We assume that IHF binding to C E.:IIEO..* this site is required for cII translation. The expression of a gene fusion in which the entire cII coding sequence is substituted with lacZ is still IHF dependent. A galE fusion that extends further into X, altering the clI Shine-Dalgarno sequence, is IHF independent. Thus, FIG. 8. Termination of transcription in cll shown by dot-blot removal of DNA between the ribosome binding site and the hybridization. RNA was isolated at 20 min after induction from the ATG of four strains described in Fig. 7. From left to right, decreasing cII eliminates the IHF requirement. This region amounts of RNA were applied to the filter. The four strains were: shows symmetry to sequences around the cII ribosome Line A, N- hip'; line B, N- hip-; line C, N+ hip'; line D, N+ hip-. binding site (Fig. 1). The cII transcript, therefore, has a The dried filters were hybridized with a 32P-end-labeled DNA probe potential, albeit weak, secondary structure that could oc- derived from the amino-terminal portion of the lacZ gene to the ClaI clude the Shine-Dalgarno sequence. Such structures are site (-800 bp). known to block translation initiation (10, 25, 27). It is VOL. 165, 1986 IHF FOR TRANSLATION INITIATION OF A GENE cII 173 possible that the cII mRNA structure is stabilized by RNA- 14 r binding proteins or by other sequences in the pR transcript. In contrast to the in vivo studies described above, analysis of cII expression in a purified in vitro system suggests a role 12 1 for IHF in cII transcription. Peacock et al. (23) found that in vitro, IHF stimulated coordinately both the synthesis of cII protein (or initial cII dipeptide) and that of a downstream C,, gene product; expression of the upstream N gene was IHF 0 10 independent. IHF augmented the synthesis of cII mRNA; x addition of IHF to clI mRNA did not increase clI transla- LU4- tion. These authors concluded that IHF stimulates cII tran- .c 8 scription by suppressing termination at tRl, which lies just C promoter-proximal to cII (23). w We offer the following hypothesis to explain a role for IHF 4 0 6 in both transcription and translation. IHF alters DNA struc- U) i-J 4

e- ~- 540 b-> 2 pL tRl cil trpA lacZ 0 20 40 60 MINUTES AT 420C FIG. 10. Subcloning of the clI transcription termination region. Isogenic strains described in the legend to Fig. 4 were transformed A with plasmid pJM1019 (see text). Cultures were grown at 30°C and B C D E F G H shifted to 42°C (0 min). Samples were taken at intervals and assayed for ,B-galactosidase activity. Cells carried the N- and hip' alleles (O), the N- and hip-157 alleles (A), the N+ and hip' alleles (U), or the N+ and hip-157 alleles (A). * _ mm -f 4 _6

ture in the tRl to cII region, perhaps by inducing local DNA 540 b - *a melting. This could reduce RNA polymerase pausing at tRl and affect the dwell time of the clI transcript on the DNA A1')A template. We suggest that changes in the rates of elongation and release can influence the secondary and tertiary struc- 380 b - ture of a transcript. In the presence of IHF, cII mRNA is released in a translatable configuration, whereas in the absence of host factor, the released transcript carries a blocked ribosome binding site. This model can be accommo- dated to the observations of Peacock et al. (23) by assuming that in vitro tRl can act as a terminator rather than as a pause site. Transcription through tRl might be modulated by FIG. 9. Analysis of transcription by S1 mapping. RNA, ex- factors absent or limiting in the in vitro system. tracted as described in the text from cells carrying pJM1016 (clI- The failure to translate cII is the presumptive cause of trpA-lacZ operon fusion), was hybridized to a DNA probe isolated premature termination in the PR operon; similar as an AvaI-EcoRI DNA fragment of pAO41 (22) labeled at the 3' transcription are end of the AvaI site with [a-32P]dCTP. This DNA fragment can be polar effects well documented in E. coli (1). IHF has, protected by a 540-nucleotide-long mRNA region containing tRl, therefore, the potential to regulate genes distal to its site of clI, and the amino-terminal portion of gene 0 (to the BgII site at action at cII. Since transcription termination in cII is sup- coordinate 38754). After hybridization and S1 treatment, the pro- pressed by X N function, this aspect of IHF control might be tected DNA fragments were separated by electrophoresis and observed only under conditions where N is limiting for phage visualized by autoradiography. Host cells are: lane A, N- and hip'; growth. Whether, in fact, termination in cII has a regulatory lane B, N- and hip-157; lane C, N+ and hip'; lane D, N+ and function in A development is not known. hip-157. Lanes E to H are DNA markers: lane E, EcoRI-AvaI probe; IHF regulates the expression of genes other than cII. The lane F, the same fragment digested with BglII; lane G, a pBR322 activities of the ilv and xyl operons are reported to be at least molecular weight marker digested with Hinfl restriction enzyme and labeled with [(t-32P]dCTP using the large Klenow fragment of DNA partially dependent on IHF (9), as is the expression of the polymerase; lane H, pBR322 marker digested with Sau3a restriction phage Mu genome (11, 19). The role of IHF in these systems enzyme and labeled as described above. The top DNA band in lanes is not yet defined. Finally, it remains possible that other A through D represents DNA-DNA hybrid formation that is resist- class II DNA-binding proteins might also regulate gene ant to S1. expression; this question is currently being investigated. 174 MAHAJNA ET AL. J. BACTERIOL.

ACKNOWLEDGMENTS Control of phage X development by stability and synthesis of cII We thank M. Berman, J. Lautenberg, and R. Weisberg for plasmids protein: role of the viral cIII and host hflA, himA, and himD and bacterial strains; H. Nash for purified IHF; and Shoshy Altuvia genes. Cell 31:565-573. and Simi Koby for plasmid pSCl. A. Honigman, S. Adhya, D. Court, 15. Kikuchi, A., E. Flamm, and R. A. Weisberg. 1985. An E. coli and R. Weisberg provided helpful suggestions for the writing of the mutant unable to support site-specific recombination of manuscript. bacteriophage X. J. Mol. Biol. 183:129-140. This work was supported by grants from Israeli Academy of 16. Lautenberg, J. A., D. Court, and T. S. Papas. 1983. High-level Sciences, United States-Israel Binational Science Foundation, and expression of Escherichia coli of the carboxy-terminal se- the Leonard Wolfson Foundation for Scientific Research. quences of the avian myelocytomatosis virus (MC29) v-myc protein. Gene 23:75-84. LITERATURE CITED 17. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, 1. Adhya, S., and M. Gottesman. 1978. Control of transcription N.Y. termination. Annu. Rev. Biochem. 47:967-996. 18. Miller, H., A. Kikuchi, H. A. Nash, R. A. Weisberg, and D. I. 2. Adhya, S., M. Gottesman, and B. de Crombrugghe. 1974. Friedman. 1979. Site-specific recombination of bacteriophage X: Release of polarity in Escherichia coli by N gene of phage X: the role of host gene products. Cold Spring Harbor Symp. termination and anti-termination of transcription. Proc. Natl. Quant. Biol. 43:1121-1126. Acad. Sci. USA 71:2534-2538. 19. Miller, H., and H. Nash. 1981. Direct role of the himA gene 3. Aiba, H., S. Adhya, and B. de Crombrugghe. 1981. Evidence for product in phage X integration. Nature two functional gal promoters in intact Escherichia coli cells. J. (London) 290:523-526. Biol. Chem. 256:11905-11910. 20. Miller, J. 1972. Experiments in molecular genetics. Cold Spring 4. Casadaban, M. J., J. Chou, and S. N. Cohen. 1980. In vitro gene Harbor Laboratory, Cold Spring Harbor, N.Y. fusions that join an enzymatically active ,-galactosidase seg- 21. Oppenheim, A. B., S. Gottesman, and M. Gottesman. 1982. ment to amino-terminal fragments of exogenous proteins: Esch- Regulation of bacteriophage X int gene expression. J. Mol. Biol. erichia coli plasmid vectors for the detection and cloning of 158:327-346. translational initiation signals. J. Bacteriol. 143:971-980. 22. Oppenheim, A. B., G. Mahajna, S. Koby, and S. Altuvia. 1982. 5. Craig, N. L., and H. A. Nash. 1984. E. coli integration host Regulation of the establishment of repressor synthesis in factor binds to specific sites in DNA. Cell 39:707-716. bacteriophage X. J. Mol. Biol. 155:121-132. 6. Dambly-Chaudiere, C., M. Gottesman, C. Debouck, and S. 23. Peacock, S., H. Weissbach, and H. A. Nash. 1984. In vitro Adhya. 1983. Regulation of the pR operon of bacteriophage regulation of XcII gene expression by E. coli integration host lambda. J. Mol. Appl. Genet. 2:45-56. factor. Proc. Natl. Acad. Sci. USA 81:6009-613. 7. Echols, H., and G. Guarneros. 1983. Control of integration and 24. Rouviere-Yaniv, J., M. Yaniv, and J. E. Germond. 1979. E. coli excision, p. 75-92. In R. W. Hendrix, J. W. Roberts, F. W. DNA binding protein Hu forms nucleosome-like structure with Stahl, and R. A. Weisberg (ed.), Lambda II. Cold Spring Harbor circular double stranded DNA. Cell 17:265-274. Laboratory, Cold Spring Harbor, N.Y. 25. Shontel, J., J. Sninsky, and S. Cohen. 1984. Effects of alterations 8. Flamm, E. L., and R. A. Weisberg. 1985. Primary structure of in the translation control region on bacterial gene expression: the hip gene of E. coli and of its product, the a-subunit of use of cat gene constructs transcribed from the lac promoter as integration host factor. J. Mol. Biol. 183:117-128. a model system. Gene 28:177-193. 9. Friedman, D. I., E. J. Olson, D. Carvet, and M. Gellert. 1984. 26. Shimatake, H., and M. Rosenberg. 1981. Purified X regulatory Synergistic effect of himA and gyrB mutations: evidence that protein cll positively activates promoters for lysogenic devel- Him functions control expression of ilv and xyl genes. J. opment. Nature (London) 292:128-132. Bacteriol. 157:484-489. 27. Steitz, J. A. 1979. Genetic signals and nucleotide sequences in 10. Gold, L., D. Pribnow, T. Schneider, S. Shinedling, B. Singer, and messenger RNA, p. 349-399. In R. F. Goldberger (ed.), Biolog- G. Stormo. 1981. Translation initiation in prokaryotes. Annu. ical regulation and development, vol. 1: Gene expression. Rev. Microbiol. 35:365-403. Plenum Publishing Corp., New York. 11. Goosen, N., and P. van de Putte. 1984. Localization of the 28. Thomas, P. S. 1983. Hybridization of denatured RNA trans- presumed recognization sites for HimD and Ner functions ferred or dotted to nitrocellulose paper. Methods Enzymol. controlling bacteriophage Mu transcription. Gene 30:41-46. 100:255-266. 12. Gottesman, M. E., S. Adhya, and A. Das. 1980. Transcription 29. Weisberg, R., and A. Landy. 1983. Site-specific recombination antitermination by bacteriophage lambda N gene product. J. in phage lambda, p. 211-250. In R. Hendrix, J. Roberts, J. Stahl, Mol. Biol. 140:57-75. and R. F. Weisberg (ed.), Lambda II. Cold Spring Harbor 13. Hendrix, R. W., J. W. Roberts, F. W. Stahl, and R. A. Weisberg Laboratory, Cold Spring Harbor, N.Y. (ed.). 1983. Lambda II. Cold Spring Harbor Laboratory, Cold 30. Wilson, D., and D. Hogness. 1966. Galactokinase and uridine Spring Harbor, N.Y. diphosphogalactose 4-epimerase from Escherichia coli. Meth- 14. Hoyt, M., A. Knight, A. Das, H. I. Miller, and H. Echols. 1982. ods Enzymol. 8:229-240.