Identification of Repressor Binding Sites Controlling Expression of Tetracycline Resistance Encoded by Tnjo LEWIS V

Identification of Repressor Binding Sites Controlling Expression of Tetracycline Resistance Encoded by TnJO LEWIS V. WRAY, JR.,t AND WILLIAM S. REZNIKOFF* Department ofBiochemistry, College ofAgricultural and Life Sciences, University of Wisconsin-Madison, Madison, Wisconsin 53706 Received 23 May 1983/Accepted 7 September 1983

The regulatory region controlling the expression of tetracycline resistance and repressor genes contains two nearly identical regions of dyad symmetry. Dele- tions of this control region were isolated by digestion with S1 nuclease. The ability of these deletions to bind the tet repressor was determined by an in vivo repressor titration assay. The results indicate that repressor specifically binds both regions of dyad symmetry.

The tetracycline resistance determinant asso- MATERIALS AND METHODS ciated with the plasmid R100 is part of a trans- Materials. Growth media were prepared as de- posable genetic element called transposon TnJO scribed by Miller (24). Concentrations of antibiotics (16). Resistance does not result from the inacti- (Sigma Chemical Co.) used were 60 jig of kanamycin vation of the antibiotic (17). Instead, the resist- per ml and 100 ,g of ampicillin per ml. ance mechanism appears to involve the active Restriction enzymes were purchased from Bethesda efflux of tetracycline from the cell (1, 21). In Research Laboratories or New England Biolabs and addition, decreased ribosomal sensitivity to tet- were used as described by the manufacturer. S1 nucle- racycline may contribute to resistance ase and T4 polynucleotide kinase were obtained from (17, 28). P-L Biochemicals, Inc. T4 DNA ligase was a gift from The expression of tetracycline resistance is R. Simoni. regulated; preincubation with a subinhibitory Bacterial strains. All bacterial strains were de- concentration of tetracycline increases the level rivatives of Escherichia coli K-12. Strain JD600 is of resistance (13). TnJO directs the synthesis of leu hsdM hsdR tonA supE lacY thi. Strain MZ12 is two tetracycline-inducible proteins with appar- Alac(ipozy)X74 trp thi. ent molecular weights of 36,000 and 25,000 (26- Plasmids and phage. Plasmids pBR322, pACYC177, 28). The largest is referred to as the TET protein and pRT86 have been described previously (5, 6, 26). and is known to be negatively regulated by a Plasmid pRZ4045 contains a lac promoter fragment repressor which is inactive in the cloned between the EcoRI and Sall sites of pBR322 presence of (R. Johnson, M. Peterson, and W. Reznikoff, unpub- tetracycline (27). The TET protein is membrane- lished data). Plasmid DNA was isolated by the method associated and is essential for tetracycline resist- of Humphreys et al. (12). ance (15, 27). The 25-kilodalton protein is the The bacteriophage XRS205 is a promoter cloning repressor and has been shown to negatively vector that contains a lacZ gene derived from a trp-lac regulate its own synthesis (2, 26). The location fusion strain, W205, that deletes the lacPO region but of the structural genes for both of these proteins leaves the lacZ gene intact. This phage contains a has been determined (7, 15, 26) (Fig. 1). single EcoRI site and a single Sall site located between These two genes are transcribed divergently the phage att site and the promoterless lacZ gene. A from a common control region has promoter-bearing DNA fragment inserted into these which been sites controls the expression of lacZ. The construction shown to bind purified RNA polymerase (15) of this vector will be described elsewhere (K. P. and tet repressor (9). The DNA sequence of this Bertrand, K. Postle, L. V. Wray, Jr., and W. S. regulatory region has been determined and has Reznikoff, manuscript in preparation). revealed the presence of two nearly identical Plasmid and deletion constructions. A plasmid clone regions of dyad symmetry (4, 10). The experi- of the repressor gene was constructed by digesting ments described in this report demonstrate that pRT86 and pACYC177 with HincIl. After heat inacti- these symmetrical sequences are the repressor vation of the restriction enzyme, the DNA was treated binding sites. with T4 DNA ligase and used to transform JD600 cells by the method of Mandel and Higa (18). The cells were inoculated into 4 ml of LB medium and incubated at t Present address: Institut fur Organische Chemie und 37°C with shaking for 90 min. Transformants were Biochemie, Technische Hochschule Darmstadt, D-6100 selected by plating on tryptone-yeast extract plates Darmstadt, Federal Republic of Germany. containing kanamycin. Since the HinclI site of

1188 VOL. 156, 1983 tet REPRESSOR BINDING SITES 1189 TET protein DNA was self-ligated with T4 DNA ligase and used for .| 1 i695695~~~PO,iN I transformation as described above. Transformants were selected by plating on tryptone-yeast extract repre plates containing ampicillin. tetracycline DNA sequencing. Deletions generated from the SalI site were end labeled at the XbaI restriction site by inactive repressor treatment with [,y-32P]ATP (Amersham Corp.) and FIG. 1. Physical and genetic map of transposon polynucleotide kinase. After digestion with BgII, the TnlO. The thick lines represent the inverted repeat labeled fragments were isolated and the sequence sequence of ISIO, and unlabeled vertical lines are determined by the method of Maxam and Gilbert (20). HincII cleavage sites. The structural gene for the The deletions generated from the XbaI restriction site repressor is located entirely within the 695-base-pair were cloned as EcoRI-SalI fragments into the single- HinclI fragment. P, Promoter; 0, operator. stranded M13 cloning vector Mp8 (23) and were se- quenced by the method of Sanger et al. (25). 3-Galactosidase assays. Cells were grown in M9 pACYC177 lies within the gene encoding f3-lactamase, minimal medium supplemented with 0.2% glucose, 80 the transformants were screened for sensitivity to ,ug of tryptophan per ml, 4 ,ug of thiamine per ml, and ampicillin. The presence of the HincIl 695 fragment antibiotics where appropriate. Cultures were assayed was confirmed by electrophoretic analysis of HincIl by the method of Miller (24). digests of the resulting plasmids. The orientation of the insertions was determined by comparing the restric- RESULTS tion patterns from a double digestion with BamHI and XbaI. pRT241 contains the TnlO HincIl 695 fragment Construction of recombinant plasmids and inserted so that the tet repressor and ,B-lactamase phage. In an earlier study (26), the tet repressor genes are in opposite orientations. gene was mapped to the TnWO HincII 695 frag- Deletions of the tet regulatory region were con- ment. To construct a plasmid encoding the re- structed with pRT301 digested with either XbaI or pressor, this fragment was inserted into the SalI. Linearized plasmid DNA (20 ,ug) was treated HincII site of pACYC177. The resulting plas- with 100 units of Si nuclease at 28°C in a buffer mid, pRT241, is resistant to kanamycin and is consisting of 25 mM NaCl-3 mM ZnSO4-25 mM as sodium acetate (pH 5.0). Portions were removed after compatible with ColEl replicons such 5, 10, 15, 20, 25, and 30 min of incubation, and pBR322. This plasmid does not contain the reactions were terminated by extraction with phenol. operator sites controlling the expression of the After extraction with ether, the samples were dialyzed repressor, and thus, repressor synthesis is un- against 10 mM Tris (pH 7.9) with Millipore VMWP regulated. filters as described by Marusyk and Sergeant (19). The The plasmid pRT301 has the 160-base-pair

Kan

TnIO tot repressor

XRT301

Sal - EcoRI A. I loc z te tt A500 ci857 S

FIG. 2. Structure of plasmids and phage. The TnlO portions in the different plasmids are shown as well as the location of the kanamycini (Kan) and ampicillin (Amp) resistance genes. 1190 WRAY AND REZNIKOFF J. BACTERIOL. TABLE 1. Repressor titration slight increase in the level of ,B-galactosidase. Plasmidsa P-Galactosidase activity' When the pBR322 tet promoter region was removed, as in pRZ4045, this increase was not None ...... 5,080 observed. pACYC177 ...... 5,160 Isolation and sequence determination of dele. pRT241 ...... 206 tions of the tet control region. To determine the pRT241 and pBR322 ...... 293 DNA sequence required for repressor binding pRT241 and pRZ4045 ...... 209 pRT241 and pRT301 ...... 3,730 activity, a series of plasmids containing dele- pRT241 and pRT315 ...... 3,870 tions of the tet control region in pRT301 were pRT241 and pRT317...... 1,700 prepared. The endpoints of the various deletions pRT241 and pRT320 ...... 202 are shown in Fig. 3. pRT241 and pRT323 ...... 1,630 The deletions 315, 317, 320, and 323 were pRT241 and pRT331 ...... 3,590 generated by Si nuclease digestion from the pRT241 and pRT332...... 2,700 XbaI site, whereas deletions 331, 332, 333, 336, pRT241 and pRT333 ...... 1,210 and 339 were generated from the SalI site. and ...... 1,230 pRT241 pRT336 Effect of deletions on repressor binding. Plas- pRT241 and pkT339 ...... 208 mids containing the deletions of the tet control a All assays were performed in strain MZ12 which is region were analyzed for their ability to bind lysogenic for XRT301. repressor by the repressor titration assay (Table b 3-Galactosidase activity is in units described by 1). Miller (24). Values given are the average from three independent cultures. All assays were repeated at least Plasmids pRT317 and pRT323 had an interme- twice. diate level of repressor titration. These plasmids contain deletions of all or part of 01, a region of dyad symmetry, without extending into 02, the TaqI fragment containing the tet control region second region of dyad symmetry. Plasmid cloned between the EcoRI and Sall sites of pRT320, which contains a deletion extending pBR322 (Fig. 2). This EcoRI-SalI fragment was into 02, does not have the ability to bind repres- cloned into the promoter cloning vector XRS205 sor. to give XRT301. In this recombinant phage, the Plasmids pRT331 and pRT332 have deletion expression of,-galactosidase is controlled by endpoints that differ by only two base pairs. The the promoter for the tet resistance gene. The lower level of 3-galactosidase observed for construction of this plasmid and phage will be pRT332 suggests that these base pairs play a role described elsewhere (K. P. Bertrand, K. Postle, in repressor binding. Plasmids pRT333 and L. V. Wray, Jr., and W. S. Reznikoff, manu- pRT336 contain deletions of most of 02 and script in preparation). showed an intermediate level of repressor titra- Assay for repressor binding. The binding of tet tion. The deletion in pRT339 extends into 01 and repressor was measured by repressor titration abolishes repressor binding activity. with a lysogen of the tet promoter-lacZ fusion phage XRT301. Repression of ,-galactosidase DISCUSSION was observed in the presence of a plasmid, such A number of regulatory proteins have been as pRT241, which encoded the tet repressor shown to bind specifically to DNA sequences (Table 1). The introduction of a multicopy plas- with dyad symmetries (3, 8, 14). In the present mid containing the tet control region into this report, the tet repressor was shown to bind to strain resulted in a derepressed expression of the two regions of dyad symmetry that lie within lacZ due to the competition of the multiple the tet control region. The plasmids which con- operators for binding of the tet repressor. Thus, tained deletions of 01 had a higher level of the plasmid pRT301 caused a large elevation in derepression than did the plasnlids which had the level of P-galactosidase activity. It is inter- deletions of 02. This suggests that 02 has a esting to note that plasmid pBR322 caused a higher affinity for repressor.

REPRESSOR 0 1 02 RESISTANCE XboI ~315~ 317-1 323-i 320~ _ _ SalI TCTAGACATCATTAATTCCTAATTTTTGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAMTGAATAGTTCGTCGAC AGATCTGAGTMTT AGGTT AAC GGGA TA9TCTCAATAAAATGGTGAGGGATAGTCACTATCTCTTTTCACTTTACTTATCAAGCAGCTG 336 L339 333 L331-332 FIG. 3. DNA sequence of the tet control region and deletions. The transcription start sites are shown by the arrows. The two regions of dyad symmetry, 01 and °2, are indicated. / VOL.V156,5tet1983 REPRESSOR BINDING SITES 1191 It has been reported (9, 11) that the tet control 70:3581-3584. 9. Hillen, W., G. Klock, I. Kaffenberger, L. V. Wray, Jr., region stoichiometrically binds four tet repres- and W. S. Reznlkoff. 1982. Purification of the tet repressor sor molecules. Since repressor binds to two sites and tet operator from the transposon TnlO and character- within this region, this suggests that each opera- ization of their interaction. J. Biol. Chem. 257:6605-6613. tor binds two repressor molecules, and thus, the 10. Hlien, W., and K. Schoilmeler. 1983. Nucleotide sequence of the TnIO encoded tetracycline resistance gene. functional form of the tet repressor is a dimer. Nucleic Acids Res. 11:525-539. The multiple operators at OR and OL in phage 11. HDllen, W., and B. Unger. 1982. Binding offour repressors lambda are known to bind dimers of the cI and to double-stranded tet operator region stabilizes it against cro repressors (14). thermal denaturation. Nature (London) 297:700-702. 12. Humphreys, G. O., G. A. Wllashaw, and S. E. Anderson. The TnJO tet repressor has a weak affinity for 1975. A simple method for the preparation of large quanti- the tet control region of pBR322. The tetracy- ties of pure plasmid DNA. Biochim. Biophys. Acta cline resistance determinants of TnlO and 383:457-463. pBR322 have been placed in different classes 13. Izaki, K., K. Kucki, and K. Arhma. 1966. Specificity and mechanism of tetracycline resistance in a multiple drug- based upon their different levels of resistance to resistant strain of Escherichia coli. J. Bacteriol. 91:628- tetracycline analogs and by DNA-DNA hybrid- 633. ization experiments (22). In spite of this, it has 14. Johnson, A. D., A. R. Poteete, G. Lauer, R. T. Sauer, been noted that these two regulatory regions G. K. Ackers, and M. Ptashne. 1981. Lambda repressor and cro-components of an efficient molecular switch. have significant sequence homology (4). The Natuie (London) 294:217-223. work presented here shows that there is some 15. Jorgensen, R. A., and W. S. Rezaikof. 1979. Organization weak recognition between the regulatory ele- of structural and regulatory genes that mediate tetracy- ments of these two different resistance determi- cline resistance in transposon TnlO. J. Bacteriol. 138:705- 714. nants. 16. Kleckner, N., R. Chan, B. K. Tye, and D. Botstein. 1975. ACKNOWLEDGMENTS Mutagenesis by insertion of a drug resistance element carrying an inverted repetition. J. Mol. Biol. 97:561-575. We thank R. Johnson, L. Munson, M. Peterson, and J. Yin 17. Levy, S. B., and L. McMurry. 1978. Probing the expres- for many useful discussions and technical advice, and S. sion of plasmid-mediated tetracycline resistance in Esche- Stibitz for critically reading the manuscript. richia coli, p. 177-180. In D. Schlessinger (ed.), Microbi- This work was supported by Public Health Service grant ology-1978. American Society for Microbiology, GM19670 from The National Institutes of Health and by grant Washington, D.C. PCM7910686 from the National Science Foundation. L.V.W. 18. Mandel, M., and A. HIga. 1970. Calcium-dependent bacte- was supported by Public Health Service training grant riophage DNA infection. J. Mol. Biol. 53:159-162. GM07215 from the National Institutes of Health. 19. Marusyk, R., and A. Sergeant. 1980. A simple method for dialysis of small volume samples. Anal. Biochem. LITERATURE CITED 105:403-404. 1. Ball, P. R., S. W. Shales, and I. Chopra. 1980. Plasmid- 20. Maxam, A. M., and W. Gilbert. 1980. Sequencing end- mediated tetracycline resistance in Escherichia coli in- labeled DNA with base-specific chemical cleavages. volves increased efflux of the antibiotic. Biochem. Methods Enzymol. 65:499-560. Biophys. Res. Commun. 93:74-81. 21. McMurry, L., R. E. Petrucci, Jr., and S. B. Levy. 1980. 2. Beck, C. F., R. Mutzel, J. Barb*, and W. Miller. 1982. A Active efflux of tetracycline encoded by four genetically multifunctional gene (tetR) controls TnlO-encoded tetra- different tetracycline resistance determinants in Esche- cycline resistance. J. Bacterial. 150:633-642. richia coli. Proc. NatI. Acad. Sci. U.S.A. 77:3974-3977. 3. Bennett, G. N., M. E. Schweingruger, K. D. Brown, C. 22. Mendez, B., C. Tachibana, and S. B. Levy. 1980. Hetero- Squhres, and C. Yanofsky. 1976. Nucleotide sequence of geneity of tetracycline resistance determinants. Plasmid region preceding trp mRNA initiation site and its role in 3:99-108. promoter and operator function. Proc. NatI. Acad. Sci. 23. Messing, J., and J. Viefra. 1982. A new pair of M13 U.S.A. 73:2351-2355. vectors for selecting either DNA strand of double-digest 4. Bertrand, K. P., K. Postle, L. V. Wray, Jr., and W. S. restriction fragments. Gene 19:269-276. Reznikoff. 1983. Overlapping divergent promoters control 24. MDlkr, J. H. 1972. Experiments in molecular genetics. expression of TnWO tetracycline resistance. Gene 23:149- Cold Spring Harbor Laboratory, Cold Spring Harbor, 156. N.Y. 5. BolHvar, F., R. L. Rodriguez, P. J. Green, M. C. Bedach, 25. Sanger, F., S. Nlcklen, and A. R. Coulson. 1977. DNA H. L. Heyneker, H. W. Boyer, J. H. Crosa, and S. Falkow. sequencing with chain-terminating inhibitors. Proc. Natl. 1977. Construction and characterization of new cloning Acad. Sci. U.S.A. 74:5463-5467. vehicles. II. A multi-purpose cloning system. Gene 2:95- 26. Wray, L. V., Jr., R. A. Jorgensen, and W. S. Reznikoff. 133. 1981. Identification of the tetracycline resistance promot- 6. Chang, A. C. Y., and S. N. Coben. 1978. Construction er and repressor in transposon TnIO. J. Bacteriol. and characterization of amplifiable multicopy DNA clon- 147:297-304. ing vehicles derived from the P15A cryptic miniplasmid. J. 27. Yang, H., G. Zubay, and S. B. Levy. 1976. Synthesis of an Bacteriol. 134:1141-1156. R plasmid protein associated with tetracycline resistance 7. Coleman, D. C., and T. J. Foster. 1981. Analysis of the is negatively regulated. Proc. NatI. Acad. Sci. U.S.A. reduction in expression of tetracycline resistance deter- 73:1509-1512. mined by transposon TnlO in the multicopy state. Mol. 28. Zupancic, T. J., S. R. King, K. Z. Pogue-Geile, and S. R. Gen. Genet. 182:171-177. Jaskunas. 1980. Identification of a second tetracycline- 8. Gilbert, W., and A. Maxam. 1973. The nucleotide se- inducible polypeptide encoded by TnlO. J. Bacteriol. quence of the lac operator. Proc. NatI. Acad. Sci. U.S.A. 144:346-355.