Gene, 23 (1983) 149-156 149 Elsevier Overlapping divergent promoters control expression of TnlO tetracycline resistance (DNA sequence; operator; repressor; regulatory region; dyad symmetry; plasmid pBR322; Sl nuclease mapping) Kevin P. Bertrand *, Kathleen Posh, Lewis V. Wray Jr. ** and William S. Reznikoff ** Department of Microbiology, University of California, Irvine, CA 92717 (U.S.A.) Tel. (714) 833- 6115, and ** Depart- ment of Biochemistry, University of Wisconsin, Madison, WI 53706 (U.S.A.) Tel. (608) 262 - 3608 (Received February 7th, 1983) (Accpeted February l&h, 1983) SUMMARY We have previously examined the genetic organization and regulation of the TnZO tetracycline-resistance determinant in Escherichia coli K-12. The structural genes for retA, the TnlO tetracycline-resistance function, and for tetR, the TnlO lef repressor, are transcribed in opposite directions from promoters in a regulatory region located between the two structural genes. Expression of both t&I and t&R is induced by tetracycline. Here we report the DNA sequence of the TnlO tet regulatory region. The locations of the tetA and tetR promoters within this region were defined by Sl nuclease mapping of the 5’ ends of in vivo tet RNA. The t&4 and tetR promoters overlap; the transcription start points are separated by 36 bp. We propose that two similar regions of dyad symmetry within the TnlO tet regulatory region are operator sites at which tet repressor binds to tet DNA, thereby in~biting transcription initiation at the ietA and tetR promoters. The TnlO ret regulatory region and the pBR322 tet regulatory region show significant DNA sequence homology (53%). INTRODUCTION tance (Franklin, 1967; Robertson and Reeve, 1972). Although the mechanism of Tc resistance is The transposable element TnZO determines not completely understood, recent studies indicate high-level Tc resistance in E. coii and other enteric that active efflux of Tc is a major component of bacteria (Foster et al., 1975; Kleckner et al., 1975). the resistance mechanism (MeMurray et al., 1980; Expression of TnZO Tc resistance is regulated; Ball et al., 1980). The TnZO Tc resistance determi- exposure of resistant bacteria to subinhibitory nant (tet) directs the synthesis of two proteins, a levels of Tc induces maximal expression of resis- 36-kDal membrane protein that is essential for Tc resistance (Levy and McMurray, 1974; Levy et al., 1977, Jorgensen and Reznikoff, 1979) and a 25-kDa * Address correspondence and reprint requests to: Kevin P. Bertrand. repressor protein that, in the absence of Tc, in- Abbreviations: bp, base pairs; kDa1, kilodaltons; Tc, tetra- hibits synthesis of the 36-kDa resistance protein cycline. (Yang et al., 1976; Wray et al., 1981). The repres- 0378-l 119/83/SO3.~ @ 1983 Elsevier Science Publishers B.V. 150 sor protein also negatively regulates its own HincII site (K.P. Bertrand, L.V. Wray Jr. and W.S. synthesis (Wray et al., 1981; Beck et al., 1982). Reznikoff, in preparation); similar experiments in- The structural genes for the 36kDal and 25-kDa1 dicate that the tetR promoter and operator(s) are proteins, designated tetA and fetR, respectively, within a 451-bp Ah1 restriction fragment that have been localized within an approx. 2200-bp spans the HincII site (K.P. Postle, T. Nguyen and region of TnlO (Jorgensen and Reznikoff, 1979; K.P. Bertrand, in preparation). (v) Finally, binding Coleman and Foster, 1981); genetic analyses sug- studies with purified tetR repressor indicate that gest that tetA and tetR are transcribed from diver- the ter operator(s) are within a 287-bp AluI-HaeIII gent promoters located between the two genes restriction fragment that spans the H&c11 site (Wray et al., 1981). Here we report the DNA (Hillen et al., 1982). sequence of the region that contains the tetA and tetR promoters and the operator sites(s) at which tetR repressor acts. Several lines of evidence suggest that the tetA MATERIALS AND METHODS regulatory region and the tetR regulatory region are located in the immediate vicinity of a HincII (a) DNA sequencing restriction site at the junction of 695-bp and 1275- bp HincII restriction fragments (Fig. 1): (i) Dele- The DNA sequence of the let regulatory region tions of the region to the right of the H&II site of plasmid pRT29 (Jorgensen and Reznikoff, 1979) do not appear to alter the tetR structural gene, was determined by the procedures of Maxam and although these deletions influence the level of tetR Gilbert (1980). pRT29 contains a single Tn 10 Hpa I expression (Wray et al., 1981). (ii) Deletions of the fragment that is comprised of 695-bp and 1275-bp region to the left of the HincII site do not appear HincII fragments (Fig. 1); the plasmid has a unique to alter the t&A structural gene, although these X&I site within the tet regulatory region. Follow- deletions, likewise, influence the level of tetA ex- ing treatment by bacterial alkaline phosphatase, pression (Wray et al., 1981). (iii) The HincII site is the 5’ ends of X&I-linearized plasmid DNA were partially protected from HincII cleavage by puri- labeled with T4 polynucleotide kinase and [y- fied RNA polymerase (Jorgensen and Reznikoff, 32P IA TP. The 3’ ends of XbaI-linearized plasmid 1979) and purified tetR repressor protein (Hillen DNA were labeled with the Klenow fragment of et al., 1982). (iv) Genetic fusions of the tetA regu- E. coli DNA polymerase I and [ cr- 32P ]dATP in the latory region to the iacZ structural gene indicate presence of dCTP, dGTP, and dTTP. Following that the tefA promoter and operator(s), are within BspI digestion, the labeled fragments were isolated a 158-bp TaqI restriction fragment that spans the and subjected to sequence analysis. The sequence in the region of the XbaI site (bp 60-65, Fig. 2) was verified by analysis of the BfpI-HincIf frag- ment labeled at its HincII end (bp 87-92). TnlO (b) Sl nuclease analysis of tet RNA 1275 891 II 2790 d * E. cofi K- 12 C600 harboring the Tn 10 tet WR WA plasmid pRT29 was grown in LB broth containing Reprsssor lbswsnca 10 pg/ml tetracycline hydrochloride (Sigma). LB Fig. 1. Physical maps of the TnlO element. (Top) TnlO consists of two 1400-bp inverted repeat sequences (IS10 left and ISlO broth contained per liter: 10 g tryptone (Difco), 8 right) flanking a 6400-bp central region (Halling et al., 1982). g NaCl and 5 g yeast extract (Difco). At an Asso of (Bottom) The 2790-bp Rg/II fragment within the central region 0.35 the cells were rapidly chilled and, following of TnlO spans tbe terR repressor and tetA resistance genes; terR addition of 20 ,ccg/ml chloramphenicol (Sigma), is located within the 695-bp HincII fragment; retA is located harvested by centrifugation. The cells were lysed largely within the 1275bp HincII fragment; fetR and retA are transcribed from promoters located near the HincII site be- by addition of 300 pg/ml lysozyme (Sigma) and tween the structural genes. 1% sodium dodecyl sulfate, the lysate was ex- 151 tracted with phenol, and nucleic acids in the aque- RESULTS ous phase were precipitated with ethanol. The DNA probes for tetA and tetR RNA were pre- We determined the DNA sequence of a 201-bp pared by digestion of pRT29 DNA with XbaI + region spanning the HincII restriction site in the NcoI and HinfI, respectively. The 136-bp XbaI- tet regulatory region, including the 158-bp Z’uqI NcoI fragment and the 1130-bp HinfI fragment restriction fragment that, on the basis of genetic were eluted from 8% polyacrylamide gels, treated evidence, contains the tetA promoter and opera- with bacterial alkaline phosphatase (Bethesda Re- tor(s) (Fig. 2). The 5’ ends of tetA and tetR RNA search Laboratories) and 5’-end-labeled with [y- were localized within this region by Sl nuclease 32P]ATP (3000 Ci/mmol, Amersham). The DNA mapping (Fig. 3) (Berk and Sharp, 1977; Favaloro strands of the labeled fragments were separated in et al., 1980; Treisman and Kamen, 1981). Total an 8% polyacrylamide gel as described by Maxam unlabeled RNA was isolated from E. cofi strain and Gilbert (1980), except that the sample buffer C600 containing plasmid pRT29, then annealed to consisted of 10 mM HEPES, pH 8, 0.5% xylene single-stranded 5’-end-labeled DNA nrobes that cyanol, and 0.5% bromphenol blue in 98% de- span the tet regulatory region. The RNA-DNA ionized formamide. The separated strands were hybrids were treated with Sl nuclease, and the identified by DNA sequencing. Annealing of un- DNA components of the Sl-resistant hybrids were labeled RNA to 5’-end-labeled single-stranded sized on polyacrylamide gels (Fig. 3). The slight DNA and Sl nuclease treatment were performed heterogeneity (2-3 bases) in the lengths of the as described by Favaloro et al. (1980) and Treis- Sl-resistant DNAs may reflect actual heterogene- man and Kamen (198 1). In particular, the hybridi- ity in the 5’ ends of the tet RNAs. However, it zations were at 30°C for 16 h, and the hybrids seems more likely that this heterogeneity is prim- were treated with 600 units/ml Sl nuclease (Sigma) arily an artifact of the Sl nuclease procedure, since at 15’C for 1 h. The Sl nuclease-resistant DNA the relative amounts of the Sl-resistant fragments and sequence reactions of appropriate 5’-end- vary with the concentration of Sl nuclease em- labeled fragments were run in parallel on thin 8% ployed. Assuming that the 5’ ends of the RNAs polyacrylamide/urea gels (Maxam and Gilbert, detected by the Sl nuclease procedure do define 1980). transcription initiation sites, the principal right- _GlL __H_i_n_f-l - 20 _A-l-u-l -! ! !c! 40 60- --ma 1 TCGATTCCGACCTCATTAAGCAGCTCTAATGCGCTGTTAATCACTTTACTTTTATCTAATCTAGACATCATT AGCTAAGGCTGGAGTAATTCGTCGAGATTACGCGACGCGACAATTAGTGAAATGAAAATAGATTAGATCTGTAGTAA I le Gly Val Glu Asn Lcu Lw Glu Lar Ala Ser Asn I le Val Lys Ser Lys Asg Lar Aq Ser Met -35 -10 RBS tat A &I _l_H-i_n_c-I-1- ’ 100 -1120 1 AATTCCTAATTTTTGTTGACACTCTATCATTGATAGAGTTATTTTACCACTCCCTATCA~TGATAGAGAAAA TTAAGGATTAAAAACAACTGTGAGATAGTAACTATCTCAATAAAATGGTG~G~C~T~TTT 1 1 I 1 -- tet R RBS -10 -35 160 18) m kt kn Ser Ser Thr Lys l ie Ala Lar Vai I le Tt !r Leu Lar kp Ala t4zt GTGAAATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGG CACTTTACTTATCAAT~~TGTTTC_~_C-G-T-A ACCATTAA-T_G-C-A ATGAGCTACGGTACC -_- ____-_- Tad Nm l Fig.