Clinical, Radiologic, and Genetic Features in Blepharophimosis, Ptosis, and Epicanthus Inversus Syndrome in the Indian Population

Home , Blepharophimosis

Clinical and Epidemiologic Research Clinical, Radiologic, and Genetic Features in Blepharophimosis, Ptosis, and Epicanthus Inversus Syndrome in the Indian Population

Bhavna Chawla,1 Yogesh Bhadange,1 Rima Dada,2 Manoj Kumar,2 Sanjay Sharma,3 Mandeep S. Bajaj,1 Neelam Pushker,1 Mahesh Chandra,1 and Supriyo Ghose1

1Oculoplastics, Orbit, and Ocular Oncology Service, Dr. Rajendra Prasad Centre for Ophthalmic Sciences, All India Institute of Medical Sciences, New Delhi, India 2Laboratory for Molecular Reproduction and Genetics, Department of Anatomy, All India Institute of Medical Sciences, New Delhi, India 3Department of Radio-diagnosis, All India Institute of Medical Sciences, New Delhi, India

Correspondence: Bhavna Chawla, PURPOSE. To study the clinical, radiologic, and genetic features in Indian Blepharophimosis, Dr. Rajendra Prasad Centre for ptosis, and epicanthus inversus syndrome (BPES) patients. Ophthalmic Sciences, All India Institute of Medical Sciences, New METHODS. A total of 33 clinically well characterized BPES cases who presented between 2009 Delhi 110029, India; bhavna2424@ to 2011 were recruited. Clinical evaluation consisted of ophthalmic and orthoptic hotmail.com. examination. For orbital indices, computed tomography (CT) scan of orbits was performed. Submitted: February 1, 2013 Genetic studies included cytogenetic analysis and molecular analysis of FOXL2 gene. Accepted: March 13, 2013 RESULTS. Significant clinical findings included a high incidence of refractive error in 94%, Citation: Chawla, B, Bhadange Y, Dada amblyopia in 60%, and strabismus in 40% of BPES cases. Orbital radiologic indices on CT scan R, et al. Clinical, radiologic, and in BPES were found to be comparable to the control group. On karyotyping, 8 out of 33 (24%) genetic features in blepharophimosis, cases harbored chromosomal abnormalities. These abnormalities included 46,XY;del(3qter), ptosis, and epicanthus inversus 46,XY;del(3q26.3), 46,XX;del(3q24-25), and 46,XY;del(3q26qter). On molecular analysis, a syndrome in the Indian population. novel mutation consisting of heterozygous substitution at c1635 that replaced cytosine by Invest Ophthalmol Vis Sci. thymidine was detected. 2013;54:2985–2990. DOI:10.1167/ iovs.13-11794 CONCLUSIONS. To the best of our knowledge, this is the first study on clinical features in BPES patients of Indian origin. A high incidence of refractive error, strabismus, and amblyopia was found in BPES cases. Orbital imaging confirmed that clinical features are limited to soft tissue abnormalities, with no underlying bony changes. Cytogenetic studies showed that most chromosomal abnormalities in the Indian population are in the region of the long arm of chromosome 3. Results of molecular analysis indicate that there may be loci other than the FOXL2 gene, which are affected in BPES cases. Our study expands the existing mutation spectrum of FOXL2 gene. Keywords: BPES, Indian, clinical features, genetics, FOXL2 gene

lepharophimosis, ptosis and epicanthus inversus syndrome a single exon gene of 2.7 kb that encodes a protein of 376 B(BPES; OMIM [Online Mendelian Inheritance in Men] amino acids, containing a 110 amino acid DNA-binding fork 110100) is a rare genetic condition, which generally displays head domain and a polyalanine (poly-Ala) tract of 14 residues an autosomal dominant inheritance pattern and predominantly of unknown function. FOXL2 gene is involved in the synthesis affects the ocular adnexa.1 The global prevalence of BPES has of fork head transcription factor, expressed predominantly in been estimated to be approximately 1 in 50,000.2 It is the developing eyelid and in the ovary.8,9 The protein characterized by the presence of a narrowed horizontal localization of FOXL2 has been shown to be nuclear, which palpebral aperture, ptosis, epicanthus inversus, and telecan- is in line with its function as a transcription factor.10,11 The thus.1 Other ophthalmic associations include raised arched biologic role and importance of FOXL2 during folliculogenesis eyebrows, abnormalities of the eyelid margin and lacrimal in vivo evolved from studies in transgenic mice.12,13 The drainage apparatus, strabismus, microphthalmos, and optic disc evolutionary conservation and expression pattern of FOXL2 colobomas.3,4 Two types of BPES have been classiﬁed: Type I is suggests that it is the earliest known marker of ovarian a complex eyelid malformation associated with premature differentiation in mammals and plays a role in ovarian somatic ovarian failure (POF) whereas in Type II cases, only the eyelid cell differentiation and in further follicular development and defect is present.5 Nonocular associations include a broad ﬂat maintenance.10,11 It is estimated that up to 75% of BPES nasal bridge, high arched palate, protruding or cup shaped ears, affected individuals have FOXL2 mutations. However, 25% female infertility (ovarian failure), and cardiac defects.3,4,6 cases may not have a known affected family member, which Mutation in the FOXL2 gene located on the chromosome may represent a new mutation or minimal expression in 3q23 region has been described as a cause of BPES.7 FOXL2 is affected relatives.4,14

Downloaded from jov.arvojournals.org on 10/02/2021 Clinical, Radiologic, and Genetic Features in Indian BPES IOVS j April 2013 j Vol. 54 j No. 4 j 2986

BPES is a rare disease and, as far as we are aware, clinical For cytogenetic studies, chromosome analysis was done to features in BPES cases of Indian origin have not been reported. identify any numerical or structural chromosomal aberra- Although generally believed to be a soft tissue disorder, tions.19,20 Lymphocyte cultures were set up and chromosomes radiologic biometric indices of the orbit in BPES patients have were analyzed by G-banding. G-Banded metaphase images not been previously evaluated. Also, there have been very few were captured with a Zeiss microscope (BX-51 Microscope; genetic studies so far on the pattern of genetic abnormalities Olympus, Tokyo, Japan) and were analyzed using Cytovision found in BPES cases in the Indian population.15–17 Therefore, 3.7 software (Applied Imaging Corp., Santa Clara, CA). At least we undertook a prospective study at our center to evaluate 50 metaphases in each patient were analyzed and karyotyped. BPES patients with respect to clinical, genetic, and imaging DNA isolation, PCR amplification, and sequence analysis findings. was performed. Genomic DNA was extracted from whole blood samples using the organic method described by Sambrook et al. with some modifications.21 The exon–intron MATERIALS AND METHODS regions of the FOXL2 were amplified in BPES patients. PCR amplifications for all primer sets (Table 1) were performed in a Patients with a clinical diagnosis of BPES who presented to 25-lL volume containing 1.0 lL of 20 mM stock solution for the Oculoplastics service of Dr. Rajendra Prasad Centre for each primer (Eurofins Genomics India Pvt Ltd., Bangalore, Ophthalmic Sciences, All India Institute of Medical Sciences, India), 100 ng of genomic DNA, 1 unit of Taq polymerase New Delhi between 2009 and 2011 were recruited into the (Bangalore Genei, Bengaluru, Karnataka, India), 0.1 mM study, after obtaining informed consent. The study followed deoxynucleotide triphosphate (dNTP), and 4 lL of 10X PCR the tenets of the Declaration of Helsinki and prior approval buffer (with 15 mM MgCl2). Amplified PCR products were from the ethics committee of All India Institute of Medical purified using a gel/PCR DNA fragments extraction kit Sciences was obtained. For the clinical study, the control (Geneaid Biotech Ltd., Sijhih City, Taiwan). Purified PCR group consisted of age-matched individuals from a normal products were sent for sequencing to Molecular Cloning population. For radiologic study, the control group consisted Laboratories (South San Francisco, CA). All fragments were of age-matched individuals who were referred to us for head sequenced in both forward and reverse directions for and orbital computed tomography (CT) scan for other confirmation of any nucleotide variation in cases and controls indications, in which the bony orbit was within normal limits. and compared with the Human Genome Reference Sequence Clinical evaluation consisted of detailed ocular examina- (NC_000003.11) provided by the National Center for Biotech- tion, which included assessment of visual acuity, refraction nology Information (NCBI), using ClustalW2 (multiple se- under cycloplegia, measurement of horizontal and vertical quence alignment program for DNA; European Bioinformatics palpebral apertures, levator function, anterior segment, and Institute, Wellcome Trust Genome Campus, Hinxton, Cam- fundus evaluation. Orthoptic evaluation consisted of assess- bridge, UK). ment of ocular alignment, ocular movements, and presence of Computational assessment of missense mutations was amblyopia. Amblyopia was defined as Snellen visual acuity of done. Two homology based programs, Polymorphism Pheno- less than 20/40, or an interocular difference in visual acuity of typing (PolyPhen), available in the public domain at http:// more than 1 Snellen line at the time of presentation. genetics.bwh.harvard.edu/pph/, and Sorting Intolerant From Ophthalmic investigations included videokeratography (Carl Tolerant (SIFT) analysis tool, available in the public domain at Zeiss Atlas-9000; Carl Zeiss Meditec, Jena, Germany) and http://sift.jcvi.org/, were used to predict the functional central corneal thickness (Pacscan 300p; Sonomed Inc., Lake impact of missense changes identified in this study. PolyPhen Success, NY). Systemic evaluation consisted of a detailed structurally analyzes an amino acid polymorphism and history including developmental history, general physical predicts whether that amino acid change is likely to be examination, and complete systemic examination for associ- deleterious to protein function.22,23 PolyPhen scores of ated systemic findings. greater than 2.0 indicate the polymorphism is probably Orbital imaging was performed using noncontrast Comput- damaging to protein function. Scores of 1.5 to 2.0 are ed Tomography of the head and orbit in the department of possibly damaging, and scores of less than 1.5 are likely Radiodiagnosis of our Institute. In all cases, 0.6- to 2-mm benign. SIFT is based on the premise that protein evolution is sections were obtained parallel to the infraorbital meatal correlated with protein function. Positions with normalized plane.18 Orbital biometry indices (Fig. 1) were studied in cases probabilities less than 0.05 are predicted to be deleterious and and controls. those greater than or equal to 0.05 are predicted to be tolerated in case of SIFT. The main outcome measures of our study were compar- ison of clinical parameters and radiologic biometric measure- ments between BPES cases and age-matched controls, and results of cytogenetic and molecular analysis. Appropriate statistical analysis was performed using SPSS (version 14.0; SPSS Inc., Chicago, IL). Quantitative data was classified as parametric and nonparametric data. Student’s t-test was used for parametric and Mann-Whitney U test was used for nonparametric data. v2 test or Fischer test was used for qualitative data. A P value less than or equal to 0.05 was considered significant.

FIGURE 1. CT scan Images of Orbit Showing Biometric Indices: (A) Interpupillary distance (IPD); Zygomatic – Zygomatic distance (ZZD); RESULTS Interorbital distance in two different areas (IOD 1; IOD 2); (B) Optic Nerve – optic nerve distance (NN); Optic Nerve – optic canal distance A total of 33 clinically well characterized BPES cases were (ON); Optic Canal – optic canal distance (CC). enrolled in the study.

Downloaded from jov.arvojournals.org on 10/02/2021 Clinical, Radiologic, and Genetic Features in Indian BPES IOVS j April 2013 j Vol. 54 j No. 4 j 2987

TABLE 1. Primer Sequence for Exon of BPES Gene

Annealing Product Primer Name Primer Sequence Temp, 8C Size, bp

FOXL2_1_AF 50GACTTGGAGATGAACTCGCC30 57 893 FOXL2_1_AR 50AGTAGTTGCCCTTGCGCTC30 FOXL2_1_BF 50CGAAGTTCCCGTTCTACGAG30 59 839 FOXL2_1_BR 50GCTGTCGTGGTCCCAGTAAG30 FOXL2_1_CF 50AGCTCAGCCCTGCCAGC30 58 863 FOXL2_1_CR 50AAGCGACGGGACTGATAGC30 FOXL2_1_DF 50GTTCAGAAGCCGCTTGCC30 57 945 FOXL2_1_DR 50CCGGTTGCTCTCAATCTTTG30

Clinical Results bilateral ptosis and two cases (6%) had unilateral ptosis. Ptosis was severe in 28 cases (85%) and moderate in five cases (15%). The mean age in BPES cases was 12 6 8.4 years (range, 4–32 Associated lid anomalies were noted in five patients (15%). years), with the majority of cases between 4 to 8 years. There These included lower lid entropion on the medial side in four were 16 (48%) males and 17 (52%) females. All females were in cases, and a lower lid ectropion in one case (Fig. 2). the prepubertal age group. Of 33 patients, 31 cases (94%) had Refractive errors were detected in 31 patients (94%). The most common refractive errors included simple hyperopia in 12 cases (36%), and a with-the-rule astigmatism in 12 cases (36%). The incidence of amblyopia in BPES was 60% (n ¼ 20). Of these, 15 cases (45%) had bilateral amblyopia and 5 (15%) cases had unilateral amblyopia. Strabismus was noted in 13 cases (40%). Of these, 10 cases (30%) had esotropia and 3 cases (10%) had exotropia. Other clinical parameters that were evaluated are summarized in Table 2. A statistically significant difference was noted between cases and controls in the mean value of horizontal palpebral aperture (P ¼ 0.0001), vertical palpebral aperture (P ¼ 0.0001), and intercanthal distance (P ¼ 0.0001). There were no statistically significant differences between cases and controls in the mean values of keratometry, corneal thickness, and intraocular pressure (IOP) (Table 2).

Radiologic Results FIGURE 2. Clinical photograph of a patient with BPES showing lower lid ectropion in the left eye, with asymmetric ptosis. The results of orbital biometric indices as determined on CT scan are summarized in Table 3. There was no statistically signiﬁcant difference between cases and controls in the mean values of interpupillary distance and interorbital distance. Similarly, other indices such as zygomatic–zygomatic bone distance, optic nerve–optic nerve distance, optic canal–optic canal distance, and optic nerve–optic canal distance were also found to be comparable between cases and controls.

Genetic Results A total of 33 BPES cases (27 proband and 6 family members) and age-matched controls underwent cytogenetic analysis to detect any chromosomal abnormality. Of these, 24 cases were sporadic and three probands had a positive family history. These three patients belonged to different families, with two affected members apart from proband in each family. There was no history of consanguinity. Eight out of 33 cases (24%) harbored chromosomal abnormalities on cytogenetic analysis. Among cytogenetically positive cases, three cases were sporadic and ﬁve were familial. All deletions were found on the long arm of chromosome 3. Four patterns of deletions were observed (Table 4, Fig. 3). The ﬁrst pattern showed a deletion in the terminal region of the long arm of chromosome 3 (46, XYdel 3qter). This pattern was seen in a sporadic case. The second pattern had a deletion on the long arm of chromosome 3 in region 26.3 (46, XYdel 3q26.3). This pattern was seen in

FIGURE 3. G-banded images showing different abnormalities in two familial cases, with affected father and daughter. The third chromosome 3. (A) 46,XYdel (3q 26.3), (B) 46,XXdel(3q24-25), (C) pattern had a deletion on the long arm of chromosome 3 in the 46,XYdel(3q26-qter), and (D) 46,XYdel(3qter). region 24-25 (46, XXdel 3q24-25). This pattern was seen in one

Downloaded from jov.arvojournals.org on 10/02/2021 Clinical, Radiologic, and Genetic Features in Indian BPES IOVS j April 2013 j Vol. 54 j No. 4 j 2988

TABLE 2. Clinical Parameters in BPES Cases and Controls

Parameters Cases, Mean 6 SD Controls, Mean 6 SD P Value

Horizontal palpebral aperture OD, mm 22.6 6 2.2 26.9 6 1.1 0.0001 Horizontal palpebral aperture OS, mm 22.9 6 1.9 26.9 6 1.1 0.0001 Vertical palpebral aperture OD, mm 4.9 6 1.1 8.5 6 0.5 0.0001 Vertical palpebral aperture OS, mm 5.2 6 1.4 8.5 6 0.5 0.0001 Intercanthal distance, mm 33 27 0.0001 Keratometry 1 OD, D 43.1 6 2.1 42.7 6 1.5 0.22 Keratometry 2 OD, D 44.7 6 2.1 43.3 6 1.6 0.01 Keratometry 1 OS, D 43.2 6 2.0 42.7 6 1.6 0.19 Keratometry 2 OS, D 44.3 6 1.9 43.7 6 1.5 0.11 Central corneal thickness OD, lm 551.7 6 35.1 541.7 6 32.2 0.17 Central corneal thickness OS, lm 557.0 6 40.1 543.4 6 28.8 0.11 IOP OD, mm Hg 13.8 6 1.4 13.9 6 1.4 0.31 IOP OS, mm Hg 14.8 6 1.2 14.2 6 1.5 0.33 D, diopters; OD, right eye; OS, left eye. P values in bold are statistically signiﬁcant.

sporadic and three familial cases with affected father, son, and region of the FOXL2 gene. This change was heterozygous daughter. The fourth pattern also had a deletion on the long c1635 cytosine > thymidine substitution that replaced cytosine arm of chromosome 3 near the terminal region (46, XYdel by thymidine in the affected individual (Fig. 4). 3q26-qter). This pattern was seen in a sporadic case. Patients who were cytogenetically normal (n ¼ 25) under- DISCUSSION went molecular analysis for detection of FOXL2 sequence variations. Of these, one patient with a positive family history BPES is a complex eyelid malformation characterized by four and affected sibling showed a mutation located in the 30 UTR cardinal ocular features, which include blepharophimosis, ptosis, epicanthus inversus, and telecanthus. This prospective study was undertaken to evaluate the clinical features, TABLE 3. Radiologic Parameters in BPES Cases and Controls radiologic findings, and genetic profile of BPES patients in Cases, mm Controls, mm the Indian population. Parameters Mean 6 SD Mean 6 SD P Value The most common age group at the time of diagnosis in the current study was 4 to 8 years. This finding is consistent with IPD 55.4 6 4.4 55.5 6 3.9 0.51 studies from other parts of the world that have reported that IOD 1 23.3 6 3.2 23.3 6 2.4 0.47 the majority of cases present before 8 years of age. In our IOD 2 24.7 6 3.9 24.2 6 2.9 0.33 series, 52% of affected individuals were females and 48% were ZZD 83.7 6 7.6 82.7 6 6.9 0.31 males. Previous investigators have reported an incidence of NN 46.2 6 3.2 46.4 6 2.9 0.57 30% to 54% in males and 46% to 70% in females,1,3,4,6 and our CC 22.9 6 1.5 23.0 6 1.4 0.64 results are within this range. In our patients, a positive family ON OD 25.5 6 2.9 25.5 6 2.8 0.49 history was noted in 9 out of 33 (27%) cases. ON OS 25.6 6 2.9 25.5 6 2.9 0.45 All BPES cases in our study had ptosis, which included severe ptosis in 85% and moderate ptosis in 15% cases. In other studies, severe ptosis has been reported in 60% to 70% cases and moderate ptosis in 30% to 40% cases.1,3,4,6 The incidence of strabismus in BPES cases has been reported as 20% to 55%.1,3,4,6 In our study, strabismus was found in 40% cases, which included esotropia in 30% and exotropia in 10% cases. Although previously described in literature, none of our cases had vertical deviations.1,3,4,6 The incidence of refractive error was 95% in our series, which is significantly higher than the previously reported range of 34% to 70%.1,3,4,6 We found simple hyperopia and astigmatism to be the most common types of refractive error in our patients. Amblyopia screening forms an important part of evaluation in BPES cases because of its high incidence. Previous investigators have reported the incidence of amblyopia in BPES from 39% to 41%.1,3,4,6 Our results show a higher incidence of amblyopia (60%). This could be attributed to a lack of awareness in the general population about the importance of early screening. Interestingly, the incidence of FIGURE 4. FOXL2 Gene Analysis Chromatogram showing a portion of amblyopia was 70% in the strabismus group as compared with FOXL2 gene DNA sequence in an affected and an unaffected individual. 40% in the nonstrabismus group, although the difference was (Top) DNA sequence chromatogram showing the heterozygous c1635 C > T substitution that replaced cytosine by thymidine in the affected not statistically significant (P ¼ 0.3). Previous studies have individual. (Bottom) DNA sequence chromatogram of an unaffected reported that strabismus is a cause of amblyopia in 46% to 67% 1,3,4,6 individual showing wild type C at position c1635. The position of of BPES cases. Severe ptosis is also a known risk factor for mutated (C > T) and wild type nucleotide C in an affected and an the development of amblyopia and we found a higher unaffected individual is indicated in the box. incidence of amblyopia (70%) in cases with severe ptosis.

Downloaded from jov.arvojournals.org on 10/02/2021 Clinical, Radiologic, and Genetic Features in Indian BPES IOVS j April 2013 j Vol. 54 j No. 4 j 2989

TABLE 4. Four Different Patterns of Chromosomal Abnormalities

Chromosomal Abnormalities

Karyotype Pattern 1 Pattern 2 Pattern 3 Pattern 4

46 XX - - 60% - 46 XY 65% 70% - 75% del(3qter) 35% - - - del(3q26.3) - 30% - - del(3q24-25) - - 40% - del(3q26q-ter) - - - 25% Type (number of cases) Sporadic (1) Familial (2) Sporadic (1), familial (3) Sporadic (1)

Furthermore, all cases with amblyopia in the current study had FOXL2 was chosen considering the fact that the maximum associated refractive error. These observations suggest that the sequence variations in BPES have been found in this gene. development of amblyopia in BPES cases is multifactorial and Among all genetic defects found in BPES, an estimated 72% of could be attributed to all three factors (i.e., strabismus, cases are due to intragenic FOXL2 mutations34; 12% of BPES refractive error, and severe ptosis). cases result from deletions involving partial or whole FOXL2 Other clinical parameters that were evaluated included IOP gene deletion,8 and approximately 5% of cases involve and corneal curvature; we studied these parameters because regulatory deletions outside the FOXL2 gene.35 In our study, BPES has been reported to be associated with ocular of 25 cases, one proband and one affected family member associations such as angle dysgenesis, elevated IOP, and showed a positive result. The mutation detected in this irregular astigmatism (Sippel KC, et al. IOVS 2002;43:ARVO E- instance was a novel mutation on FOXL2 gene. The case was Abstract 178).24 None of these parameters showed any heterozygous for this mutation (c1635 cytosine > thymidine) statistically significant difference as compared with controls. and was located in the 30 UTR region of the gene. To the best of Although associated systemic abnormalities such as develop- our knowledge, 18 mutations have been found in the 30 UTR mental delay, growth deficiency, and cleft palate have been region of FOXL2 gene, but the change reported in this study is 25 reported in literature, none of our cases showed any obvious novel. systemic or developmental abnormality. Literature review shows that almost all intragenic mutations Radiologic biometry was undertaken to study the bony in FOXL2 gene identified until date are confined to the single development of the orbit in BPES cases. As far as we are coding exon of FOXL2, which is why it was also selected in our aware, radiologic biometric indices of the orbit have not been study. However, genetic defects in BPES may involve other loci, previously reported in BPES. Although generally believed to and one limitation of our study is that we confined molecular be a soft tissue disorder, bony abnormalities of the orbit have analysis only to FOXL2 gene. The low prevalence of FOXL2 been described in a previous study on BPES patients.26 In a 26 mutation in our patient population could be partly attributed series of 50 BPES cases (which included 44 children), the to a different ethnic population and very few cases with a authors performed CT scan of the orbits and observed that positive family history. Previous genetic studies on Indian BPES BPES may be associated with orbital phimosis (i.e., a deep and patients have been reported from the southern parts of narrow orbit).26 In such cases, they recommended orbital India,15–17 where the population is ethnically different from reconstructive surgery and bone remodeling to enlarge and Northern India and a high number of consanguineous widen the orbital framework and to shorten the orbital marriages are found, resulting in a different mutation cavity.26 A limitation of their study was the absence of a control group to compare the radiologic findings. In our spectrum. In our study, seven out of nine familial cases (77%) study, none of the parameters in BPES cases showed any were found to be positive for genetic defects, which is consistent with western studies in which 72% of clinically statistically significant difference as compared with age- 7 matched controls, thereby confirming that in BPES, it is only diagnosed BPES cases have a mutation in the FOXL2 gene. the soft tissues that are affected and bony development However, the rate of mutation in sporadic cases in our cohort remains within normal limits. The lacrimal gland was normal was only 12.5%, indicating that there may be loci other than in all our BPES cases, although a sporadic case report of BPES the FOXL2 gene, which are affected in BPES patients from and absence of lacrimal gland has been reported in Northern India. Further studies to explore other possible loci literature.27 Recently, magnetic resonance imaging (MRI) which may regulate the development of eyelids in BPES would features of levator palpebrae superioris muscle (LPS) have be required. been reported in a small cohort of BPES cases. In our patients, To summarize, this is a comprehensive study on BPES cases we performed CT scans as it is preferable to MRI to study which reports the clinical, radiologic, and genetic findings in osseous details.28 BPES cases in the Indian population. BPES was found to be Literature review of cytogenetic anomalies in BPES shows associated with a high incidence of refractive error, strabismus, that the cytogenetic rearrangements in BPES mostly consist of and amblyopia. Orbital radiologic indices in BPES cases were interstitial deletions and/or translocations involving the long comparable with the normal population, thereby confirming arm of chromosome 3, similar to those observed in our that the disease is related only to soft tissue developmental study.29–32 Our results are consistent with previously reported abnormality and bony development is essentially normal. This cytogenetic abnormalities in BPES.29–32 A previous study has study showed that most chromosomal abnormalities in the shown linkage of blepharophimosis syndrome in a large Indian Indian population are in the region of the long arm of pedigree to chromosome 7p.33 Patients who had a negative chromosome 3. While our study expands the existing mutation result on cytogenetic analysis in our study underwent further spectrum of FOXL2 gene, there may be loci other than the molecular analysis for detection of the FOXL2 mutation. FOXL2 gene that are involved in BPES cases.

Downloaded from jov.arvojournals.org on 10/02/2021 Clinical, Radiologic, and Genetic Features in Indian BPES IOVS j April 2013 j Vol. 54 j No. 4 j 2990

Acknowledgments the blepharophimosis syndrome (BPES) associated with ovarian dysfunction. Hum Genet. 2007;121:107–112. Supported by All India Institute of Medical Sciences, New Delhi, India. 18. Mafee MF, Pruzansky S, Corrales MM, et al. CT in the evaluation of the orbit and the bony interorbital distance. Disclosure: B. Chawla, None; Y. Bhadange, None; R. Dada, Am J Neuroradiol. 1986;7:265–269. None; M. Kumar, None; S. Sharma, None; M.S. Bajaj, None; N. 19. Benn PA, Perle MA. Chromosome staining and banding Pushker, None; M. Chandra, None; S. Ghose, None techniques. In: DE, Rooney, Czepulkowski BH, ed. Human Cytogenetics: A Practical Approach. Constitutional Analysis. References Oxford, UK: IRL Press Ltd.; 1992:99–129. 20. Sumner AT. The nature and mechanisms of chromosome 1. Beaconsfield M, Walker JW, Collin JR. Visual development in banding. Cancer Genet Cytogenet. 1982;6:59–87. the blepharophimosis syndrome. Br J Ophthalmol. 1991;75: 746–748. 21. Sambrook JFEMT. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring: Harbor Laboratory Press; 1989. 2. Oley C, Baraitser M. Blepharophimosis, ptosis, epicanthus inversus syndrome (BPES syndrome). J Med Genet. 1988;25: 22. Ramensky V, Bork P,Sunyaev S. Human non-synonymous SNPs: 47–51. server and survey. Nucleic Acids Res. 2002;30:3894–3900. 3. Choi KH, Kyung S, Oh SY. The factors influencing visual 23. Sunyaev S, Ramensky V, Koch I, Lathe W 3rd, Kondrashov AS, development in blepharophimosis-ptosis-epicanthus inversus Bork P. Prediction of deleterious human alleles. Hum Mol syndrome. J Pediatr Ophthalmol Strabismus. 2006;43:285– Genet. 2001;10:591–597. 288. 24. Chismire KJ, Witcop GS. Optic nerve hypoplasia and angle 4. Beckingsale PS, Sullivan TJ, Wong VA, Oley C. Blepharophi- dysgenesis in a patient with blepharophimosis syndrome. Am mosis: a recommendation for early surgery in patients with J Ophthalmol. 1994;117:676–677. severe ptosis. Clin Experiment Ophthalmol. 2003;31:138–142. 25. Cunniff C, Curtis M, Hassed SJ, Hoyme HE. Blepharophimosis: 5. De Baere E, Dixon MJ, Small KW, et al. Spectrum of FOXL2 a causally heterogeneous malformation frequently associated gene mutations in blepharophimosis-ptosis-epicanthus inver- with developmental disabilities. Am J Med Genet. 1998;75:52– sus (BPES) families demonstrates a genotype–phenotype 54. correlation. Hum Mol Genet. 2001;10:1591–1600. 26. Krastinova D, Jasinski MA. Orbitoblepharophimosis syndrome: 6. Dawson EL, Hardy TG, Collin JR, Lee JP. The incidence of a 16-year perspective. Plast Reconstr Surg. 2003;111:987– strabismus and refractive error in patients with blepharophi- 999. mosis, ptosis and epicanthus inversus syndrome (BPES). 27. Athappilly GK, Braverman RS. Congenital alacrima in a patient Strabismus. 2003;11:173–177. with blepharophimosis syndrome. Ophthalmic Genet. 2009; 7. Crisponi L, Deiana M, Loi A, et al. The putative forkhead 30:37–39. transcription factor FOXL2 is mutated in blepharophimosis/ 28. Decock CE, De Baere EE, Bauters W, et al. Insights into levator ptosis/epicanthus inversus syndrome. Nat Genet. 2001;27: muscle dysfunction in a cohort of patients with molecularly 159–166. confirmed blepharophimosis-ptosis-epicanthus inversus syn- 8. Beysen D, De Paepe A, De Baere E. FOXL2 mutations and drome using high-resolution imaging, anatomic examination, genomic rearrangements in BPES. Hum Mutat. 2009;30:158– and histopathologic examination. Arch Ophthalmol. 2011; 169. 129:1564–1569. 9. Beysen D, Vandesompele J, Messiaen L, De Paepe A, De Baere 29. Fukushima Y, Wakui K, Nishida T, Ueoka Y. Blepharophimosis E. The human FOXL2 mutation database. Hum Mutat. 2004; sequence and de novo balanced autosomal translocation 24:189–193. [46,XY,t(3;4)(q23;p15.2)]: possible assignment of the trait to 10. Cocquet J, Pailhoux E, Jaubert F, et al. Evolution and 3q23. Am J Med Genet. 1991;40:485–487. expression of FOXL2. J Med Genet. 2002;39:916–921. 30. Fujita H, Meng J, Kawamura M, Tozuka N, Ishii F, Tanaka N. 11. Cocquet J, De Baere E, Gareil M, et al. Structure, evolution and Boy with a chromosome del (3)(q12q23) and blepharophi- expression of the FOXL2 transcription unit. Cytogenet mosis syndrome. Am J Med Genet. 1992;44:434–436. Genome Res. 2003;101:206–211. 31. Jewett T, Rao PN, Weaver RG, Stewart W, Thomas IT, Pettenati 12. Schmidt D, Ovitt CE, Anlag K, et al. The murine winged-helix MJ. Blepharophimosis, ptosis, and epicanthus inversus syn- transcription factor FOXL2 is required for granulosa cell drome (BPES) associated with interstitial deletion of band differentiation and ovary maintenance. Development. 2004; 3q22: review and gene assignment to the interface of band 131:933–942. 3q22.3 and 3q23. Am J Med Genet. 1993;47:1147–1150. 13. Uda M, Ottolenghi C, Crisponi L, et al. FOXL 2 disruption 32. Cai T, Tagle DA, Xia X, et al. A novel case of unilateral causes mouse ovarian failure by pervasive blockage of follicle blepharophimosis syndrome and mental retardation associated development. Hum Mol Genet. 2004;13:1171–1181. with de novo trisomy for chromosome 3q. J Med Genet. 1997; 14. Allen CE, Rubin PA. Blepharophimosis-ptosis-epicanthus in- 34:772–776. versus syndrome (BPES): clinical manifestation and treatment. 33. Maw M, Kar B, Biswas J, et al. Linkage of blepharophimosis Int Ophthalmol Clin. 2008;48:15–23. syndrome in a large Indian pedigree to chromosome 7p. Hum 15. Kaur I, Hussain A, Naik MN, Murthy R, Honavar SG. Mutation Mol Genet. 1996;5:2049–2054. spectrum of fork-head transcriptional factor gene (FOXL2) in 34. Beysen D, De Jaegere S, Amor D, et al. Identification of 34 Indian Blepharophimosis Ptosis Epicanthus Inversus Syn- novel and 56 known FOXL2 mutations in patients with drome (BPES) patients. Br J Ophthalmol. 2011;95:881–886. Blepharophimosis syndrome. Hum Mutat. 2008;29:E205–219. 16. Kumar A, Babu M, Raghunath A, Venkatesh CP. Genetic 35. Beysen D, Raes J, Leroy BP, et al. Deletions involving long- analysis of a five generation Indian family with BPES: a novel range conserved nongenic sequences upstream and down- missense mutation (p.Y215C). Mol Vis. 2004;10:445–449. stream of FOXL2 as a novel disease-causing mechanism in 17. Nallathambi J, Moumne L, De Baere E, et al. A novel polyalanine blepharophimosis syndrome. Am J Hum Genet. 2005;77:205– expansion in FOXL2: the first evidence for a recessive form of 218.

Downloaded from jov.arvojournals.org on 10/02/2021