DOCSLIB.ORG

Identification of Subspecies and Parentage Relationship by Means of DNA Fingerprinting in Two Exemplary of Pan Troglodytes (Blumenbach, 1775) (Mammalia Hominidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Subspecies and Parentage Relationship by Means of DNA Fingerprinting in Two Exemplary of Pan Troglodytes (Blumenbach, 1775) (Mammalia Hominidae) Biodiversity Journal , 2018, 9 (2): 107–114 DOI: 10.31396/Biodiv.Jour.2018.9.2.107.114 Identification of subspecies and parentage relationship by means of DNA fingerprinting in two exemplary of Pan troglodytes (Blumenbach, 1775) (Mammalia Hominidae) Viviana Giangreco 1, Claudio Provito 1, Luca Sineo 2, Tiziana Lupo 1, Floriana Bonanno 1 & Stefano Reale 1* 1Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri”, Via G. Marinuzzi 3, 90129 Palermo, Italy 2Biologia animale e Antropologia, Dip. STEBICEF, Via Archirafi 18, 90123 Palermo, Italy *Corresponding author, e-mail: [email protected] ABSTRACT Four chimpanzee subspecies (Mammalia Hominidae) are commonly recognised: the West - ern Chimpanzee, P. troglodytes verus (Schwarz, 1934), the Nigeria-Cameroon Chim - panzee, P. troglodytes ellioti, the Central Chimpanzee, P. troglodytes troglodytes (Blumenbach, 1799), and the Eastern Chimpanzee, P. troglodytes schweinfurthii (Giglioli, 1872). Recent studies on mitochondrial DNA show the incorporation of P. troglodytes schweinfurthii in P. troglodytes troglodytes , suggesting the existence of only two sub - species: P. troglodytes troglodytes in Central and Eastern Africa and P. troglodytes verus- P. troglodytes ellioti in West Africa. The aim of the present study is twofold: first, to identify the correct subspecies of two chimpanzee samples collected in a Biopark structure in Carini (Sicily, Italy), and second, to verify whether there was a kinship relationship be - tween the two samples through techniques such as DNA barcoding and microsatellite analysis. DNA was extracted from apes’ buccal swabs, the cytochrome oxidase subunit 1 (COI) gene was amplified using universal primers, then purified and injected into capillary electrophoresis Genetic Analyzer ABI 3130 for sequencing. The sequence was searched on the NCBI Blast database. In addiction, the microsatellite analysis was performed on the same machine for parentage detection among samples, and data were analyzed with GenMapper software. Our results show that both samples were P. troglodytes troglodytes , while the analysis of the microsatellite results in an unclear relationship between two chim - panzee samples. KEY WORDS Hominidae; Pan ; Africa; DNA; cytochrome oxidase ; evolution. Received 08.03.2018; accepted 29.04.2018; printed 30.06.2018; published online 05.07.2018 INTRODUCTION to as a “DNA barcode” (Hebert et al., 2003), contain approximately 648 base-pair in almost all the Cellular Biology and Molecular Genetics have species and can serve as the standard barcode for assumed over time a greater role in species identi - almost all animals. fication. The identification was based on the as - DNA barcode amplicons are typically obtained sumption that there are no individuals (except by PCR using standardized and universal primer homozygous twins) who have exactly the same sets; there are approximately five million COI bar - genome. The sequence of mitochondrial cy - code sequences in GenBank and/or BOLD (Bar - tochrome C oxidase subunit 1 (COI), often referred code of Life) databases in about 280,000 species. 108 VIVIANA GIANGRECO ET ALII In addition to “DNA barcode”, the study of ge - between chimpanzees is too small to justify the dis - netic diversity among species or subspecies can be tinction in subspecies. obtained analyzing the combination of a group of Later studies, including more mtDNA haplo - microsatellites loci with relative alleles frequencies types, once more did not find consistent support for extracted from genomic sequences. monophyly of P. troglodytes troglodytes and P. The possibility of carrying out genetic trace - troglodytes schweinfurthii (Gagneux et al., 2001; ability analysis on biological samples in the Gonder et al., 2006). In addition, in the study by framework of surveillance programs, represents Gonder et al. (2006), no fixed nucleotide differ - without doubt a strong deterrent for illegal com - ences distinguishing the haplotypes of Central and mercial procedures, illegal hunting, and protected Eastern chimpanzees were detected. species commercialization. Conducting this type Other bibliographies consulted are: Boesch & of investigation requires a technique that com - Boesch, 1993; Sakura, 1994; Bard, 1995; Jones et bines sensitivity and high discriminating power, al., 1996; Goldberg & Wrangham, 1997; Gagneux so as to allow researchers to use it even on mini - et al., 1999; Mitani et al., 2000; Butynski, 2003; mum sample quantities and to trace or identify an Marsh, 2003; Poulsen & Clark, 2004; Prufer et al., individual in a univocal way and with a low mar - 2012. gin of error. By means of microsatellites, we can detect parentage relationship among samples, but also MATERIAL AND METHODS carry out population studies and shed light on mi - Two samples of chimpanzee ( Pan troglodytes ) gration and evolutionary processes. from the Bioparco di Sicilia, Carini (Sicily, Italy), Knowing the genetic profile of a single animal both coming from a Belgian circus, were analyzed in relation to certain polymorphisms allows to: in April 2017. • ascertain the pedigree by genetic investigation Eight DNA samples were collected from buccal of paternity and / or maternity; swabs, four samples for each chimpanzee. The two • tackle suspected cases of poaching, acts of cru - specimens have been identified as: first individual, elty, and illegal imports of protected animals; named Mango (MN), born in 2000; second individ - • identify the species and / or determine the sex, ual, named Whiskey (WY), born in 1998. helping to safeguard biodiversity. The samples, numbered and subdivided into different plastic bags, were deposited in a transport Knowledge of population relationships might box and placed in a cooler bag, and the following also facilitate the use of the limited resources avail - day brought to the “Istituto Zooprofilattico Speri - able for conservation efforts (Schonewald-Cox et mentale della Sicilia”, Palermo (Italy). DNA ex - al., 1983; Avise, 1996), and might help in guiding traction was performed through the kit E.Z.N.A. breeding programs of chimpanzees kept in captivity Tissue DNA Kit Protocol - Whole Blood and Body (see Witzenberger & Hochkirch, 2011; Hvilsom et Fluids. Quantification of DNA extracted was per - al., 2013). formed using NANODROP 1000 spectrophotome - Genetic data on mitochondrial DNA (Gonder et ter from THERMO SCIENTIFIC. The COI gene al., 2006), analyses of complete genomes (Prado- was amplified by PCR using the AmpliTaq Gold™ Martinez et al., 2013), and on autosomal microsatel - DNA Polymerase Kit (Applied Biosystems) and lites (Fünfstück et al., 2015) suggest that the the specific primers Cyt-1 (F) CCAATGATAT - subspecies form two distinctive groups: one group GAAAAACATCGTT and Cyt-2 (R) GCCC - includes P. troglodytes verus and P. troglodytes el - CTCAGAATGATATTTGTCCTC for a final size lioti in West Africa and the other group includes P. of amplificate of 474 base pairs. The mixture was troglodytes troglodytes and P. troglodytes schwein - optimized as follows: 1X PCR Buffer 5 µl, 2 mM furthii in Central and Eastern Africa. MgCl2 4 µl, 10 mM dNTP mixture 2 µl, 0.6 Fischer et al. (2006) argue that, based on their pmol/ µl cyt B1 0.5 µl, 0.6 µl cyt B1 0.5 µl , 0,6 µl work on nuclear DNA and considerations on mor - cyt B2 0.5 µl, 0.03 U/ µl taq Polymerase 0.3 µl and phological and behavioral similarity, the difference water to 50 µl final volume. The amplification was Subspecies and parentage relationship by means of DNA fingerprinting in two exemplary of Pan troglodytes 109 optimized in accord to the manufacturer (Thermo), Identifiler kit for labeling the samples are shown in a 9700 thermal cycler (Applied Biosystems) in Table 1. with an initial denaturation step at 94 °C for 8 min, followed by 40 cycles, primer annealing at 53 °C for 50 s, and elongation at 72 °C for 1 minute and RESULTS AND DISCUSSION a final extension step at 72 °C for 7 minutes. All gene amplification reactions were visualized on The amplification of the COI gene in eight iso - 2% agarose gel (GellyPhor Euroclone), prepared lates taken from two samples of P. troglodytes gave by dissolving the 0.5X TBE agar and the DNA a specific band on agarose gel. The size of ampli - bands of interest displayed through an UV image fied fragment was 508 bp (Fig. 1). acquisition system, ChemiDoc BioRad (Biotec NCBI BLAST database search of the sequence 206). The samples of amplified DNA were sub - gave a similarity with species Pan troglodytes jected to purification through the “GFX PCR DNA troglodytes for both Wishy and Mango samples and gel band purification kit”. Once the purified with 99% of identity. ones were obtained, the sequence PCR was per - The microsatellites fragment were analyzed formed, with the “Bigdye Terminator Cycle Se - using the GeneMapper ID software. All electro - quencing Kit” (Applied Biosystems), considering pherograms derived from the fragment analysis of a reaction volume of 20 µl for each sample. The se - samples of Pan troglodytes for each locus are re - quence products were then purified through the ported in figures 2–7. We excluded the fluorescent “Big Dye Xterminator Purification KIT” kit and in - dye PET® because it did not give any peak. jected into the ABI Prism 3130 DNA sequencer With the VIC® dye, in the two figures (Figs. 4, (Life technologies). 5), the electropherograms of each locus, respec - The sequences obtained were searched on the tively of Whisky and Mango, were represented. Basic Local Alignment Search Tool (BLAST) With the NED™ dye, in the two figures (Figs. Database for species identification. Only se - 6, 7), the electropherograms of each locus, respec - quences with a low e-value and high degree of tively of Whisky and Mango, were represented. identity were retained. Further analyzes for the In Table 2, the alleles for each locus are reported identification of microsatellites were carried out. for all samples. Sample 3 of Whisky didn’t present Initially, after the DNA extraction from buccal swabs, samples were adjusted for their concentra - tion in ng/ µl after dilution with the corresponding TE at 0.1%. The mix was constituted in according to Kit “AMPF1 STR Identifiler PCR Amplifica - tion”.
Load more

Recommended publications
  • 10 Sota3 Chapter 7 REV11
    200 Until recently, quantifying rates of tropical forest destruction was challenging and laborious. © Jabruson 2017 (www.jabruson.photoshelter.com) forest quantifying rates of tropical Until recently, Photo: State of the Apes Infrastructure Development and Ape Conservation 201 CHAPTER 7 Mapping Change in Ape Habitats: Forest Status, Loss, Protection and Future Risk Introduction This chapter examines the status of forested habitats used by apes, charismatic species that are almost exclusively forest-dependent. With one exception, the eastern hoolock, all ape species and their subspecies are classi- fied as endangered or critically endangered by the International Union for Conservation of Nature (IUCN) (IUCN, 2016c). Since apes require access to forested or wooded land- scapes, habitat loss represents a major cause of population decline, as does hunting in these settings (Geissmann, 2007; Hickey et al., 2013; Plumptre et al., 2016b; Stokes et al., 2010; Wich et al., 2008). Until recently, quantifying rates of trop- ical forest destruction was challenging and laborious, requiring advanced technical Chapter 7 Status of Apes 202 skills and the analysis of hundreds of satel- for all ape subspecies (Geissmann, 2007; lite images at a time (Gaveau, Wandono Tranquilli et al., 2012; Wich et al., 2008). and Setiabudi, 2007; LaPorte et al., 2007). In addition, the chapter projects future A new platform, Global Forest Watch habitat loss rates for each subspecies and (GFW), has revolutionized the use of satel- uses these results as one measure of threat lite imagery, enabling the first in-depth to their long-term survival. GFW’s new analysis of changes in forest availability in online forest monitoring and alert system, the ranges of 22 great ape and gibbon spe- entitled Global Land Analysis and Dis- cies, totaling 38 subspecies (GFW, 2014; covery (GLAD) alerts, combines cutting- Hansen et al., 2013; IUCN, 2016c; Max Planck edge algorithms, satellite technology and Insti tute, n.d.-b).
    [Show full text]
  • Ebola & Great Apes
    Ebola & Great Apes Ebola is a major threat to the survival of African apes There are direct links between Ebola outbreaks in humans and the contact with infected bushmeat from gorillas and chimpanzees. In the latest outbreak in West Africa, Ebola claimed more than 11,000 lives, but the disease has also decimated great ape populations during previous outbreaks in Central Africa. What are the best strategies for approaching zoonotic diseases like Ebola to keep both humans and great apes safe? What is Ebola ? Ebola Virus Disease, formerly known as Ebola Haemorrhagic Fever, is a highly acute, severe, and lethal disease that can affect humans, chimpanzees, and gorillas. It was discovered in 1976 in the Democratic Republic of Congo and is a Filovirus, a kind of RNA virus that is 50-100 times smaller than bacteria. • The initial symptoms of Ebola can include a sudden fever, intense weakness, muscle pain and a sore throat, according to the World Health Organization (WHO). Subsequent stages include vomiting, diarrhoea and, in some cases, both internal and external bleeding. • Though it is believed to be carried in bat populations, the natural reservoir of Ebola is unknown. A reservoir is the long-term host of a disease, and these hosts often do not contract the disease or do not die from it. • The virus is transmitted to people from wild animals through the consumption and handling of wild meats, also known as bushmeat, and spreads in the human population via human-to-human transmission through contact with bodily fluids. • The average Ebola case fatality rate is around 50%, though case fatality rates have varied from 25% to 90%.
    [Show full text]
  • Proposal for Inclusion of the Chimpanzee
    CMS Distribution: General CONVENTION ON MIGRATORY UNEP/CMS/COP12/Doc.25.1.1 25 May 2017 SPECIES Original: English 12th MEETING OF THE CONFERENCE OF THE PARTIES Manila, Philippines, 23 - 28 October 2017 Agenda Item 25.1 PROPOSAL FOR THE INCLUSION OF THE CHIMPANZEE (Pan troglodytes) ON APPENDIX I AND II OF THE CONVENTION Summary: The Governments of Congo and the United Republic of Tanzania have jointly submitted the attached proposal* for the inclusion of the Chimpanzee (Pan troglodytes) on Appendix I and II of CMS. *The geographical designations employed in this document do not imply the expression of any opinion whatsoever on the part of the CMS Secretariat (or the United Nations Environment Programme) concerning the legal status of any country, territory, or area, or concerning the delimitation of its frontiers or boundaries. The responsibility for the contents of the document rests exclusively with its author. UNEP/CMS/COP12/Doc.25.1.1 PROPOSAL FOR THE INCLUSION OF CHIMPANZEE (Pan troglodytes) ON APPENDICES I AND II OF THE CONVENTION ON THE CONSERVATION OF MIGRATORY SPECIES OF WILD ANIMALS A: PROPOSAL Inclusion of Pan troglodytes in Appendix I and II of the Convention on the Conservation of Migratory Species of Wild Animals. B: PROPONENTS: Congo and the United Republic of Tanzania C: SUPPORTING STATEMENT 1. Taxonomy 1.1 Class: Mammalia 1.2 Order: Primates 1.3 Family: Hominidae 1.4 Genus, species or subspecies, including author and year: Pan troglodytes (Blumenbach 1775) (Wilson & Reeder 2005) [Note: Pan troglodytes is understood in the sense of Wilson and Reeder (2005), the current reference for terrestrial mammals used by CMS).
    [Show full text]
  • The Evolutionary History of Human and Chimpanzee Y-Chromosome Gene Loss
    The Evolutionary History of Human and Chimpanzee Y-Chromosome Gene Loss George H. Perry,* à Raul Y. Tito,* and Brian C. Verrelli* *Center for Evolutionary Functional Genomics, The Biodesign Institute, Arizona State University, Tempe; School of Life Sciences, Arizona State University, Tempe; and àSchool of Human Evolution and Social Change, Arizona State University, Tempe Recent studies have suggested that gene gain and loss may contribute significantly to the divergence between humans and chimpanzees. Initial comparisons of the human and chimpanzee Y-chromosomes indicate that chimpanzees have a dis- proportionate loss of Y-chromosome genes, which may have implications for the adaptive evolution of sex-specific as well as reproductive traits, especially because one of the genes lost in chimpanzees is critically involved in spermatogenesis in humans. Here we have characterized Y-chromosome sequences in gorilla, bonobo, and several chimpanzee subspecies for 7 chimpanzee gene–disruptive mutations. Our analyses show that 6 of these gene-disruptive mutations predate chimpan- zee–bonobo divergence at ;1.8 MYA, which indicates significant Y-chromosome change in the chimpanzee lineage Downloaded from https://academic.oup.com/mbe/article/24/3/853/1246230 by guest on 23 September 2021 relatively early in the evolutionary divergence of humans and chimpanzees. Introduction The initial comparisons of human and chimpanzee Comparative analyses of single-nucleotide differences (Pan troglodytes) Y-chromosome sequences revealed that between human and chimpanzee genomes typically show although there are no lineage-specific gene-disruptive mu- estimates of approximately 1–2% divergence (Watanabe tations in the X-degenerate portion of the Y-chromosome et al. 2004; Chimpanzee Sequencing and Analysis Consor- fixed within humans, surprisingly, 4 genes, CYorf15B, tium 2005).
    [Show full text]
  • Tanzania Chimpanzee Conservation Action Plan 2018-2023
    Tanzania Chimpanzee Conservation Action Plan 2018-2023 This plan is written in collaboration with various institutions that have interest and are working tirelessly in conserving chimpanzees in Tanzania. Editorial list i. Dr. Edward Kohi ii. Dr. Julius Keyyu iii. Dr. Alexander Lobora iv. Ms. Asanterabi Kweka v. Dr. Iddi Lipembe vi. Dr. Shadrack Kamenya vii. Dr. Lilian Pintea viii. Dr. Deus Mjungu ix. Dr. Nick Salafsky x. Dr. Flora Magige xi. Dr. Alex Piel xii. Ms. Kay Kagaruki xiii. Ms. Blanka Tengia xiv. Mr. Emmanuel Mtiti Published by: Tanzania Wildlife Research Institute (TAWIRI) Citation: TAWIRI (2018) Tanzania Chimpanzee Conservation Action Plan 2018-2023 TAWIRI Contact: [email protected] Cover page photo: Chimpanzee in Mahale National Park, photo by Simula Maijo Peres ISBN: 978-9987-9567-53 i Acknowledgements On behalf of the Ministry of Natural Resource and Tourism (MNRT), Wildlife Division (WD), Tanzania National Parks (TANAPA), and Tanzania Wildlife Authority (TAWA), the Tanzania Wildlife Research Institute (TAWIRI) wishes to express its gratitude to organizations and individuals who contributed to the development of this plan. We acknowledge the financial support from the U.S. Agency for International Development (USAID) and the U.S Fish and Wildlife Service (USFWS) for the planning process. Special thanks are extended to the Jane Goodall Institute (JGI) and Kyoto University for their long-term chimpanzee research in the country that has enhanced our understanding of the species behaviour, biology and ecology, thereby greatly contributing to the development process of this conservation action plan. TAWIRI also wishes to acknowledge contributions by Conservation Breeding Specialist Group - Species Survival Commission of the International Union for Conservation of Nature (IUCN), Evaluation and Research Technologies for Health, Inc.
    [Show full text]
  • West African Chimpanzees
    Status Survey and Conservation Action Plan West African Chimpanzees Compiled and edited by Rebecca Kormos, Christophe Boesch, Mohamed I. Bakarr and Thomas M. Butynski IUCN/SSC Primate Specialist Group IUCN The World Conservation Union Donors to the SSC Conservation Communications Programme and West African Chimpanzees Action Plan The IUCN Species Survival Commission is committed to communicating important species conservation information to natural resource managers, decision makers and others whose actions affect the conservation of biodiversity. The SSC’s Action Plans, Occasional Papers, newsletter Species and other publications are supported by a wide variety of generous donors including: The Sultanate of Oman established the Peter Scott IUCN/SSC Action Plan Fund in 1990. The Fund supports Action Plan development and implementation. To date, more than 80 grants have been made from the Fund to SSC Specialist Groups. The SSC is grateful to the Sultanate of Oman for its confidence in and support for species conservation worldwide. The Council of Agriculture (COA), Taiwan has awarded major grants to the SSC’s Wildlife Trade Programme and Conser- vation Communications Programme. This support has enabled SSC to continue its valuable technical advisory service to the Parties to CITES as well as to the larger global conservation community. Among other responsibilities, the COA is in charge of matters concerning the designation and management of nature reserves, conservation of wildlife and their habitats, conser- vation of natural landscapes, coordination of law enforcement efforts, as well as promotion of conservation education, research, and international cooperation. The World Wide Fund for Nature (WWF) provides significant annual operating support to the SSC.
    [Show full text]
  • Behavior on Tour and Non-Tour Days at Chimpanzee Sanctuary Northwest
    Central Washington University ScholarWorks@CWU All Master's Theses Master's Theses Spring 2016 Comparison of Chimpanzee (Pan Troglodytes) Behavior on Tour and Non-Tour Days at Chimpanzee Sanctuary Northwest Allison A. Farley Central Washington University, [email protected] Follow this and additional works at: https://digitalcommons.cwu.edu/etd Part of the Animal Sciences Commons, and the Other Anthropology Commons Recommended Citation Farley, Allison A., "Comparison of Chimpanzee (Pan Troglodytes) Behavior on Tour and Non-Tour Days at Chimpanzee Sanctuary Northwest" (2016). All Master's Theses. 425. https://digitalcommons.cwu.edu/etd/425 This Thesis is brought to you for free and open access by the Master's Theses at ScholarWorks@CWU. It has been accepted for inclusion in All Master's Theses by an authorized administrator of ScholarWorks@CWU. For more information, please contact [email protected]. COMPARISON OF CHIMPANZEE (PAN TROGLODYTES) BEHAVIOR ON TOUR AND NON-TOUR DAYS AT CHIMPANZEE SANCTUARY NORTHWEST __________________________________ A Thesis Presented to The Graduate Faculty Central Washington University __________________________________ In Partial Fulfillment of the Requirements for the Degree Master of Science Primate Behavior and Ecology ___________________________________ by Allison Ann Farley May 2016 CENTRAL WASHINGTON UNIVERSITY Graduate Studies We hereby approve the thesis of Allison Ann Farley Candidate for the degree of Master of Science APPROVED FOR THE GRADUATE FACULTY ______________ _________________________________________
    [Show full text]
  • African Great Apes Update
    African Great Apes Update Recent News from the WWF African Great Apes Programme © WWF / PJ Stephenson Number 1 – January 2005 Cover photo: Project staff from the Wildlife Conservation Society marking a Cross River gorilla nest in the proposed gorilla sanctuary at Kagwene, Mbulu Hills, Cameroon (see story on page 7). This edition of African Great Apes Update was edited by PJ Stephenson. The content was compiled by PJ Stephenson & Alison Wilson. African Great Apes Update provides recent news on the conservation work funded by the WWF African Great Apes Programme. It is aimed at WWF staff and WWF's partners such as range state governments, international and national non-governmental organizations, and donors. It will be published at least once per year. Published in January 2005 by WWF - World Wide Fund for Nature (formerly World Wildlife Fund), CH-1196, Gland, Switzerland Any reproduction in full or in part of this publication must mention the title and credit the above-mentioned publisher as the copyright owner. No photographs from this publication may be reproduced on the internet without prior authorization from WWF. The material and the geographical designations in this report do not imply the expression of any opinion whatsoever on the part of WWF concerning the legal status of any country, territory, or area, or concerning the delimitation of its frontiers or boundaries. © text 2005 WWF All rights reserved In 2002, WWF launched a new African Great Apes Programme to respond to the threats facing chimpanzees, bonobos, and western and eastern gorillas. Building on more than 40 years of experience in great ape conservation, WWF’s new initiative aims to provide strategic field interventions to help guarantee a future for these threatened species.
    [Show full text]
  • The Sampling Scheme Matters: Pan Troglodytes Troglodytes and P
    AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 156:181–191 (2015) The Sampling Scheme Matters: Pan troglodytes troglodytes and P. t. schweinfurthii Are Characterized by Clinal Genetic Variation Rather Than a Strong Subspecies Break Tillmann Funfst€ uck,€ 1* Mimi Arandjelovic,1 David B. Morgan,2 Crickette Sanz,3 Patricia Reed,2 Sarah H. Olson,2 Ken Cameron,2 Alain Ondzie,4 Martine Peeters,5 and Linda Vigilant1* 1Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig, Germany 2Wildlife Conservation Society, Global Conservation, 2300 Southern Boulevard, New York, NY 10460, USA 3Department of Anthropology, Washington University, 1 Brookings Drive, Saint Louis, MO 63130, USA 4Wildlife Conservation Society, Congo Program, 151 Ave Charles de Gaulle, Brazzaville, Republic of Congo 5UMI233, TransVIHMI, Institut de Recherche pour le Developpement (IRD) and Universite Montpellier 1, Montpel- lier, France KEY WORDS genetic differentiation; isolation by distance; structure; microsatellites; genotyping ABSTRACT Populations of an organism living in were sampled across large parts of their range and analyzed marked geographical or evolutionary isolation from other them together with 283 published eastern chimpanzee geno- populations of the same species are often termed subspecies types from known localities. We observed a clear signal of and expected to show some degree of genetic distinctiveness. isolation by distance across both subspecies. Further, we Thecommonchimpanzee(Pan troglodytes) is currently found that a large proportionofcomparisonsbetween described as four geographically delimited subspecies: the groups taken from the same subspecies showed higher western (P. t. verus), the nigerian-cameroonian (P. t. ellioti), genetic differentiation than the least differentiated the central (P. t. troglodytes) and the eastern (P.
    [Show full text]
  • Western Chimpanzee (Pan Troglodytes Verus) Population and Habitat Viability Assessment (PHVA) for Sierra Leone
    Western Chimpanzee (Pan troglodytes verus) Population and Habitat Viability Assessment (PHVA) for Sierra Leone Freetown, Sierra Leone 24 to 27 May 2011 FINAL REPORT A contribution of the IUCN/SSC Conservation Breeding Specialist Group (CBSG) in cooperation with the Tacugama Chimpanzee Sanctuary. Western Chimpanzee (Pan troglodytes verus) Population and Habitat Viability Assessment (PHVA) for Sierra Leone. Final Report. CBSG Europe and CBSG Headquarters Torben and Alice Frimodt’s Foundation Western Chimpanzee (Pan troglodytes verus) Population and Habitat Viability Assessment (PHVA) for Sierra Leone Freetown, Sierra Leone 24 to 27 May 2011 Final Report Edited by: Carlsen, F.; Leus, K.; Traylor-Holzer, K.; McKenna, A. Compiled by the workshop participants A participative workshop in cooperation with: Supported by Torben and Alice Frimodt’s Foundation Workshop organized by: Tacugama Chimpanzee Sanctuary & IUCN/SSC CBSG Planning committee: Anita McKenna, Frands Carlsen, Kathy Traylor-Holzer, Kristin Leus General Organization: Ministry of Agriculture, Forestry and Food Security (MAFFS), Tacugama Chimpanzee Sanctuary, IUCN/SSC CBSG Europe, IUCN/SSC CBSG HQ Financial support provided by: Alice and Torben Frimodt’s Foundation, Association Beauval Conservation & Recherche, Copenhagen Zoo, Hamilton Zoo, Sweden Chimpanzee Trust Institutional support provided by: IUCN/SSC Conservation Breeding Specialist Group Europe (CBSG), Tacugama Chimpanzee Sanctuary (TCS), IUCN/SSC Primate Specialist Group Workshop facilitated by: IUCN/SSC Conservation Breeding Specialist Group (CBSG) Europe (www.cbsg.org) Photos courtesy of Tacugama Chimpanzee Sanctuary and CBSG. A contribution of the IUCN/SSC Conservation Breeding Specialist Group. IUCN encourages meetings, workshops and other fora for the consideration and analysis of issues related to conservation, and believes that reports of these meetings are most useful when broadly disseminated.
    [Show full text]
  • African Apes Initiative
    African Apes Initiative frica is home to four of the world’s five great ape species, Aincluding the bonobo, chimpanzee and two species of gorilla, the eastern and western. Unfortunately, all four of these great ape species are either endangered or critically endangered. Africa’s great apes face a number of threats, including: • Habitat destruction and fragmentation, • Poaching, • The risk of disease transfer from humans, and • The pet trade. Through the newly launched African Apes Initiative (AAI), the African Wildlife Foundation (AWF) is working through, and with, stakeholders throughout West and Central Africa to protect great apes and their habitat. How It Works The African Apes Initiative leverages the funding strength and conservation expertise of AWF—including our decades of experience conserving mountain gorilla and bonobo populations—to create a holistic conservation program that effectively addresses the range of threats facing great apes. The initiative identifies landscapes with the potential to sustain viable African ape populations over the long term, and then works with partners on the ground to conserve those ecosystems. By combining the expertise of AWF and local stakeholders, we can ensure that great ape populations—not to mention the other critical fauna and flora found in the landscape—stand a much better chance of survival. How the initiative works: • AWF prioritizes those great ape habitats most in need of conservation intervention. The objective of AAI is to work toward conserving at least one population of each of the nine subspecies of African apes. We select target populations based on this and other factors, such as the level of threats to their survival and the viability of working with certain partners on the ground.
    [Show full text]
  • Wildlife Without Borders - Great Ape Conservation Fund
    Wildlife Without Borders - Great Ape Conservation Fund In 2012, the USFWS awarded 47 new grants from the Great Ape Conservation Fund totaling $3,333,562.68 which was matched by $4,947,144 in leveraged funds. Field projects in 17 countries (in alphabetical order below) will be supported. AFRICA In 2012, the USFWS awarded 25 new grants in eight African countries totaling $2,168,307.58 in USFWS funding which was matched by $3,844,684 in leveraged funds. In addition to one project that involves multiple countries. CAMEROON Capacity building for Great Ape Conservation and Natural Resource Management across the Deng Deng National Park Landscape, Cameroon. GA-0900 Wildlife Conservation Society Grant# F12AP00329 FWS: $64,702 Leveraged Funds: $40,327 Location: Cameroon The purpose of this project is to improve protection of chimpanzees and gorillas at Deng Deng NP by developing a strong local constituency for conservation and training park ecoguards in law enforcement, natural resource management, and monitoring of illegal activities. Promoting Community Participation in Great Ape Conservation in the Proposed Ebo National Park, Cameroon. GA-0924 Zoological Society of San Diego Grant# F12AP00679 FWS: $70,662 Leveraged Funds: $183,729 Location: Cameroon The purpose of this project is to reduce illegal hunting of great apes and other wildlife by engaging local communities, traditional authorities, and government agencies in a program of outreach, education, and awareness. DEMOCRATIC REPUBLIC OF THE CONGO Ensuring continued growth of the Virunga Mountain
    [Show full text]