USOO9393221B2

(12) United States Patent (10) Patent No.: US 9,393,221 B2 W (45) Date of Patent: Jul.19, 2016

(54) METHODS AND COMPOUNDS FOR FOREIGN PATENT DOCUMENTS REDUCING INTRACELLULAR LIPID STORAGE WO WO2007096,251 8, 2007 OTHER PUBLICATIONS (75) Inventor: Sean Wu, Brookline, MA (US) Onyesom and Agho, Asian J. Sci. Res., Oct. 2010, vol. 4, No. 1, p. (73) Assignee: THE GENERAL, HOSPITAL 78-83. CORPORATION, Boston, MA (US) Davis et al., Br J Clin Pharmacol., 1996, vol. 4, p. 415-421.* Schweiger et al., Am J Physiol Endocrinol Metab, 2009, vol. 279, E289-E296. (*) Notice: Subject to any disclaimer, the term of this Maryam Ahmadian et al., Desnutrin/ATGL is regulated by AMPK patent is extended or adjusted under 35 and is required for a brown adipose phenotype, Cell Metabolism, vol. U.S.C. 154(b) by 748 days. 13, pp. 739-748, 2011. Mohammadreza Bozorgmanesh et al., Diabetes prediction, lipid (21) Appl. No.: 13/552,975 accumulation product, and adiposity measures; 6-year follow-up: Tehran lipid and glucose study, Lipids in Health and Disease, vol. 9, (22) Filed: Jul.19, 2012 pp. 1-9, 2010. Judith Fischer et al., The gene encoding adipose triglyceride lipase (65) Prior Publication Data (PNPLA2) is mutated in neutral lipid storage disease with myopathy, Nature Genetics, vol.39, pp. 28-30, 2007. US 2013/OO23488A1 Jan. 24, 2013 Astrid Gruber et al., The N-terminal region of comparative gene identification-58 (CGI-58) is important for lipid droplet binding and activation of adipose triglyceride lipase, vol. 285, pp. 12289-12298, Related U.S. Application Data 2010. (60) Provisional application No. 61/509,890, filed on Jul. Ken-Ichi Hirano et al., Triglyceride deposit cardiomyovasculopathy, The New England Journal of Medicine, vol. 359, pp. 2396-2398. 20, 2011. 2008. John D. Horowitz et al., Perhexiline and hypertrophic (51) Int. Cl. cardiomyopathy: A new horizon for metabolic modulation, Circula CI2N5/00 (2006.01) tion, vol. 122, pp. 1547-1549, 2010. CI2N 5/02 (2006.01) Sally Inglis et al., Metabolic therapeutics in angina pectoris: history A6 IK3I/37 (2006.01) revisited with perhexiline, European Journal of Cardiovascular Nurs A6 IK3I/25 (2006.01) ing, vol. 5, pp. 175-184, 2006. A6 IK3I/4375 (2006.01) Kunihisa Kobayashi et al., The lack of the C-terminal domain of A6 IK3I/439 (2006.01) adipose triglyceride lipase causes neutral lipid storage disease A6 IK3I/4458 (2006.01) through impaired interactions with lipid droplets, The Journal of A 6LX3L/24709 (2006.01) Clinical Endocrinology and Metabolism, vol. 93, pp. 2877-2884, 2008. A6 IK3I/706 (2006.01) Leong Lee et al., Metabolic modulation with perhexiline in chronic C4OB 30/06 (2006.01) heart failure: A randomized, controlled trial of short-term use of a GOIN33/50 (2006.01) novel treatment, Circulation, vol. 112, pp. 3280-3288, 2005. GOIN33/92 (2006.01) Krishnakant G. Soni et al., Coatomer-dependent protein delivery to (52) U.S. Cl. lipid droplets, Journal of CellScience, vol. 122, pp. 1834-1841, 2009. CPC ...... A6 IK3I/137 (2013.01); A61 K3I/215 John R. Ussher et al., Targeting malonyl CoA inhibition of (2013.01); A61 K3I/439 (2013.01); A61 K mitochondrial fatty acid uptake acid uptake,as an approach to treat 31/4375 (2013.01); A61 K3I/4458 (2013.01); cardiac ischemia reperfusion, Basic Research in Cardiology, vol. A61 K3I/4709 (2013.01); A61 K3I/706 104, pp. 203-210, 2009. (2013.01); C40B30/06 (2013.01); G0IN 33/5061 (2013.01); G0IN33/5073 (2013.01); * cited by examiner G0IN33/92 (2013.01) Primary Examiner — Kade Ariani (58) Field of Classification Search (74) Attorney, Agent, or Firm — Nixon Peabody LLP None See application file for complete search history. (57) ABSTRACT (56) References Cited Compounds and compositions for reducing intracellular lipid accumulation in a cell are described herein. These com U.S. PATENT DOCUMENTS pounds are useful for the treatment and prevention of lipid/ glycogen disorders, as well as for the treatment and preven 7,449.482 B2 11/2008 Cheng et al. tion of obesity. A high throughput screen for identifying 7,855,289 B2 12/2010 Nunes et al. 2001/0048980 A1 12/2001 Kishimoto et al. compounds that reduce intracellular lipid accumulation in 2007/0275997 A1 11, 2007 Frenneaux cells is also provided. 2009/0324682 A1 12/2009 Popowski 2011/0048980 A1 3/2011 Seman 9 Claims, 15 Drawing Sheets U.S. Patent Jul. 19, 2016 Sheet 1 of 15 US 9,393,221 B2

#################### V,±0IJI ####################

seager SSX 38

I’01), U.S. Patent Jul. 19, 2016 Sheet 2 of 15 US 9,393,221 B2

------S33: E.

s

E. . . ran as R s w as rise ces

gas

ca a. warra a s s se s A 383d 8 ex es e e SSX 3

2. s was e R s w

w c s

i SSX 3 SS U.S. Patent Jul. 19, 2016 Sheet 3 of 15 US 9,393,221 B2

(Of’91)I

{{#######{}{}&&############3 U.S. Patent Jul. 19, 2016 Sheet 4 of 15 US 9,393,221 B2

}} {}}} # {}

age s’ acs x 8. U.S. Patent Jul. 19, 2016 Sheet 5 Of 15 US 9,393,221 B2

U.S. Patent Jul. 19, 2016 Sheet 7 Of 15 US 9,393,221 B2

.

A W H F D M S K W M S K FoxA2 festi if U.S. Patent Jul. 19, 2016 Sheet 8 of 15 US 9,393,221 B2

U.S. Patent Jul. 19, 2016 Sheet 9 Of 15 US 9,393,221 B2

FE A PC A PEEE

s:

-

E

C. S. 8 - - - A CEE A PERENE

s 3. e d

E} FIG. 7D

U.S. Patent Jul. 19, 2016 Sheet 11 of 15 US 9,393,221 B2

####### * )(310,0${}\\ E On Molimanae

O U.S. Patent US 9,393,221 B2

42,1149 !############ U.S. Patent US 9,393,221 B2

AS

f U.S. Patent US 9,393,221 B2

Per met veh) va) NON

FIG SE

Pik i. FIG. SF U.S. Patent Jul. 19, 2016 Sheet 15 Of 15 US 9,393,221 B2

(c.595--Ga., p.a.233esis: 62} C, i 2 ?essic-l. p.289X)

ES 3 8

3

US 9,393,221 B2 1. 2 METHODS AND COMPOUNDS FOR spleen must be removed to improve cardiopulmonary func REDUCING INTRACELLULAR LIPID tion. For patients with Fabry disease, the drugs phenyloin and STORAGE carbamazepine may be prescribed to help treat pain (includ ing bone pain). CROSS-REFERENCE TO RELATED Given the lack of specific therapies for lipid/glycogen stor APPLICATIONS age diseases, there is need in the art for compositions and methods for treatment of these disorders. This application claims the benefit under 35 U.S.CS119(e) of U.S. Provisional Application No. 61/509,890, filed Jul. 20, SUMMARY 2011, which is herein incorporated by reference in its entirety. 10 Embodiments of the present invention are based, in part, on SEQUENCE LISTING the establishment of a high throughput assay for the identifi cation of compounds capable of modulating intracellular The instant application contains a Sequence Listing which lipid storage. The inventors have generated both a murine and has been submitted in ASCII format via EFS-Web and is 15 human induced pluripotent stem cell (iPSC) model system of hereby incorporated by reference in its entirety. Said ASCII neutral lipid storage disease, myopathy subtype (NLSD-M), a copy, created on Jul. 25, 2012, is named 071061 US.txt and is condition characterized by aberrant lipid accumulation in 12,530 bytes in size. cardiac and skeletal muscle that results from the loss of func FIELD OF INVENTION tional adipose triglyceride lipase (ATGL). They demonstrate that differentiated ATGL-knockout (KO) iPSCs and human The invention relates to methods, compounds and compo mutant iPSCs exhibit significantly increased lipid accumula sitions for the treatment of lipid/glycogen storage disorders tion compared to differentiated control iPSCs, and using a and obesity. high throughput platform for iPSC differentiation and small 25 molecule screening have identified compounds that reduce BACKGROUND lipid accumulation within both mouse and human NLSD-M iPSCs and extended the mean life span of ATGK knock out Metabolic disorders, such as lipid storage disease and gly mice by 30% (from 13 to 17 weeks). They have also deter cogen storage disease, can have devastating effects on mined that inhibitors of intracellular lipid storage shift cellu patients. The Lipid storage diseases represent a group of 30 lar energy metabolism from fatty acid oxidation to glycolysis. disorders in which harmful amounts of lipids accumulate in Thus, compounds selected using the high throughput Screen various cells and tissues in the body. Glycogen storage dis are useful for the treatment and prevention of a variety of ease is the result of defects in the processing of glycogen lipid/glycogen storage disorders, as well are useful for the synthesis or breakdown within cells. Individuals with lipid/ treatment of obesity. glycogen storage disorders either do not produce enough of 35 Accordingly, in one aspect, the invention provides for a one of the enzymes needed to breakdown (metabolize) lipids, method of reducing intracellular lipid accumulation in a cell or glycogen, or they produce enzymes that do not work prop comprising a contacting the cell with an effective amount of erly. Over time, this excessive storage of fats and glycogen a compound selected from Table 1. In one embodiment, the can cause permanent cellular and tissue damage, for example, compound is selected from a compound listed in Table 2. In in the heart, muscle, brain, peripheral nervous system, liver, 40 one embodiment the compound is selected from a compound spleen, and bone marrow. listed in Table 3. In one embodiment, the compound shifts Neutral lipid storage disease myopathy subtype (NLSD cellular energy metabolism from fatty acid oxidation to gly M) is caused by loss-of-function mutations in PNPLA2, colysis. which encodes adipose triglyceride lipase (ATGL, also Intracellular lipid accumulation may be reduced in any cell known as desnutrin) (Fischer et al., 2007). ATGL is expressed 45 type. In one embodiment the cell is selected from the group in a variety of tissues, including cardiac and skeletal muscle consisting of a skeletal muscle cell, a heart muscle cell, a (Lake et al., 2005; Pinent et al., 2008), and as it cleaves the Smooth muscle cell, a neuronal cell, a leukocyte cell, a bone first ester bond in triacylglycerol (TAG), it is the rate-limiting marrow cell, an epithelial cell, and an endothelial cell. enzyme in the breakdown of intracellular TAG droplets to In one embodiment, the cells to be contacted do not express provide free fatty acid for cellular energy metabolism (Haem 50 functional adipose triglyceride lipase (ATGL), expresses merle et al., 2006). Consistent with this function, the domi only partially functional ATGL, or expresses a mutant form of nant phenotype of NLSD-M is excessive intracellular TAG ATGL. In one embodiment, the cell comprises a loss of func accumulation in multiple tissues, notably in cardiac and skel tion mutation in the gene PNPLA2 or lacks the gene etal muscle, which then go on to develop myopathy (Fischer PNPLA2 et al. 2007; Kobayashi, K. et al., 2008). ATGL-knockout 55 The compounds may further comprise a pharmaceutically (ATGL-KO) mice exhibit an NLSD-M-like phenotype and acceptable carrier and the cells may be contacted with the Suffer from fatal cardiac myopathy secondary to massive fat compound either in vitro or in vivo (e.g. in a Subject in need accumulation in the heart (Haemmerle et al., 2006). of reduction of pathological intracellular lipid accumulation). Currently there is a lack of specific treatments available for In one embodiment, the In vivo contact comprises admin most of the lipid/glycogen storage disorders and restricting 60 istering a therapeutically effective amount of the compound one's diet does not prevent lipid/glycogen buildup in cells and to a Subject using a administration route selected from the tissues. Enzyme replacement therapy is available for some, group consisting of oral, Subcutaneous, intravenous, intra e.g. patients with type 1 and type 3 Gaucher disease. How muscular, intraperitoneal, intranasal, and topical. In one ever, most available treatments for storage disorders are pre embodiment, the in vivo contact comprises administering the Ventative of secondary symptoms. For example, individuals 65 compound locally to the heart. In one embodiment the subject having lipid storage disease associated with anemia may is a mammal, e.g. human. In one embodiment, the human require blood transfusions and, in Some patients, an enlarged Subject is selected as being obese, or selected for being at risk US 9,393,221 B2 3 4 of being obese. In one embodiment, the human Subject is Another aspect of the invention provides a method for selected for treatment of a lipid/glycogen storage disorder. treating or preventing a lipid/glycogen disorder comprising In one embodiment, the lipid/glycogen storage disorder is administrating a therapeutically effective amount of recom characterized by increased intracellular lipid accumulation as binant ATGL protein to a subject in need thereof. compared to a normal healthy individual. In one embodiment, Still another aspect of the invention provides a method for the lipid/glycogen storage disorder is associated with myopa treating or preventing of obesity comprising administrating a thy, e.g. neutral lipid storage disease (NLSD) or neutral lipid therapeutically effective amount of recombinant ATGL pro storage disease with myopathy (NLSD-M). tein to a subject in need thereof. In some embodiments, the lipid/glycogen storage disorder is selected from the group consisting of Activator Defi 10 BRIEF DESCRIPTION OF THE DRAWINGS ciency/GM2 Gangliosidosis, Alpha-mannosidosis, Aspartyl FIG. 1 shows a gel of RT-PCR products for pluripotency glucosaminuria, Cholesteryl ester storage disease, Chronic and germ-layer markers in WT and KO iPSCs and ES cells on Hexosaminidase A Deficiency, Cystinosis, Danon disease, days 0 and 10 of differentiation. Fabry disease, Farber disease, Fucosidosis, Galactosialidosis, 15 FIGS. 2a-2e depict bar graphs of quantitative PCR for the Gaucher Disease, GM1 gangliosidosis, I-Cell disease/Mu expression of embryonic germ layer markers during in vitro colipidosis II, Infantile Free Sialic Acid Storage Disease/ differentiation. ATGL-KO and WT iPSCs and control ES ISSD. Juvenile Hexosaminidase A Deficiency, Krabbe dis cells were differentiated as EBs and harvested at the indicated ease, Lysosomal acid lipase deficiency, Metachromatic days to assess RNA expression levels of the indicated lineage Leukodystrophy, a Mucopolysaccharidoses disorder, Mul markers. The expression level of each gene is normalized tiple sulfatase deficiency, Niemann-Pick Disease, a Neuronal against the corresponding expression level of GAPDH in Ceroid Lipofuscinoses, Pompe diseasef Glycogen storage dis each sample. Data are displayed as meants.d. (n=3). *-not ease type II. Hypertrophic cardiomyopathy, Pycnodysostosis, detected. FIG. 2a depicts Oct4 expression. FIG. 2b depicts Sandhoff disease/GM2 Gangliosidosis, Schindler disease, Nestin expression. FIG. 2c depicts FoxA2 expression. FIG. Salla disease/Sialic Acid Storage Disease, Tay-Sachs/GM2 25 2d depicts Mlc2v expression. FIG. 2e depicts Brachury gangliosidosis, and Wolman disease. expression. In one embodiment, the compound is Perhexyline, FIG.3 depicts a bar graph of quantitative analysis of ORO Fendiline hydrochloride, Vinpocetine, Mefloquine hydro levels in each cell line during in vitro differentiation; i.e. WT chloride, Dicyclomine hydrochloride, Tomatine, or Clid IPSC, ATGL-KO IPSCs, and control ES cells. Data are plot inium bromide. 30 ted as mean normalized ORO-ts.d., n=3 (*P-0.05, In another aspect of the invention, a high throughput assay **P<0.005, student's t-test), relative to the normalized ORO for screening of compounds or agents that reduce intracellu levels of WT day 0 samples. ATGL-KO iPSCs recapitulate lar accumulation of lipid within cells is provided. The assay intracellular lipid accumulation phenotype of ATGL-1 KO comprising: (a) contacting a test population of induced pluri 1CC. potent stem cells (iPSCs) derived from a somatic that lacks 35 FIGS. 4a-4d depict bar graphs showing comprehensive expression of functional adipose triglyceride lipase (ATGL), profiling of changes in lipid species in ATGL-1 KO vs. WT or that comprises a mutation in PNPLA2 gene, with a test iPSCs a measured by mass spectrometry. The amounts of compound; (b) differentiating the cells of step (a) in the individual (FIG. 4a) triacylglycerol (TAG), (FIG. 4b) choles presence of the test compound; and (c) selecting a compound terol ester (CE), and (FIG.4c) phosphatidylcholine (PC) spe that decreases lipid accumulation within the cells as com 40 cies were quantified in day 12 differentiated ATGL-KO and pared to a differentiated control population of induced pluri WT iPSCs plotted as ratios of KO levels over WT levels. The potent stem cells (iPSCs) that has not been contacted with a molecular species are denoted by their total acyl carbon num test compound. ber and total double bond number (total acyl carbon: total In one embodiment, the control population of cells is unsaturated bonds). (FIG. 4d.) The ratio of aggregate levels of derived from the same Somatic cell as the test population. 45 TAG, CE, diacylglycerols (DAG), phosphatidylethanola In one embodiment, the Somatic cell is from a Subject that mines (PE), sphingomyelins (SM), lysophosphatidylcholines has neutral lipid storage disease with myopathy (NLSD-M). (LPC), lysophosphatidylethanolamines (LPE), and PC in KO In one embodiment, the Somatic cell is from an knockout vs. WT cells. Data are plotted as meanistandard error, n=6. animal that has had the gene for adipose triglyceride lipase FIGS. 5a-5c show graphic illustrations of the high through (ATGL) deleted from its genome, or is a cell with a mutation 50 put Screening for Small molecule regulators of the lipid accu in the gene for ATGL, wherein the gene for adipose triglyc mulation phenotype in ATGL-KO iPSCs. (FIG. 5a) A sche eride lipase (ATGL) is PNPLA2. matic of the screening protocol. (FIG.5b) Graphic summary In one embodiment, the iPSC is differentiated into a cell of screening results plotted as Z-score values for each com selected from the group consisting of a cardiac myocyte, a pound. Negative scores indicate a decrease in ORO uptake Smooth muscle cell, and a skeletal muscle cell. 55 compared to DMSO-treated cells. Inset shows the functional In one embodiment, lipid accumulation is determined by classification of the top 50 hits. (FIG. 5c) Compound set the use of Oil Red O (ORO) staining. enrichment analysis, showing graphic depiction of enrich In one embodiment, the test compound or agent is selected ment of glycolytic Switch inducers among the top hits (most from the group consisting of a small molecule, a nucleic acid, negative Z-scores). The red-blue bar depicts the ranked list of a protein, a peptide, an antibody, and antibody-fragment. 60 analyzed compounds. Each vertical line shows the position of In one embodiment, the test compound or agent has a a glycolytic Switch compound in the rank list. The blue rect concentration in the range of 0.1 nM to 1000 mM. angle indicates the region of greatest enrichment of glycolytic In one embodiment, the test compound decreases lipid Switch compounds among the top-scoring compounds from accumulation by at least 5%, 10%, 20%, 30%, 40%, 50%, the ORO screen (i.e.9 out of the top 50 and 5 out of the top 10 50%, 70%, 80%, 90%, 1-fold, 1.1-fold, 1.5-fold, 2-fold, 65 are potential glycolytic switch compounds). See also FIG. 6 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold or more rela for secondary validation of 7 of the top hits representing tive to the control. different functional classes. US 9,393,221 B2 5 6 FIGS. 6a-6c depict that top-scoring screen hits demon genomic map of the homozygous mutation in exon 5 (LC1) strate robust lipid-lowering effect in ATGL-KO iPSCs. (FIG. and exon 7 (LC2) of two Japanese patients. (FIG.9b) Deter 6a) show bar graphs for relative ORO uptake for Fendiline, mination of TG content in differentiated human iPSCs treated Vinpocetine, Dicyclomine, Clidinium, Perhexyline, Metho with Mef, Per, Vin, and WY14643, a PPAR-alpha agonist. quine, and Tomatine respectively. ATGL-KO iPSCs were 5 treated with low (5 nM) and high (3-75 M) doses of selected DETAILED DESCRIPTION compounds from days 1 to 6 of differentiation in a monolayer, 96-well plate format. Data are plotted as the mean (n=12) Embodiments of the invention provide methods and com normalized ORO levels relative to the ORO levels of DMSO positions for the reduction of lipid accumulation within cells, treated ATGL-KO iPSCs (set to 1.0) and WT iPSCs (set to 10 either in vitro or in vivo. The methods comprise contacting 0.0) differentiated in parallel with the drug-treated KO cells. the cell, either in vitro or in vivo, with an effective amount of (FIG. 6b) is a bar graph of relative ORO uptake in KO iPSCs a compound described herein, e.g. a compound selected from (X-axis) after treatment from days 7-12 of differentiation with the compounds (y-axis). Data are plotted as means (n-3) Tables 1-3. relative to the levels in untreated KO cells WT cells, as in (a) 15 As used herein, the phrase “reducing intracellular lipid (*P-0.05, student's t-test when compared to DMSO-treated accumulation” refers to a decrease in lipid accumulation KO cells). (FIG. 6c) RT-PCR for cTnT, FoxA2, and Nestin in within cells as compared to a reference. In some embodi ATGL-KO iPSCs treated with compounds fendiline (F), vin ments, contacting of a cell with a compound described herein pocetin, (V), dicyclomine (D), tomatine (T), mefloquine (M), results in at least about 10%, at least about 20%, at least about and DMSO(S) from days 1-7 (D7) or days 7-12 (D12) of 20 30%, at least about 40%, at least about 50% at least about differentiation. Undifferentiated (DO) and differentiated but 60%, at least about 70%, at least about 80%, at least about untreated WT (W) and KO (K) iPSCs served as controls. 90%, or at least about 95% reduction of lipid accumulation, or H=no template control. about 2-fold, about 3-fold, about 4-fold, about 5-fold or more FIGS. 7a-7g depict that glycolytic switch inducers modu decrease in lipid accumulation as compared to control not late the metabolic profile of WT and KO iPSCs. Measurement 25 treated with the compound. of (FIG. 7a) oxygen consumption rate (OCR) and (FIG. 7b) Intracellular lipid accumulation can be assessed by means extracellular acidification rate (ECAR) in WT and KO iPSCs well known to those of skill in the art, for example in vitro at day 10 of differentiation following compound pre-treat (e.g., tissue samples or cells) by using colorimetric lipid ment for 16 h. Data are expressed as meants.d. (n=10 staining assays such as Oil Red O(ORO) staining of cells (e.g. samples, with 3 measurements each) relative to DMSO- 30 tissue sample) as described herein, or by commercially avail treated WT cells. (*P-0.001, student's t-test between com able triglyceride assay kits, e.g. TG-1TM kits from Zen-Bio, pound-treated and DMSO-1 treated cells of same type. Inc. Research Triangle Park, N.C. 27709. Triglyceride assay **P<0.001, student's t-test between DMSO-treated WT and kits provide quantitative data on triglyceride accumulation in KO cells). Measurement of OCAR/ECAR ratios for drug cultured or in primary cells (Whittaker, et al. Journal of treated (FIG. 7c) WT and (FIG. 7d.) KO iPSCs following 35 biomolecular screening, 2010, 15: 798-805). ORO staining of treatment carbonyl cyanide m-chlorophenyl hydrazone cells and tissue samples is described in, e.g., Fischer et al. (CCCP), at the time indicated (arrow). Antimycin, an electron Nature Genetics, 2007, 39(1):28-30; and Hirano et al. NEngl transport chain inhibitor, was added to each well at the end of J Med, 2008, 359:2396-2398, which are herein incorporated the assay to Verify that mitochondrial function was intact in by reference in their entirety. drug-treated cells. A schematic model of ATGL-1 mediated 40 Intracellular lipid accumulation can be assessed in vivo by lipid metabolism in shown for (FIG. 7e) WT cells, (FIG. 7?) assessing lipid deposition in a subject, e.g. by assessing the KO cells, and (FIG. 7g) drug-treated KO cells. body mass index (BMI) or the “lipid accumulation product FIGS. 8a–8fshow graphs of the in vivo validation of the (LAP) (Khan et al. BMC Cardiovascular Disorders, 2005, 5: drug hit efficacy on ATGL-KO mice. (FIG. 8a) Kaplan-Meier 26). LAP is a simple index for estimating lipid overaccumu survival plot of ATGL-KO mice treated with Mefloquine 45 lation among adults, designated the “lipid accumulation (N=15), Perhexyline (N=15), Vinpocetin low dose (N=15), product” (LAP), based on a combination of two measure Vinpocetin high dose (N=15), or water alone (N=15) (FIG. ments: 1) waist circumference (WC), a measure of truncal fat 8b) Contractile function of wild type mice treated with that includes the visceral (intra-abdominal) depot and 2) the Mefloquine (Mef), Perhexyline (Per), Vinpocetin (Vin), and fasting concentration of circulating triglycerides (TGS) (Bo water (None) at 3 weeks of age before drug treatment (black) 50 Zorgmanesh et al., Diabetes prediction, lipid accumulation and at 18 weeks of age (white) after drug treatment. (FIG. 8c) product, and adiposity measures; 6-year follow-up: Tehran Contractile function of ATGL-KO mice treated with Mef, Per, lipid and glucose study, Lipids in Health and Disease, 2010, Vin, and water at 3 weeks of age before drug treatment (black) 9:45). and at 10 (gray), and 14 (white) weeks of age after drug Contacting of Cells with Compounds treatment. (FIG. 8d) Measurement of triglyceride content in 55 Cells can be contacted with the compounds described hearts of 14 weeks old wild type (WT) and ATGL-KO (KO) herein in a cell culture e.g., in vitro or ex vivo, or adminis mice after treatment with the indicated drugs. V(H)—vinpo trated to a subject, e.g., in vivo. In some embodiments of the cetin high dose, V (L)—vinpocetin low dose. (FIG. 8e) Mea invention, a compound described herein is administrated to a Surement of triglyceride content in the liver, lung, and kidney Subject to treat or prevent a lipid/glycogen storage disorder of WT mice (gray) and ATGL-KO mice treated with Per (red), 60 including. In some embodiments of the invention, a com Mef (green), V (H) (blue), V (L) (orange), or water (black). pound described herein is administered to treat or prevent (FIG. 8f) Quantitative PCR analysis of metabolic gene obesity. expression in the hearts of 14 weeks old ATGL-KO mice The term “contacting or “contact as used herein in con treated with water (black), Per (red), and Mef (green) and in nection with contacting a cell includes Subjecting the cell to the hearts of age-matched WT mice (gray). 65 an appropriate culture media which comprises the indicated FIGS. 9a-9b show graphs of the effect of drug candidates compound or agent. Where the cell is in vivo, "contacting” or on differentiated NLSD-M human iPSCs. (FIG. 9a). A “contact” includes administering the compound or agent in a US 9,393,221 B2 7 8 pharmaceutical composition to a subject via an appropriate 70%, by at least 80%, or by at least 90%, as measured by a administration route Such that the compound or agent con reduction in the abnormal lipid accumulation within cells tacts the cell in vivo. (e.g. as determined by ORO staining). In one embodiment, For in vitro methods, cells can be obtained from different one or more symptoms of a lipid/glycogen storage disorder sources. For example, the contacted cell can be obtained from are alleviated by at least 20%, at least 30%, at least 40%, or at a subject, or the cell can be derived from a subject’s embry least 50%. In one embodiment, a symptom of a lipid/glyco onic stem cells (ESCs), or from a Somatic cell, e.g. an induced gen storage disorder is alleviated by more that 50%. In one pluripotent stem cell (undifferentiated or differentiated). In embodiment, the symptom of a lipid/glycogen storage disor Some embodiments, the Subject is suffering from a lipid/ der is alleviated by 80%, 90%, or greater. In some embodi glycogen storage disorder. In some embodiments, the Subject 10 ments, the symptoms of lipid/glycogen storage disorder is human. In some embodiments, the Subject is mouse. In improves by at least about 10%, 20%, 30%, 40%, 50%, 60%, Some embodiments, mouse is a transgenic mouse, e.g. a gene 70% or more. Clinicians are well versed in determination of knockout mouse (KO), or mouse comprising a mutated lipid/ symptom alleviation. glycogen storage disease gene. In one embodiment, in lipid/glycogen disorders associated For in vivo methods, a therapeutically effective amount of 15 with myopathy, muscular function is improved by at least a compound described herein can be administered to a Sub about 10%, 20%, 30%, 40%, 50%, 60%, 70% or more. ject. Methods of administering compounds to a subject are Examples of lipid/glycogen storage disorders include, but known in the art and easily available to one of skill in the art. are not limited to: Activator Deficiency/GM2 Gangliosidosis, As one of skill in the art is aware, reducing lipid accumu Alpha-mannosidosis, Aspartylglucosaminuria, Cholesteryl lation within cells in a Subject can lead to treatment, preven ester storage disease, Chronic Hexosaminidase A Deficiency, tion or amelioration of a number of lipid/glycogen storage Cystinosis, Danon disease, Fabry disease, Farber disease, disorders. As used herein, a “lipid/glycogen storage disorder Fucosidosis, Galactosialidosis, Gaucher Disease (e.g. Type I. refers to any disease or disorder caused by or associated with Type II, or Type III), GM1 gangliosidosis (e.g. Infantile, Late excess (pathological) accumulation of lipid, or glycogen, infantile/Juvenile, Adult/Chronic), I-Cell disease/Mucolipi within cells of the body, wherein the lipid/glycogen storage 25 dosis II, Infantile Free Sialic Acid Storage Disease/ISSD, disorder is not obesity. All types of cells within the body can Juvenile Hexosaminidase A Deficiency, Krabbe disease (e.g. be affected (e.g. Smooth muscle, skeletal muscle, adipocytes, Infantile Onset, Late Onset) Lysosomal acid lipase deficiency neuronal, epithelial cells, etc.). Representative examples (e.g. Early onset or Late onset), Metachromatic Leukodystro lipid/glycogen storage disorders are described herein. phy, a Mucopolysaccharidoses disorder (e.g. Pseudo-Hurler Reducing lipid accumulation within cells in a subject can 30 polydystrophy/Mucolipidosis IIIA, MPSI Hurler Syndrome, also lead to treatment, prevention or amelioration, of obesity MPSI Scheie Syndrome, MPS I Hurler-Scheie Syndrome, in a subject. As used herein, the term “obesity' is a condition MPS II Hunter syndrome, Sanfilippo syndrome Type A/MPS in which an individual has an excess of body fat. Guidelines III A, Sanfilippo syndrome Type B/MPS III B, Sanfilippo for determination of obesity in a subject are well established syndrome Type C/MPS III C, Sanfilippo syndrome Type in the art, e.g. as determined by body mass index (BMI). The 35 D/MPS III D, Morquio Type A/MPS IVA, Morquio Type Body Mass Index (BMI) is calculated as body weight per B/MPS IVB, MPS IX Hyaluronidase Deficiency, MPS VI height in meters squared (kg/m). “Obesity” refers to a con Maroteaux-Lamy, MPS VII Sly Syndrome. Mucolipidosis dition whereby anotherwise healthy subject has a Body Mass I/Sialidosis, Mucolipidosis IIIC, Mucolipidosis type IV), Index (BMI) greater than or equal to 30 kg/m. An "obese Multiple sulfatase deficiency, Niemann-Pick Disease (e.g. subject' is an otherwise healthy subject with a Body Mass 40 Type A, Type B, or Type C), a Neuronal Ceroid Lipofuscino Index (BMI) greater than or equal to 30 kg/m or is a subject ses disorder (e.g., CLN6 disease (e.g. Atypical Late Infantile, with at least one co-morbidity with a BMI greater than or Late Onset variant, Early Juvenile), Batten-Spielmeyer-Vogt/ equal to 27 kg/m2. A “subject at risk of obesity' is an other Juvenile NCL/CLN3 disease, Finnish Variant Late Infantile wise healthy subject with a BMI of 25 kg/m to less than 30 CLN5, Jansky-Bielschowsky disease/Late infantile CLN2/ kg/m. In one embodiment, obesity is characterized by cen 45 TPP1 Disease, Kufs/Adult-onset NCL/CLN4 disease, North tral obesity (excessive fat tissue in and around the abdomen). ern Epilepsy/variant late infantile CLN8, Santavuori-Haltia/ Central obesity in males correlates to waist to hip ratio higher Infantile CLN1/PPT disease, Beta-mannosidosis), Pompe than 0.90; central obesity in females correlates to a waist to diseasef Glycogen storage disease type II, Hypertrophic car hip ratio higher than 0.85. diomyopathy (e.g. due to glycogen storage from AMPK By “treating a disorder (e.g. lipid/glycogen storage disor 50 gamma2 or LAMP2 mutation), Pycnodysostosis, Sandhoff der or obesity) is meant reversing, alleviating, ameliorating, disease/Adult Onset/GM2 Gangliosidosis, Sandhoff disease/ inhibiting, slowing down or stopping the progression, of the GM2 gangliosidosis-Infantile, Sandhoff disease/GM2 gan storage disorder, i.e. the severity of the storage disorder. By gliosidosis, Juvenile, Schindler disease, Salla disease/Sialic “preventing a disorder (e.g. lipid/glycogen storage disorder Acid Storage Disease, Tay-Sachs/GM2 gangliosidosis, and or obesity) is meant delaying or preventing the onset of Such 55 Wolman disease. a disorder (e.g. delaying or preventing the onset of pathologi Lipid/glycogen storage disorders are well known to those cal lipid deposition). of skill in the art and described in e.g.: A clinical guide to In one aspect, the invention described herein features a inherited metabolic diseases by Joe T. R. Clarke, Cambridge method for treating or preventing a lipid/glycogen storage University Press (2006); and in Inborn Metabolic Diseases: disorder in a subject, the method comprising: administering a 60 Diagnosis and Treatment, Springer Medzin Verieg (Ger therapeutically effective amount of a compound to a subject many), by John Fernandes, Jean-Marie Saudubray, and in need of treatment, wherein the compound is selected from Georges Van Den Berghe 4” edition, 2008., which are herein Table 1, Table 2, or Table 3, and wherein the compound incorporated by reference. A subset of lipid/glycogen storage reduces accumulation of lipids within cells. disorders are described herein. In one embodiment, treatment of a lipid/glycogen storage 65 Lipid Storage Disorders disorder alleviates lipid accumulation within cells by at least Lipid storage disorders are a group of metabolic disorders 20%, at least 30%, at least 40%, or at least 50%, by at least in which harmful amounts of lipids accumulate in various US 9,393,221 B2 10 cells and tissues in the body and include, but are not limited ily due to low blood platelets and experience fatigue due to to: Neutral lipid Storage disease, Gaucher disease, Niemann anemia. Depending on disease onset and severity, type 1 Pick disease, Fabry disease, Farber's disease, GM1 and GM2 patients may live well into adulthood. Many patients have a (e.g. Tay-Sachs disease, and Sandhoff disease) gangliosi mild form of the disease or may not show any symptoms. doses, Krabbé disease, Metachromatic leukodystrophy, and Type 2 (or acute infantile neuropathic Gaucher disease) typi Wolman's disease. Symptoms that can be alleviated and cally begins within 3 months of birth. Symptoms include an improved in a Subject and the enzyme deficiencies associated enlarged liver and spleen, abnormal eye movement, extensive with various lipid storage disorders are described in more and progressive brain damage, spasticity, seizures, limb rigid detail below. ity, and a poor ability to suck and swallow. Affected children In one aspect of the invention, the compounds of the inven 10 usually die before age 2. Type 3 (the chronic neuronopathic tion are used to treat or prevent a lipid storage disease. The form) can beginatany time in childhood or evenin adulthood. method comprises administering a therapeutically effective It is characterized by slowly progressive but milder neuro amount of a compound selected from Table 1, from Table 2, or logic symptoms compared to the acute or Type 2 Gaucher from Table 3, to a subject in need of treatment. disease. Major symptoms include an enlarged spleen and/or Neutral Lipid Storage Disease and Symptoms 15 liver, seizures, poor coordination, skeletal irregularities, eye In one embodiment the lipid storage disorder is Neutral movement disorders, blood disorders including anemia, and lipid storage disease (NLSD) (also known as “Chanarin-Dor respiratory problems. Patients often live to their early teen fman syndrome'). NLSD is an autosomal recessive disorder years and, in some cases, into adulthood. in which lipids are stored abnormally in organs and tissues In some embodiments, the compounds of the invention are throughout the body characterized by accumulation of trig administered in conjunction with additional therapies known lycerides in the cytoplasm of leukocytes, muscle, liver, fibro to be effective in the disorder. For example, for type 1 and blasts, and other tissue. NLSD. Individuals with NLSD suffer most type 3 Gaucher disease patients, enzyme replacement from cardiac and skeletal myopathy and hepatic Steatosis due treatment can be given intravenously every two weeks and to the accumulation of fats in muscle tissue. Other features of can dramatically decrease liver and spleen size, reduce skel NLSD include fatty liver, a weakened and enlarged heart 25 etal abnormalities, and reverse other manifestations. Surgery (cardiomyopathy), inflammation of the pancreas (pancreati to remove the spleen may be required on rare occasions (if the tis), and reduced thyroid activity (hypothyroidism). Muta patient is anemic or when the enlarged organ affects the tions in adipocyte triglyceride lipase (ATGL) regulatory pro patient’s comfort). Blood transfusion may benefit some ane tein CGI-58 cause NLSD-I, with additional symptoms of mic patients. Other patients may require joint replacement neurological defects (Lefevreet al. Am. J. Hum. Genet. 2001). 30 Surgery to improve mobility and quality of life. In one embodiment, the lipid storage disorder is neutral lipid Niemann-Pick Disease and Symptoms storage disease with myopathy (NLSD-M). Mutations in the In one embodiment the lipid storage disorder is a Niemann PNPLA2 gene cause NLSD-M, which is characterized by Pick disease. Niemann-Pick disease is a group of autosomal more severe myopathy than NLSD. The PNPLA2 gene recessive disorders caused by an accumulation of fat and encodes the enzyme adipose triglyceride lipase (ATGL), 35 cholesterol in cells of the liver, spleen, bone marrow, lungs, which plays a role in breaking triglycerides, the main source and, in some patients, brain. Neurological complications may of stored energy in cells. PNPLA2 gene mutations impair the include ataxia, eye paralysis, brain degeneration, learning ATGL enzyme’s ability to break down triglycerides, which problems, spasticity, feeding and Swallowing difficulties, then accumulate in muscle and tissues throughout the body, slurred speech, loss of muscle tone, hypersensitivity to touch, resulting in the signs and symptoms of neutral lipid storage 40 and some corneal clouding. A characteristic cherry-red halo disease with myopathy. Two out of six patients identified with develops around the center of the retina in 50 percent of NLSD-M die from heart failure (Fischer et al. Nat. Genet. patients. 2007). Niemann-Pick disease is currently subdivided into four Gaucher Disease and Symptoms. categories. Onset of type A, the most severe form, is in early In one embodiment the lipid storage disorder is Gaucher 45 infancy. Infants appear normal at birth but develop an disease. Gaucher disease is the most common of the lipid enlarged liver and spleen, Swollen lymph nodes, nodes under storage diseases and is caused by a deficiency of the enzyme the skin (Xanthemas), and profound brain damage by 6 glucocerebrosidase. Fatty material often collects in the months of age. The spleen may enlarge to as much as 10 times spleen, liver, kidneys, lungs, brain, and bone marrow. Symp its normal size and can rupture. These children become pro toms may include enlarged spleen and liver, liver malfunc 50 gressively weaker, lose motor function, may become anemic, tion, skeletal disorders and bone lesions that may cause pain and are susceptible to recurring infection. They rarely live and fractures, severe neurologic complications, Swelling of beyond 18 months. This form of the disease occurs most often lymph nodes and (occasionally) adjacent joints, distended in Jewish families. In the second group, called type B (or abdomen, a brownish tint to the skin, anemia, low blood juvenile onset), enlargement of the liver and spleen charac platelets, and yellow spots in the eyes. Persons affected most 55 teristically occurs in the pre-teen years. Most patients also seriously may also be more susceptible to infection. The develop ataxia, peripheral neuropathy, and pulmonary diffi disease affects males and females equally. culties that progress with age, but the brain is generally not Gaucher disease has three common clinical Subtypes. Type affected. Type B patients may live a comparatively long time 1 (or normeuropathic type) is the most common form of the but many require Supplemental oxygen because of lung disease. It occurs most often among persons of Ashkenazi 60 involvement. Niemann-Pick types A and B result from accu Jewish heritage. mulation of the fatty Substance called sphingomyelin, due to Symptoms of Gaucher disease may begin early in life or in deficiency of an enzyme called sphingomyelinase. adulthood and include enlarged liver and grossly enlarged Niemann-Pick disease also includes two other variant spleen, which can rupture and cause additional complica forms called types C and D. These may appear early in life or tions. Skeletal weakness and bone disease may be extensive. 65 develop in the teen or even adult years. Niemann-Pick disease The brain is not affected, but there may be lung and, rarely, types C and Dare not caused by a deficiency of sphlingomy kidney impairment. Patients in this group usually bruise eas elinase but by a lack of the NPC1 or NPC2 proteins. As a US 9,393,221 B2 11 12 result, various lipids and particularly cholesterol accumulate shortening of muscles or tendons around joints), hoarseness, inside nerve cells and cause them to malfunction. Patients and Xanthemas which thicken around joints as the disease with types C and D have only moderate enlargement of their progresses. Patients with breathing difficulty may require spleens and livers. Brain involvement may be extensive, lead insertion of a breathing tube. Most children with the disease ing to inability to look up and down, difficulty in walking and 5 die by age 2, usually from lung disease. In one of the most Swallowing, and progressive loss of vision and hearing. Type severe forms of the disease, an enlarged liver and spleen D patients typically develop neurologic symptoms later than (hepatosplenomegaly) can be diagnosed soon after birth. those with type C and have a progressively slower rate of loss Children born with this form of the disease usually die within of nerve function. Most type D patients share a common 6 months. ancestral background in Nova Scotia. The life expectancies of 10 Farber's disease is caused by a deficiency of the enzyme patients with types C and D vary considerably. Some patients called ceramidase. Currently there is no specific treatment for die in childhood while others who appear to be less severely Farber's disease. Corticosteroids may be prescribed to relieve affected can live into adulthood. Children usually die from pain. Bone marrow transplants may improve granulomas infection or progressive neurological loss. (Small masses of inflamed tissue) on patients with little or no In some embodiments of the invention, the compounds of 15 lung or nervous system complications. Older patients may the invention are administered in conjunction with additional have granulomas Surgically reduced or removed. therapies, e.g. patients with types C and D are frequently Gangliosidoses and Symptoms placed on a low-cholesterol diet and/or cholesterol lowering In one embodiment the lipid storage disorder is a gangli drugs, although research has not shown these interventions osidose. The gangliosidoses are comprised of two distinct change the abnormal cholesterol metabolism or halt progres groups of genetic diseases. Both are autosomal recessive and sion of the disease. affect males and females equally. The GM1 gangliosidoses Fabry Disease and Symptoms are caused by a deficiency of the enzyme beta-galactosidase, In one embodiment the lipid storage disorder is Fabry resulting in abnormal storage of acidic lipid materials par disease. Fabry disease, also known as alpha-galactosidase-A ticularly in the nerve cells in the central and peripheral ner deficiency, causes a buildup offatty material in the autonomic 25 Vous systems. GM1 gangliosidosis has three clinical presen nervous system, eyes, kidneys, and cardiovascular system. tations: early infantile, late infantile, and adult. Signs of early Fabry disease is the only X-linked lipid storage disease. infantile GM1 (the most severe subtype, with onset shortly Males are primarily affected although a milder form is com after birth) may include neurodegeneration, seizures, liver mon in females. Occasionally, affected females have severe and spleen enlargement, coarsening of facial features, skel manifestations similar to those seen in males with the disor 30 etal irregularities, joint stiffness, distended abdomen, muscle der. Onset of symptoms is usually during childhood or ado weakness, exaggerated Startle response, and problems with lescence. Neurological signs include burning pain in the arms gait. About half of affected patients develop cherry-red spots and legs, which worsens in hot weather or following exercise, in the eye. Children may be deaf and blind by age 1 and often and the buildup of excess material in the clear layers of the die by age 3 from cardiac complications or pneumonia. Onset cornea (resulting in clouding but no change in vision). Fatty 35 of late infantile GM1 gangliosidosis is typically between ages storage in blood vessel walls may impair circulation, putting 1 and 3 years. Neurological signs include ataxia, seizures, the patient at risk for stroke or heart attack. Other manifesta dementia, and difficulties with speech. Onset of adult GM1 tions include heart enlargement, progressive kidney impair gangliosidosis is between ages 3 and 30. Symptoms include ment leading to renal failure, gastrointestinal difficulties, muscle atrophy, neurological complications that are less decreased Sweating, and fever. Angiokeratomas (Small, non 40 severe and progress at a slower rate than in other forms of the cancerous, reddish-purple elevated spots on the skin) may disorder, corneal clouding in Some patients, and dystonia develop on the lower part of the trunk of the body and become (Sustained muscle contractions that cause twisting and repeti more numerous with age. Patients with Fabry disease often tive movements or abnormal postures). Angiokeratomas may die prematurely of complications from heart disease, renal develop on the lower part of the trunk of the body. The size of failure, or stroke. 45 the liver and spleen in most patients is normal. In some embodiments, the compounds are administered in The GM2 gangliosidoses also cause the body to store conjunction with additional therapies, e.g. drugs such as phe excess acidic fatty materials in tissues and cells, most notably nyloin and carbamazepine are often prescribed to treat pain in nerve cells. These disorders result from a deficiency of the that accompanies Fabry disease and metoclopramaide or Lip enzyme beta-hexosaminidase. The GM2 disorders include isorb (a nutritional Supplement) can ease gastrointestinal dis 50 Tay-Sachs disease and Sandhoff diseases. tress that often occurs in Fabry patients, and some individuals Tay-Sachs disease (also known as GM2 gangliosidosis may require kidney transplant or dialysis. Enzyme replace variant B). Tay-Sachs and its variant forms are caused by a ment can reduce storage, ease pain, and improve organ func deficiency in the enzyme hexosaminidase A. The incidence is tion in patients with Fabry disease. particularly high among Eastern European and Ashkenazi Farber's Disease and Symptoms 55 Jewish populations, as well as certain French Canadians and Farber's disease, also known as Farber's lipogranulomato Louisianan Cajuns. Affected children appear to develop nor sis, describes a group of rare autosomal recessive disorders mally for the first few months of life. Symptoms begin by 6 that cause an accumulation of fatty material in the joints, months of age and include progressive loss of mental ability, tissues, and central nervous system. The disorder affects both dementia, decreased eye contact, increased startle reflex to males and females. Disease onset is typically in early infancy 60 noise, progressive loss of hearing leading to deafness, diffi but may occur later in life. Children who have the classic form culty in Swallowing, blindness, cherry-red spots in the retinas, of Farber's disease develop neurological symptoms within and some paralysis. Seizures may begin in the child's second the first few weeks of life. These symptoms may include year. Children may eventually need a feeding tube and they moderately impaired mental ability and problems with Swal often die by age 4 from recurring infection. No specific treat lowing. The liver, heart, and kidneys may also be affected. 65 ment is available. Anticonvulsant medications may initially Other symptoms may include Vomiting, arthritis, Swollen control seizures. Other Supportive treatment includes proper lymph nodes, Swollen joints, joint contractures (chronic nutrition and hydration and techniques to keep the airway US 9,393,221 B2 13 14 open. A rarerform of the disorder, called late-onset Tay-Sachs adult form, symptoms begin after age 16 and may include disease, occurs in patients in their twenties and early thirties impaired concentration, depression, psychiatric distur and is characterized by unsteadiness of gait and progressive bances, ataxia, seizures, tremor, and dementia. Death gener neurological deterioration. ally occurs within 6 to 14 years after onset of symptoms. Sandhoff disease (variant AB). This is a severe form of 5 Bone marrow transplantation may delay progression of the Tay-Sachs disease. Onset usually occurs at the age of 6 disease in some cases. Considerable progress has been made months and is not limited to any ethnic group. Neurological with regard to gene therapies in animal models of MLD. signs may include progressive deterioration of the central Wolman's Disease and Symptoms nervous system, motor weakness, early blindness, marked In one embodiment the lipid storage disorder is Wolman’s startle response to Sound, spasticity, myoclonus (shock-like 10 disease. Wolman's disease, also known as acid lipase defi contractions of a muscle), seizures, macrocephaly (an abnor ciency, is a severe lipid storage disorder that is usually fatal by mally enlarged head), and cherry-red spots in the eye. Other age 1. This autosomal recessive disorder is marked by accu symptoms may include frequent respiratory infections, mur mulation of cholesteryl esters (normally a transport form of murs of the heart, doll-like facial features, and an enlarged cholesterol) and triglycerides (a chemical form in which fats liver and spleen. There is no specific treatment for Sandhoff 15 exist in the body) that can build up significantly and cause disease. As with Tay-Sachs disease, Supportive treatment damage in the cells and tissues. Both males and females are includes keeping the airway open and proper nutrition and affected by this disorder. Infants are normal and active at birth hydration. Anticonvulsant medications may initially control but quickly develop progressive mental deterioration, seizures. Children generally die by age 3 from respiratory enlarged liver and grossly enlarged spleen, distended abdo infections. men, gastrointestinal problems including steatorrhea (exces Krabbé Disease and Symptoms sive amounts of fats in the stools), jaundice, anemia, Vomit In one embodiment the lipid storage disorder is Krabbé ing, and calcium deposits in the adrenal glands, causing them disease. Krabbé disease (also known as globoid cell leukod to harden. yStrophy and galactosylceramide lipidosis) is an autosomal Cholesteryl Ester Storage Disease and Symptoms recessive disorder caused by deficiency of the enzyme galac 25 In one embodiment the lipid storage disorder is Cholesteryl tocerebrosidase. The disease most often affects infants, with ester storage disease, which is characterized by an acid lipase onset before age 6 months, but can occur in adolescence or deficiency. Cholesteryl ester storage disease results from Stor adulthood. The buildup of undigested fats affects the growth age of cholesteryl esters and triglycerides in cells in the blood of the nerves protective myelin sheath and causes severe and lymph and lymphoid tissue. Children develop an enlarged deterioration of mental and motor skills. Other symptoms 30 liver leading to cirrhosis and chronic liver failure before include muscle weakness, hypertonia (reduced ability of a adulthood. Children may also have calcium deposits in the muscle to stretch), myoclonic seizures (sudden, shock-like adrenal glands and may develop jaundice late in the disorder. contractions of the limbs), spasticity, irritability, unexplained Glycogen Storage Disorders fever, deafness, optic atrophy and blindness, paralysis, and Herein, the inventors have identified compounds that shift difficulty when Swallowing. Prolonged weight loss may also 35 cellular energy metabolism from fatty acid oxidation to gly occur. The disease may be diagnosed by its characteristic colysis. Such compounds render a cell more likely to utilize grouping of cells into globoid bodies in the white matter of the glucose Substrates more readily as an energy source. Accord brain, demyelination of nerves and degeneration, and ingly, in one aspect of the invention, the compounds of the destruction of brain cells. In infants, the disease is generally invention are used to treat or prevent a glycogen storage fatal before age 2. Patients with a later onset form of the 40 disease. The method comprises administering a therapeuti disease have a milder course of the disease and live signifi cally effective amount of the compound to a subject in need of cantly longer. treatment, wherein the compound is selected from Table 1, Metachromatic Leukodystrophy and Symptoms from Table 2, or from Table 3. In one embodiment the lipid storage disease is a Metach Glycogen storage disease (GSD) (also glycogenosis and romatic leukodystrophy (MLD). MLD is a group of disorders 45 dextrinosis) is the result of defects in the processing of gly marked by storage buildup in the white matter of the central cogen synthesis or breakdown within muscles, liver, and nervous system and in the peripheral nerves and to some other cell types. GSD may be genetic and acquired. Genetic extent in the kidneys. Similar to Krabbé disease, MLD affects GSD is caused by any inborn error of metabolism (genetically the myelin that covers and protects the nerves. This autosomal defective enzymes) involved in these processes. In livestock, recessive disorder is caused by a deficiency of the enzyme 50 acquired GSD is caused by intoxication with the alkaloid arylsulfatase A. Both males and females are affected by this castanospermine. Non-limiting examples of glycogen Stor disorder. age diseases include Von Gierke’s disease, Pompe's disease, MLD has three characteristic phenotypes: late infantile, Cori's disease or Forbes’ disease, Andersen disease, McArdle juvenile, and adult. The most common form of the disease is disease, Hers’ disease, Tarui's disease, Fanconi-Bickel Syn late infantile, with onset typically between 12 and 20 months 55 drome. following birth. Infants may appear normal at first but develop A person with a Glycogen Storage Disease (GSD) has an difficulty in walking and a tendency to fall, followed by absence or deficiency of one of the enzymes responsible for intermittent pain in the arms and legs, progressive loss of making or breaking down glycogen in the body. This is called vision leading to blindness, developmental delays, impaired an enzyme deficiency. The enzyme deficiency causes either Swallowing, convulsions, and dementia before age 2. Chil 60 abnormal tissue concentrations of glycogen (too much or too dren also develop gradual muscle wasting and weakness and little) or incorrectly or abnormally formed glycogen (shaped eventually lose the ability to walk. Most children with this wrong). Depending on the type of GSD a person has, their form of the disorder die by age 5. Symptoms of the juvenile enzyme deficiency may be important in all parts of the body, form typically begin between ages 3 and 10. Symptoms or only in some parts of the body, like the liver or muscle. include impaired School performance, mental deterioration, 65 Typically, the forms of GSD are described by the part of the ataxia, seizures, and dementia. Symptoms are progressive body that has trouble because of the enzyme deficiency. The with death occurring 10 to 20 years following onset. In the categories most often are: the liver only, the muscles only, or US 9,393,221 B2 15 16 both the liver and the muscles. Other systems that may be ides, lipids (fats), uric acid and other by-products of metabo involved include blood cells (red blood cells, white blood lism increase in the blood as the body tries to raise blood cells, and platelets), heart, and kidneys amongst others. Sugar. Fats get stored in the liver along with the glycogen, All types of GSD cause the body to either not be able to which leads to the enlargement of the liver. The liver does its make enough glucose, or not be able to use glucose as a form many other functions normally, and there is not usually any of energy. Determining what type of GSD a person has (diag evidence of liver failure. The kidneys are also enlarged due to nosis) depends on an individual’s symptoms. Typically a increased glycogen storage. The continued presence of low doctor will do a physical examination and some blood and blood Sugar can eventually leads to delayed growth and devel urine testing. Occasionally, a muscle and/or liver biopsy will opment as well as abnormal levels of some metabolites (sub be needed to measure the amount of a certain enzyme in that 10 stances) in the blood and urine. High blood pressure has also part of the body. been seen in a number of individuals and when this occurs, Pompe Disease and Symptoms appropriate treatment is needed. In one embodiment the glycogen storage disorder is Pompe In addition to the problems described above, individuals disease (also known as GSDII). Pompe disease is an inherited with Glycogen Storage Disease Type Ib can develop frequent and often fatal disorder that disables the heart and muscles. It 15 bacterial and fungal infections, due to abnormal functioning is caused by mutations in a gene that makes an enzyme called of the white blood cells called neurophils. These are the alpha-glucosidase (GAA). Normally, the body uses GAA to fighter cells of the body. Therefore, people with GSD Ib can break down glycogen, a stored form of Sugar used for energy. have low levels of neutrophils in their blood (a finding called But in Pompe disease, mutations in the GAA gene reduce or neutropenia). Many people with GSD Ib use a medicine completely eliminate this essential enzyme. Excessive called GCSF to increase the number of neutrophils in the amounts of glycogen accumulate everywhere in the body, but body. People with Glycogen Storage Disease Type Ib may the cells of the heart and skeletal muscles are the most seri also develop chronic pancreatitis, chronic inflammatory ously affected. Researchers have identified up to 70 different bowel disease, and Crohn's disease. mutations in the GAA gene that cause the symptoms of Patients with Type I Glycogen Storage Disease may Pompe disease, which can vary widely in terms of age of 25 develop benign tumors in the liver called hepatic adenomas. onset and severity. The severity of the disease and the age of Adenomas are usually first noted around the time of puberty. onset are related to the degree of enzyme deficiency. They typically do not cause symptoms and are identified by Early onset (or infantile Pompe disease is the result of routine imaging studies of the liver. In rare instances these can complete or near complete deficiency of GAA. Symptoms develop into liver cancer. begin in the first months of life, with feeding problems, poor 30 Renal (kidney) disease is another complication in GSDI weight gain, muscle weakness, floppiness, and headlag. Res patients, and most patients with type I glycogen storage dis piratory difficulties are often complicated by lung infections. ease older than age 20 yr have proteinuria (proteins excreted The heart is grossly enlarged. More than half of all infants in urine). Many also have hypertension (high blood pressure), with Pompe disease also have enlarged tongues. Most babies and kidney Stones, among other changes in kidney functions. with Pompe disease die from cardiac or respiratory compli 35 More severe kidney injury may occur with large amounts of cations before their first birthday. protein in the urine, high blood pressure, and decreased abil Late onset (or juvenile/adult) Pompe disease is the result of ity of the kidneys to filter waste products due to damage to the a partial deficiency of GAA. The onset can be as early as the filtering units of the kidney (glomeruli). In some patients with first decade of childhood or as late as the sixth decade of the advancement of renal/kidney disease, kidney failure can adulthood. The primary symptom is muscle weakness pro 40 happen which can require dialysis and eventually kidney gressing to respiratory weakness and death from respiratory transplantation. Other complications can include pulmonary failure after a course lasting several years. The heart may be hypertension, radiographic (X-ray) evidence of osteopenia involved but it will not be grossly enlarged. A diagnosis of (weak bones), and fractures. Pompe disease can be confirmed by Screening for the com Type I GSD can be diagnosed through blood studies such mon genetic mutations or measuring the level of GAA 45 as blood glucose, cholesterol, triglycerides, lactate, and uric enzyme activity in a blood sample. acid, measurements of growth, and ultrasound or other imag von Gierke Disease and Symptoms ing studies to measure the size of the liver and kidneys. By In one embodiment the glycogen storage disorder is von looking for changes in the genes associated with GSD I. Gierke disease (also known as Glycogen storage disease genetic (DNA) testing can be used to diagnose the majority of (GSD) type I or hepatorenal glycogenosis). GSD type I is 50 individuals with GSD Type Ia and Ib. Sometimes liver biopsy divided into GSD type Ia caused by a glucose-6-phosphatase analysis will be needed to examine the enzyme levels of (G6Pase) deficiency and GSD type Ib resulting from defi someone Suspected to have Type I Glycogen Storage Disease, ciency of a specific translocase T1. Patients with GSD type Ib especially in situations when DNA testing is negative and the have altered neutrophil functions predisposing them togram clinical suspicion of GSDI is high. positive bacterial infections. GSD type Ic is deficiency of 55 Forbes-Cori Disease and Symptoms translocase T2 that carries inorganic phosphates from In one embodiment the glycogen storage disorder is microsomes into the cytosol and pyrophosphates from the Forbes-Cori disease (also known as GSD type III or limit cytosol into microsomes. GSD type Id is deficiency in a dextrinosis). In contrast to GSD type I, liver and skeletal transporter that translocates free glucose molecules from muscles are involved in GSD type III. Glycogen deposited in microsomes into the cytosol. GSD type Ia demonstrates defi 60 these organs has an abnormal structure. Differentiating cient G6Pase activity in the fresh and frozen livertissue. GSD patients with GSD type III from those with GSD type I solely type Ib demonstrates normal G6Pase activity in the frozen on the basis of physical findings is not easy. tissue samples and lowered activity in the fresh specimens. There are two types of GSDIII known as type Ma and type People with Type I GSD are able to store glucose as gly Mb. Most patients with Type IIIGSD have enzyme deficiency cogen but notable to release it normally, with time the stores 65 (i.e. glycogen debrancher enzyme (GDE) deficiency) in liver of glycogen build up in the liver causing the liver to Swell and skeletal muscle. Patients that have enzyme deficiency in (hepatomegaly). Levels of hormones, lactic acid, triglycer liver and muscle (including sometimes the heart muscle) have US 9,393,221 B2 17 18 what is know as type GSD Ma. Some patients (<15%) have develop poor tone. The course of the disease is one of pro debranching enzyme deficiency only in the liver which is type gressive cirrhosis and associated problems. Death typically GSD Mb. During early years of infancy and childhood, the occurs by five years of age. disease may present clinically just like GSDI: Small stature, McArdle Disease and Symptoms large liver, poor muscle tone (hypotonia) and hypoglycemia. In one embodiment, the glycogen storage disorder is Some liver symptoms (enlarged liver) often improve with age McArdel disease, GSD type V, also known as McArdle dis and may disappear after puberty. However, in some patients ease, affects the skeletal muscles. Initial signs of the disease liver cirrhosis (damage to liver cells) can occur due to accu usually develop in adolescents or adults. Muscle phosphory mulation of abnormal glycogen. lase deficiency adversely affects the glycolytic pathway in 10 skeletal musculature causes GSD type V. Like other forms of Children with GSD III are often first diagnosed because GSD, McArdle disease is heterogeneous. they have swollen (distended) abdomens (belly) due to a very People with Type V GSD experience problems performing large liver. Some children have problems with low blood and completing most exercises, especially anaerobic exer Sugars when fasting (not eating for 4 hours) but this is not as cises. Because they lack the enzyme to metabolize glycogen, common or as severe as in GSDI. Growth may be delayed or 15 which is the main source of energy for anaerobic activity, slow during childhood but most individuals reach a normal their body struggles to find other sources of energy to com adult height. Muscle weakness (GSD Ma) is commonly plete a given activity or exercise. Under these circumstances, present in childhood and can, at times, become severe in adult the body breaks down muscle when trying to attain energy. age (requiring use of a wheel chair for mobility by 50-60 This causes many symptoms such as muscle pain, muscle years). Although the enzyme defect does not go away, the cramping, muscle fatigue, and muscle tenderness. With the liver often returns to a smaller size at puberty. breakdown of muscle (rhabdomyolysis) and the release of the Elevated glycogen content is present in liver and muscle red protein myoglobin, myoglobinuria may develop, as evi cells. A definite diagnosis and Sub-typing (determining Ma denced by dark-red or red-brown urine. Serum creatine versus IIIb type) requires either liver biopsies or DNA based kinase levels will be greatly elevated. genetic testing. Biopsy of the liver shows inflammatory 25 The physical exam of patients with Type V glycogen stor changes (swollen liver cells) with great elevations of abnor age disease is normal. They complain of painful muscle mal-structured glycogen content and a deficiency of the cramps after exercise. These persons are commonly muscu debrancher enzyme (GDE). In GSD Ma, biopsy of muscle lar, they do not have large livers, and are normal in height. and liver shows an accumulation of abnormal-structured gly Their liver phosphorylase activity is normal, and they do not cogen and deficiency of debrancher enzyme. However, if only 30 have hypoglycemia. A muscle biopsy will show increased the liver is examined, the type of GSD cannot be determined. concentrations of glycogen, and a deficiency of the phospho If genetic testing is performed and the person has a gene rylase enzyme. change in the area associated with GSD Mb, a doctor may be Hers Disease and Symptoms able to use the mutation information and clinical information In one embodiment, the glycogen storage disorder Hers to determine GSD III type (type a versus type b). 35 disease. GSD type VI, also known as Hers disease, belongs to Other complications associated with GSD III can include the group of hepatic glycogenoses. Hepatic phosphorylase radiographic (X-ray) evidence of osteopenia (weak bones) deficiency or deficiency of other enzymes that form a cascade and fractures. Often, a DEXA bone scan will be required to necessary for liver phosphorylase activation cause the dis measure bone density. Also, chemical analysis of the blood CaSC. usually shows low blood sugar and elevated levels of fat 40 Clinically, this form of glycogen storage disease appears to (cholesterol/lipids). However, uric acid and lactic acid levels, be similar to, but is usually considerably milder than glucose which are usually elevated in GSDI patients, are usually 6-phosphatase deficiency GSD (type I GSD) since glucose normal. can be made from protein. These patients present with Andersen Disease and Symptoms hepatomegaly (liver enlargement) and growth retardation In one embodiment, the glycogen storage disorder is 45 early in childhood. Since people with Type VI GSD are able Andersen disease. GSD type IV, also known as amylopecti to store glucose as glycogen but not able to release it nor nosis or Andersen disease, is a rare disease that leads to early mally, with time the stores of glycogen build up in the liver death. In 1956, Andersen reported the first patient with pro causing the liver to Swell (hepatomegaly). Hypoglycemia gressive hepatosplenomegaly and accumulation of abnormal (low blood Sugars) and elevated ketone concentrations in the polysaccharides. The main clinical features are liver insuffi 50 blood and urine after a period of fasting are the hallmarks of ciency and abnormalities of the heart and nervous system. these disorders. Hyperlipidemia (elevated cholesterol and In Type IV GSD there is not an increased amount of gly fats in the blood) and abnormalities in the liver function tests cogen in the tissues, as in other forms of GSD. Instead, the are usually mild if present. Lactic acid and uric acid are glycogen that does accumulate has very long outer branches, normal. The heart and skeletal muscles are not involved. The because there is a genetic deficiency of the branching 55 hepatomegaly improves with good metabolic control. enzyme. This structural abnormality of the glycogen is Hepatic adenomas are rare in well treated individuals with thought to trigger the body's immune system, causing the GSD VI, and liver failure does not occur. body to actually attack the glycogen and the tissues in which The diagnosis of this disease can be made by genetic test it is stored. The result is tremendous scarring (cirrhosis) of the ing from DNA extracted from blood or saliva. Liver biopsies liver as well as other organs, such as muscle. The typical 60 to measure phosphorylase activity, which is reduced in this symptomatology of this disease is the result of the Scarring disease, are not necessary in most cases and not recom process. mended if type VI GSD is suspected. Ababy with the typical Type IV GSD appears to be normal Tarui Disease and Symptoms at birth. The first indication of a problem is a failure to thrive. In one embodiment, the glycogen storage disorder Tarui The rate of growth and mental progress of the baby stops at a 65 disease. GSD type VII, also known as Tarui disease, arises as certain point and does not continue normally. The liver and a result of phosphofructokinase (PFK) deficiency. The spleen enlarge, there is little weight gain, and muscles enzyme is located in skeletal muscles and erythrocytes. The US 9,393,221 B2 19 20 clinical and laboratory features are similar to those of GSD reduces accumulation of lipids within cells. In one embodi type V. Patients experience early onset of fatigue and muscle ment, the lipid deposition in obesity is alleviated by at least pain with exercise. The body breaks down muscle when try 20%, at least 30%, at least 40%, or at least 50%, e.g. as ing to attain energy, which causes many symptoms Such as measured by a reduction in Body Mass Index (BMI). In one muscle pain, muscle cramping, muscle fatigue, and muscle 5 embodiment, one more symptoms associated with obesity are tenderness. With the breakdown of muscle (rhabdomyolysis) alleviated by at least 20%, at least 30%, at least 40%, or at and the release of the red protein myoglobin, myoglobinuria least 50%. In one embodiment, the lipid deposition in obesity may develop, as evidenced by dark-red or red-brown urine. is alleviated is alleviated by more that 50%. In some embodi However, exercise intolerance is evident in childhood and ments, the symptoms of obesity improves by at least about symptoms are more severe than in Type V GSD. Diagnosis of 10 Type VII Glycogen Storage Disease is done by muscle 10%, 20%, 30%, 40%, 50%, 60%, 70% or more. biopsy, with a deficiency of the muscle phosphofructokinase Symptoms of obesity include, but are not limited to, diffi enzyme and a modest accumulation of glycogen found. culty in doing daily activities, lethargy, breathlessness, Patients may also display a hemolytic anemia. increased weight, and secondary problems, e.g. heart disease, In one embodiment, the lipid/glycogen storage disorder is 15 high blood pressure, type 2 diabetes, gallstones, breathing characterized by myopathy. In one embodiment the myopa problems, and certain cancers. thy is a lipid storage myopathy. In some embodiments, the methods described herein fur In one embodiment, the myopathy is cardiomyopathy. ther comprise selecting a subject diagnosed with obesity. In one embodiment, the lipid/glycogen storage disorder Diagnosis of obesity can be made through clinical evaluation. characterized by myopathy is neutral lipid storage disease In one embodiment diagnosis is based upon in a Body Mass (NLSD). In one embodiment, the lipid/glycogen storage dis Index (BMI) greater than or equal to 30 kg/m. In one order characterized by myopathy is neutral lipid storage dis embodiment diagnosis is made based upon excessive fattis ease associated with myopathy (NLSD-M). Thus, in one Sue in and around the abdomen, i.e. a waist to hip ratio higher aspect of the invention, a method is provided for treating or than 0.90 in men or a waist to hip ratio higher than 0.85 in preventing neutral lipid storage disease (e.g. NLSD or NLSD 25 WOC. M) in a subject in need of treatment, the method comprising Compounds administering to a Subject a therapeutically effective amount The compounds of the present invention are useful in the of compound selected from Table 1, Table 2, or Table 3. In one methods described herein for reducing the accumulation of embodiment, the compound is selected from Table 1. In one lipids within cells, and accordingly are useful for the treat embodiment the compound is selected from Table 2. In on 30 ment and prevention of a lipid/glycogen storage diseases, as embodiment, the compound is selected from Table 3. well as for the treatment and prevention of obesity. In one In some embodiments of the methods described herein embodiment, the compound for use in methods of the present further comprise selecting a Subject diagnosed with a lipid/ invention is a compound selected from the compounds listed glycogen storage disorder. Diagnosis can be made through in Table 1. In one embodiment, the compound for use in clinical examination, biopsy, genetic testing (for mutations 35 methods of the present invention is a compound selected from predictive of the disorder), molecular analysis of cells or the compounds listed in Table 2. In one embodiment, the tissues, and enzyme assays (testing a variety of cells or body compound for use in methods of the present invention is a fluids for enzyme deficiency). A subject suffering from a compound selected from the compounds listed in Table 3. lipid/glycogen storage disorder can further be selected based The compounds described herein are positive hits from a on the symptoms presented. For example, a Subject diagnosed 40 screen using the Prestwick CollectionTM of off-patent drugs as Suffering from Gaucher disease may based on the presence (generic), and all are commercially available. Commercial of an enlarged spleen and liver, liver malfunction, skeletal Sources of the compounds include, for example, Prestwick disorders and bone lesions that may cause pain and fractures, Chemical, Washington, D.C.; and Sigma-Aldrich Co., St. severe neurologic complications, Swelling of lymph nodes Louis, Mo. Alternatively, the compounds described herein and (occasionally) adjacent joints, distended abdomen, a 45 can be synthesized using means well known to those of skill brownish tint to the skin, anemia, low blood platelets, and in the art. The compounds may beformulated in combination yellow spots in the eyes, and/or the presence of a deficiency of with additional compounds (e.g. compounds useful for treat the enzyme glucocerebrosidase. Symptoms and enzyme defi ment of symptoms of lipid/glycogen storage disorders) and ciencies of other various lipid/glygogen disorders are may be formulated as pharmaceutically acceptable composi described herein. 50 tions, See the heading “Formulations and administration', Biopsy for lipid or glycogen storage diseases involves herein. removing a small sample of the liver or other tissue and In one embodiment, the compound used in methods for studying it under a microscope, or subjecting the tissue reducing lipid accumulation with in cells is selected from the sample to quantitative/qualitative assays. In this procedure, a group consisting of Fendiline hydrochloride, Vinpocetine, physician will administer a local anesthetic and then remove 55 Mefloquine hydrochloride, Perhexyline maleate, Gossypol, a small piece of tissue either Surgically or by needle biopsy (a Butylparaben, Clotrimazole, Fluspirilen, Cinnarizine, Small piece of tissue is removed by inserting a thin, hollow Ebselen, Ethynodiol diacetate. Thiethylperazine malate, needle through the skin). The tissue sample is analyzed for Tamoxifen citrate, Chrysene-1,4-quinone, Biperiden hydro e.g. lipid deposition, or enzymatic activity. Genetic testing for chloride, Clemastine fumarate, GBR 12909 dihydrochloride, lipid/glycogen storage disease may be done to determine if 60 Chlorprothixene hydrochloride, Clomipramine hydrochlo they are carrying a mutated gene that causes the disorder. ride, Homosalate, Pimozide, Sulconazole nitrate, Naftifine Treatment and Prevention of Obesity hydrochloride, Piperidolate hydrochloride, Sertaconazole In another aspect, the invention described herein features a nitrate, Menadione, Phenforminhydrochloride, Cyclobenza method for treating or preventing obesity in a Subject, the prine hydrochloride, Triflupromazine hydrochloride, method comprising: administering a therapeutically effective 65 Methiothepin maleate, Phenoxybenzamine hydrochloride, amount of a compound to a Subject (e.g. a compound selected (1-(4-Chlorophenyl)phenyl-methyl-4-methylpiperazine), from Table 1, Table 2, or Table 3), wherein the compound Merbromin, Ascorbic acid, Bisacodyl, Altretamine, Test US 9,393,221 B2 21 22 osterone propionate, Cloperastine hydrochloride, Preg Table 2, or from Table 3, is not GM1 gangliosidosis (e.g. nenolone, Clomiphene citrate (Z.E), Nifuroxazide. Infantile, Late infantile/Juvenile, Adult/Chronic). In Some embodiments, the compound to reduce lipid accu In one embodiment the lipid/glycogen storage disorder to mulation in a cell is not one of the compounds selected from be treated with a compound selected from Table 1, or from the following list of compounds: Fendiline hydrochloride, Table 2, or from Table 3, is not I-Cell disease/Mucolipidosis Vinpocetine, Mefloquine hydrochloride, Perhexyline male II. ate, Gossypol, Butylparaben, Clotrimazole, Fluspirilen, Cin In one embodiment the lipid/glycogen storage disorder to narizine, Ebselen, Ethynodiol diacetate. Thiethylperazine be treated with a compound selected from Table 1, or from malate, Tamoxifen citrate, Chrysene-1,4-quinone, Biperiden Table 2, or from Table 3, is not infantile Free Sialic Acid hydrochloride, Clemastine fumarate, GBR 12909 dihydro 10 chloride, Chlorprothixene hydrochloride, Clomipramine Storage Disease/ISSD. hydrochloride, Homosalate, Pimozide, Sulconazole nitrate, In one embodiment the lipid/glycogen storage disorder to Naftifine hydrochloride, Piperidolate hydrochloride, Serta be treated with a compound selected from Table 1, or from conazole nitrate, Menadione, Phenformin hydrochloride, Table 2, or from Table 3, is not Juvenile Hexosaminidase A Cyclobenzaprine hydrochloride, Triflupromazine hydrochlo 15 Deficiency. ride, Methiothepin maleate, Phenoxybenzamine hydrochlo In one embodiment the lipid/glycogen storage disorder to ride, (1-(4-Chlorophenyl)phenyl-methyl-4-methylpipera be treated with a compound selected from Table 1, or from Zine), Merbromin, Ascorbic acid, Bisacodyl, Altretamine, Table 2, or from Table 3, is not Krabbe disease (e.g. Infantile Testosterone propionate, Cloperastine hydrochloride, Preg Onset, Late Onset). nenolone, Clomiphene citrate (Z.E), Nifuroxazide. In one embodiment the lipid/glycogen storage disorder to In one aspect, the invention described herein features a be treated with a compound selected from Table 1, or from method of treating a lipogen/glycogen storage disorder in a Table 2, or from Table 3, is not Lysosomal acid lipase defi Subject. The method comprises administering to a Subject a ciency (e.g. Early onset or Late onset). therapeutically effective amount of a compound selected In one embodiment the lipid/glycogen storage disorder to from Table 1, from Table 2, or from Table 3. 25 be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not Metachromatic Leukodystro be treated with a compound selected from Table 1, or from phy. Table 2, or from Table 3, is not Activator Deficiency/GM2 In one embodiment the lipid/glycogen storage disorder to Gangliosidosis. be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to 30 Table 2, or from Table 3, is not a Mucopolysaccharidoses be treated with a compound selected from Table 1, or from Table 2, or from Table 3, is not Alpha-mannosidosis. disorder (e.g. Pseudo-Hurler polydystrophy/Mucolipidosis In one embodiment the lipid/glycogen storage disorder to IIIA, MPSI Hurler Syndrome. be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not Aspartylglucosaminuria. 35 be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not MPSI Scheie Syndrome, MPS be treated with a compound selected from Table 1, or from I Hurler-Scheie Syndrome. Table 2, or from Table 3, is not Cholesteryl ester storage In one embodiment the lipid/glycogen storage disorder to disease. be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to 40 Table 2, or from Table 3, is not MPS II Hunter syndrome, be treated with a compound selected from Table 1, or from Sanfilippo syndrome Type A/MPS III A. Table 2, or from Table 3, is not Chronic Hexosaminidase A In one embodiment the lipid/glycogen storage disorder to Deficiency. be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not Sanfilippo syndrome Type be treated with a compound selected from Table 1, or from 45 B/MPS III B. Table 2, or from Table 3, is not Cystinosis. In one embodiment the lipid/glycogen storage disorder to In one embodiment the lipid/glycogen storage disorder to be treated with a compound selected from Table 1, or from be treated with a compound selected from Table 1, or from Table 2, or from Table 3, is not Sanfilippo syndrome Type Table 2, or from Table 3, is not Danon disease. C/MPS III C. In one embodiment the lipid/glycogen storage disorder to 50 In one embodiment the lipid/glycogen storage disorder to be treated with a compound selected from Table 1, or from be treated with a compound selected from Table 1, or from Table 2, or from Table 3, is not Fabry disease. Table 2, or from Table 3, is not Sanfilippo syndrome Type In one embodiment the lipid/glycogen storage disorder to D/MPS IIID. be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not Farber disease. 55 be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not Morquio Type A/MPS IVA or be treated with a compound selected from Table 1, or from Morquio Type B/MPS IVB. Table 2, or from Table 3, is not Fucosidosis. In one embodiment the lipid/glycogen storage disorder to In one embodiment the lipid/glycogen storage disorder to be treated with a compound selected from Table 1, or from be treated with a compound selected from Table 1, or from 60 Table 2, or from Table 3, is not MPS IX Hyaluronidase Defi Table 2, or from Table 3, is not Galactosialidosis. ciency. In one embodiment the lipid/glycogen storage disorder to In one embodiment the lipid/glycogen storage disorder to be treated with a compound selected from Table 1, or from be treated with a compound selected from Table 1, or from Table 2, or from Table 3, is not Gaucher Disease (e.g. Type I, Table 2, or from Table 3, is not MPS VI Maroteaux-Lamy. Type II, or Type III). 65 In one embodiment the lipid/glycogen storage disorder to In one embodiment the lipid/glycogen storage disorder to be treated with a compound selected from Table 1, or from be treated with a compound selected from Table 1, or from Table 2, or from Table 3, is not MPS VII Sly Syndrome. US 9,393,221 B2 23 24 In one embodiment the lipid/glycogen storage disorder to In one embodiment the lipid/glycogen storage disorder to be treated with a compound selected from Table 1, or from be treated with a compound selected from Table 1, or from Table 2, or from Table 3, is not Mucolipidosis I/Sialidosis. Table 2, or from Table 3, is not Tay-Sachs/GM2 gangliosido In one embodiment the lipid/glycogen storage disorder to S1S. be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not Multiple sulfatase deficiency. be treated with a compound selected from Table 1, or from In one embodiment the lipid/glycogen storage disorder to Table 2, or from Table 3, is not Wolman disease. be treated with a compound selected from Table 1, or from In one aspect, the invention teaches a method for treating or Table 2, or from Table 3, is not Niemann-Pick Disease (e.g. preventing obesity in a Subject. The method comprises Type A, Type B, or Type C). 10 administering to a Subject a compound selected from Table 1, from Table 2, or from Table 3. In one embodiment the lipid/glycogen storage disorder to In some embodiments, the compound to treat obesity is not be treated with a compound selected from Table 1, or from one of the compounds selected from the following list of Table 2, or from Table 3, is not a Neuronal Ceroid Lipofus compounds: Fendiline hydrochloride, Vinpocetine, Meflo cinoses disorder (e.g., CLN6 disease (e.g. Atypical Late 15 quine hydrochloride, Perhexyline maleate, Gossypol, Infantile, Late Onset variant, Early Juvenile). Butylparaben, Clotrimazole, Fluspirilen, Cinnarizine, In one embodiment the lipid/glycogen storage disorder to Ebselen, Ethynodiol diacetate. Thiethylperazine malate, be treated with a compound selected from Table 1, or from Tamoxifen citrate, Chrysene-1,4-quinone, Biperiden hydro Table 2, or from Table 3, is not Batten-Spielmeyer-Vogt/ chloride, Clemastine fumarate, GBR 12909 dihydrochloride, Juvenile NCL/CLN3 disease. Chlorprothixene hydrochloride, Clomipramine hydrochlo In one embodiment the lipid/glycogen storage disorder to ride, Homosalate, Pimozide, Sulconazole nitrate, Naftifine be treated with a compound selected from Table 1, or from hydrochloride, Piperidolate hydrochloride, Sertaconazole Table 2, or from Table 3, is not Finnish Variant Late Infantile nitrate, Menadione, Phenforminhydrochloride, Cyclobenza CLN5. prine hydrochloride, Triflupromazine hydrochloride, In one embodiment the lipid/glycogen storage disorder to 25 Methiothepin maleate, Phenoxybenzamine hydrochloride, be treated with a compound selected from Table 1, or from (1-(4-Chlorophenyl)phenyl-methyl-4-methylpiperazine), Table 2, or from Table 3, is not Jansky-Bielschowsky disease/ Merbromin, Ascorbic acid, Bisacodyl, Altretamine, Test Late infantile CLN2/TPP1 Disease. osterone propionate, Cloperastine hydrochloride, Preg In one embodiment the lipid/glycogen storage disorder to nenolone, Clomiphene citrate (Z.E), Nifuroxazide. 30 In some embodiments, the compound to treat obesity is not be treated with a compound selected from Table 1, or from one of the compounds selected from the compounds listed in Table 2, or from Table 3, is not Kufs/Adult-onset NCL/CLN4 Table 1. disease. In other aspects of the invention, methods for treating In one embodiment the lipid/glycogen storage disorder to lipid/glycogen storage disorders and methods for treating be treated with a compound selected from Table 1, or from 35 obesity are provided; these methods comprise administering Table 2, or from Table 3, is not Northern Epilepsy/variant late atherapeutically effective amount of recombinant ATGL pro infantile CLN8. tein to a subject in need thereof (e.g. a subject diagnosed with, In one embodiment the lipid/glycogen storage disorder to or predisposed to having, a lipid/glycogen disorder or obesity be treated with a compound selected from Table 1, or from (e.g. prophylactic administration)). Table 2, or from Table 3, is not Santavuori-Haltia/Infantile 40 As used herein, recombinant ATGL refers to refers to adi CLN1/PPT disease, Beta-mannosidosis). pose triglyceride lipase enzyme (ATGL, also known as des In one embodiment the lipid/glycogen storage disorder to nutrin) protein, or a fragment ATGL protein, that has been be treated with a compound selected from Table 1, or from produced using protein expression techniques well known to Table 2, or from Table 3, is not Pompe disease/Glycogen those of skill in the art, where the recombinant ATGL (which storage disease type II. 45 may be a fragment thereof) is capable of cleaving the first In one embodiment the lipid/glycogen storage disorder to ester bond in triacylglycerol (TAG) within cells (i.e. func be treated with a compound selected from Table 1, or from tional ATGL). Methods for expressing functional ATGL are Table 2, or from Table 3, is not Hypertrophic cardiomyopathy described in, e.g., Duncan et al., Characterization of desnutrin (e.g. due to glycogen storage from AMPK-gamma2 or functional domains: critical residues for triacylglycerol LAMP2 mutation). 50 hydrolysis in cultured cells.J. Lipid Res. 2010 51:(2)309-317. In one embodiment the lipid/glycogen storage disorder to Methods for assessing ATGL enzyme activity are well known to those of skill in the art, e.g. as described in Zimmermannet be treated with a compound selected from Table 1, or from al. Science: Vol. 306 no. 5700 pp. 1383-1386. Table 2, or from Table 3, is not Pycnodysostosis. In one embodiment, the recombinant ATGL is a fusion In one embodiment the lipid/glycogen storage disorder to 55 protein comprising functional ATGL and a targeting moiety. be treated with a compound selected from Table 1, or from The recombinant ATGL can comprise more that one targeting Table 2, or from Table 3, is not GM2 Gangliosidosis. moiety. The targeting moiety may be an amino acid sequence In one embodiment the lipid/glycogen storage disorder to that binds to the cell Surface, or it may be an amino acid be treated with a compound selected from Table 1, or from sequence that binds to a Subcellular compartment within a Table 2, or from Table 3, is not GM1 Gangliosidosis. 60 cell (e.g. early or late endosomes, ER, Golgi, lipid droplets, In one embodiment the lipid/glycogen storage disorder to lysosomes, nucleus). In some embodiments, the targeting be treated with a compound selected from Table 1, or from moiety binds to a specific cell Surface receptor, e.g. to aid in Table 2, or from Table 3, is not Schindler disease. delivery of the recombinant ATGL into a cell. In some In one embodiment the lipid/glycogen storage disorder to embodiment, the targeting moiety binds to a Subcellular com be treated with a compound selected from Table 1, or from 65 partment of a cell (e.g. lysosome or lipid droplet, e.g. binds to Table 2, or from Table 3, is not Salla diseasef Sialic Acid a receptor or molecule found on a Subcellular compartment). Storage Disease. In some embodiments, the fusion protein further comprises a US 9,393,221 B2 25 26 linker amino acid sequence. In one embodiment the linker In some embodiments, the targeting moiety targets Subcel amino acid sequence is capable of being cleaved by an intra lular compartments within a cell (See e.g. Rajendran et al. cellular cellular protease. The fusion protein can further com Subcellular targeting strategies for drug design and delivery prise a penetration peptide sequence, e.g. to aid in escape of Nature Reviews Drug Discovery 9, 29-42 (January 2010). In the ATGL fusion from cellular endocytic compartments, and/ 5 one embodiment, the targeting moiety is a soluble receptor. or to aid in penetration of functional ATGL into a subcellular In one embodiment, the targeting moiety binds to lysos compartment. mes. In one embodiment, the targeting moiety binds to the As used herein, a “linker is a short (e.g., about 1-40, e.g., mannose-6-phosphate receptor. In one embodiment, the tar 1-20 amino acids) sequence of amino acids that is not part of geting moiety comprises a proteoglycan (See, for example, the ATGL sequence or of the cell penetrating peptide and/or 10 Lemansky and Hasilik, Chondroitin sulfate is involved in targeting moiety sequence. A linker peptide is attached on its lysosomal transport of lysozyme in U937 cells, J. Cell Sci 114 amino-terminal end to one polypeptide or polypeptide (2), 345-352). domain and on its carboxyl-terminal end to another polypep In one embodiment, the targeting moiety binds to lipid tide or polypeptide domain. Examples of useful linker pep 15 droplets. For example the targeting moiety may comprise tides include, but are not limited to, glycine polymers (G)n) hormone-sensitive lipase (HSL), or fragment thereof, which including glycine-serine and glycine-alanine polymers where is known to target lipid droplets within cells (Yang et al. Cell n=1-8, preferably, n=3, 4, 5, or 6). Metabolism 11, 194-205, Mar. 3, 2010, 194-205). The term “fusion protein’ refers to a recombinant protein In one embodiment, the targeting moiety is tail interacting of two or more fused proteins. Fusion proteins can be pro protein of 47 kDa (TIP47) or fragment thereof, or a moiety duced, for example, by a nucleic acid sequence encoding one (e.g. peptide orantibody) that binds to tail interacting protein protein joined to the nucleic acid encoding another protein of 47 kDa (TIP47) (Bulankina et al. J. Cell Biol. Vol. 185 No. Such that they constitute a single open-reading frame that can 4641-655). be translated in the cells into a single polypeptide harboring In one embodiment the targeting moiety binds to the COPI all the intended proteins. The order of arrangement of the 25 and/or COPII coatomer proteins (Sonietal. Coatomer-depen proteins can vary. As a non-limiting example, the nucleic acid dent protein delivery to lipid droplets J Cell Sci. 2009 Jun. 1: sequence encoding ATGL can be fused to either the 5' or the 122(Pt 11):1834-41). In other embodiments, the targeting 3' end of the nucleic acid sequence encoding a targeting moiety comprises a PAT-domain protein, or fragment thereof, moiety and/or a penetration peptide. e.g. ADRP (adipophilin) and TIP47, which are known to In some embodiments, the targeting moiety is an antibody, 30 including antibodies or antibody fragments. In one embodi localize to the surface of lipid droplets (Soni et al. Supra). In ment the antibody recognizes a viral envelope protein, a cel some embodiments, the targeting moiety binds to a PAT lular receptor, or an extracellular domain of an activated domain protein. In one embodiment the targeting moiety receptor. Antibodies and antibody fragments, polyclonal or comprises COPI or COPII, or a fragment thereof. monoclonal, can be purchased from a variety of commercial 35 In one embodiment, the targeting moiety comprises an Suppliers, or may be manufactured using well-known meth N-terminal region of comparative gene identification-58 ods, e.g., as described in Harlow et al., Antibodies: A Labo (CGI-58) (e.g. amino acids 1-30 or portion thereof), which ratory Manual, 2nd Ed; Cold Spring Harbor Laboratory harbors a lipophilic tryptophan-rich stretch known to bind Press, Cold Spring Harbor, N.Y. (1988). lipid droplets (Gruberetal. Biol Chem 2010 Apr. 16:285(16): As used herein, the term “antibody” refers to immunoglo 40 12289-98). bulin molecules and immunologically active portions of In one embodiment, the targeting moiety comprises a cyto immunoglobulin molecules, i.e., molecules that contain an plasmic targeting/retention signal, e.g. the region of 18 amino antigen binding site that bind an antigen. The term includes acids within the MA of MPMV that is responsible for type antibodies comprised of two immunoglobulin heavy chains D-specific morphogenesis as described in Choi et al. Identi and two immunoglobulin light chains as well as a variety of 45 fication of a Cytoplasmic Targeting/Retention Signal in a forms besides antibodies; including, for example, single Retroviral Gag Polyprotein J. Virol. 1999 July; 73(7): 5431 chain antibodies Fv, Fab, and F(ab)'2, diabodies, as well as 5437). bifunctional hybrid antibodies capable of binding the antigen In one embodiment, the targeting moiety comprises an or antigenic fragment of interest. amino acid sequence that targets the Golgi complex. In one In one embodiment, the targeting moiety is a ligand of a 50 embodiment, the amino acid sequence comprises a 32-amino cell Surface molecule, e.g. to a cell Surface receptor, or Surface acid segment of the putative COOH-terminal cytoplasmic receptor (or molecule) found on a Subcellular compartment of domain of caveolin-3, which is known to specifically and a cell. The cell Surface receptor may be a transmembrane exclusively target to the Golgi complex, as described in receptor or a non-transmembrane receptor. In one embodi Luetterforst et al. Molecular Characterization of Caveolin ment the targeting moiety is a soluble receptor. The targeting 55 Association with the Golgi Complex: Identification of a Cis moiety may target a cell Surface receptor, or Subcellular com Golgi Targeting Domain in the Caveolin Molecule, JCB 1999 partment receptor, on or in any cell. In one embodiment, the Jun. 28, 145 (7): 1443). In one embodiment, the targeting targeting moiety targets a cell Surface receptor on adipocytes, moiety comprises the amino acid sequence AFDNVGYE liver cells lung cells, muscle cells, or heart cells. In one (SEQID NO: 43) (See e.g., Braiterman et al. Apical targeting embodiment, the cell Surface receptor undergoes endocyto 60 and Golgi retention signals reside within a 9-amino acid sis. In one embodiment, the cell Surface receptor is specific sequence in the copper-ATPase, ATP7B, Am J Physiol Gas for the target cell. Examples of cell surface receptors include, trointest Liver Physiol. 2009 February; 296(2): G433-G444). but are certainly not limited to, hormone receptors e.g. epi In one embodiment, the targeting moiety comprises a frag dermal growth factor receptor (EGFR), fibroblast growth fac ment of the glycoprotein from Crimean-Congo Hemorrhagic tor receptor (FGFR) etc, transferrin receptors; low density 65 Fever (CCHF) virus, for example as described in Haferkamp lipoprotein receptor (LDLR), FC receptors, and CD recep et al. Intracellular localization of Crimean-Congo Hemor tOrS. rhagic Fever (CCHF) virus glycoproteins Virology Journal US 9,393,221 B2 27 28 2005, 2:42. The C-terminal region of glycoprotein G, targets 27-mer consisting of N-terminal fragment of neuropeptide the endoplasmic reticulum, while the N-terminal glycopro galanine and membrane interacting wasp venom peptide tein Gw localizes to the Golgi. mastoporan (Lindgren et al., (2000), Bioconjugate Chem. In other embodiments, the recombinant ATGL is a fusion 11, 619-626); a peptide derived from influenza virus hemag protein comprising functional ATGL and a cell penetration glutinin envelop glycoprotein (Bongartz et al., 1994, Nucleic peptide. Acids Res., 22, 468 14688); RGD peptide; HIV-1 TAT pro tein (Frankel and Pabo. (1988) Cell, 55, pp. 1189-93). See In some embodiments of the methods described herein, the also, e.g., Morris, M. C. et al., Nature Biotechnol. 19:1173 functional ATGL comprises the “patatin-like domain com 1176 (2001); Dupont, A.J. and Prochiantz, A., CRC Hand monto plant acyl-transferases (Dessen et al. Crystal structure book on Cell Penetrating Peptides, Langel, Editor, CRC of human cytosolic phospholipase A2 reveals a novel topol 10 Press, (2002); Chaloin, L. et al., Biochemistry 36(37): 11179 ogy and catalytic mechanism. Cell 97, 349-360; Lu et al. 87 (1997); and Lundberg, P. and Langel, U.J. Mol. Recognit. Differential control of ATGL-mediated lipid droplet degrada 16(5):227-233 (2003); which are each incorporated herein by tion by CGI-58 and GOS2, Cell Cycle 2010 Jul. 15: 9(14): reference. Non-limiting example cell penetration peptide 2719-2725.). In some embodiments, the recombinant ATGL sequences are set forth in Table 5. TABLE 5

PEPTIDE SEQUENCE SEO ID NO: HIV-1 TAT (49-57) RKKRRORRR SEO ID NO: 32 HIV-1 TAT (48 - 6 O) GRKKRRORRRTPO SEO ID NO: 33 HIV-1 TAT (47-57) YGRKKRRORRR SEO ID NO: 34

Kaposi fibroblast AAW ALL PAW LL.A. LL.A. P -- SEO ID NO: 35 growth factor WOR KRO KLMP

of caiman MGL, GLH LLW LAA ALQ GA SEO ID NO: 36 crocodylus Ig (5) light chain

HIV envelope GAL FLG FLG AAG STM GA. -- SEO ID NO : 37 glycoprotein gp41 PKS KRK 5 (NLS of the SV40 Drosophila ROI KIW FON RRM KWK K SEO ID NO: 38 Antennapedia amide

influenza virus GLFEAIAGFIENGWEGMIDGGG SEO ID NO: 39 hemagglutinin YC envelop glycoprotein

transportan A GWT LNS AGY LLG KIN LKA SEO ID NO: 40 LAA. L.A.K KIL

Pre-S-peptide (S) DH OLN PAF SEO ID NO: 41 Somatostatin (tyr-3- (S) FC YWK TCT SEO ID NO: 42 octreotate) (S) optional Serine for Coupling italic = optional D isomer for Stability comprises the C-terminal hydrophobic domain (Kobayashi In another embodiment, the cell penetrating peptide com K. etal.J. Clin Endocrinol Metab. 2008 July: 93(7):2877-84). prises a membrane signal peptide or membrane translocation In one embodiment, the recombinant ATGL does not com sequence capable of translocating across the cell membrane. prise the C-terminal hydrophobic domain. 50 A cell penetrating “signal peptide' or 'signal sequence' As used herein, a “cell penetration peptide' refers to an refers to a sequence of amino acids generally of a length of amino acid sequence capable of crossing the lipid bilayer of a about 10 to about 50 or more amino acid residues, many cell. Several cell penetrating peptides have been identified (typically about 55-60%) residues of which are hydrophobic which can be used as carrier peptides in the methods of the such that they have a hydrophobic, lipid-soluble portion. invention for transporting functional ATGL across cell mem 55 Generally, a signal peptide is a peptide capable of penetrating branes. These peptides include, but are not limited to, the through the cell membrane to allow the import and/or export homeodomain of antennapedia, a Drosophila transcription of cellular proteins. Signal peptides can be selected from the factor (Wang et al., (1995) PNAS USA. 92, 3318-3322); a SIGPEP database (von Heijne, Protein Sequence Data Analy fragment representing the hydrophobic region of the signal 60 sis 1:4142 (1987); von Heijne and Abrahmsen, L., FEBS sequence of Kaposi fibroblast growth factor with or without Letters 224:439-446 (1989)). Algorithms can also predict NLS domain (Antopolsky et al. (1999) Bioconj. Chem., 10, signal peptide sequences for use in the compositions (see, 598-606); a signal peptide sequence of caiman crocodylus e.g., SIGFIND Signal Peptide Prediction Server version Ig(5) light chain (Chaloin et al. (1997) Biochem. Biophys. SignalP V2.0b2. Bendtsen et al. “Improved prediction of Res. Comm., 243, 601-608); a fusion sequence of HIV enve 65 signal peptides: SignalP 3.0.” J. Mol. Biol. 340:783-795, lope glycoprotein gp41 14. (Morris et al. (1997) Nucleic 2004; Nielsenet al. “Identification of prokaryotic and eukary Acids Res., 25, 2730-2736); a transportan A-achimeric otic signal peptides and prediction of their cleavage sites.” US 9,393,221 B2 29 30 Protein Engineering, 10:1-6, 1997: Bairoch and Boeckmann, Subcuticular, intraarticular, Sub capsular, Subarachnoid, “The SWISS-PROT protein sequence data bank: current sta intraspinal, intracerebro spinal, and intrasternal injection and tus' Nucleic Acids Res. 22:3578-3580, 1994.). infusion. In some embodiments of the present invention, recombi In one embodiment, the compounds are administered nant ATGL further comprises a cell penetrating agent and/or 5 locally to heart muscle. For example, the compound may be targeting moiety as described herein, that is not present as delivered by catherization or by direct injection. Alterna fusion protein with ATGL. For example, the recombinant tively, a delivery vehicle may be loaded with the compound ATGL may have a cell penetrating peptide and/or targeting and directly applied to the heart. Delivery vehicles includebut moiety conjugated the recombinant ATGL protein by chemi are not limited to drug-impregnated or coated releasing 10 sheets, patches, matrix, hydrogel, foam, gel, cream, spray, cal bond linkages, such as linkages by disulfide bonds or by microsphere, microcapsule, composite and ointment, or poly chemical bridges. Peptide sequences of the present invention meric devices. In one embodiment, the compound is deliv can also be linked together using non-peptide cross-linkers ered locally to the heart by the use of targeted vehicles, e.g. (Pierce 2003-2004 Applications Handbook and Catalog, liposomes, which are modified to that target cardiac myo Chapter 6) or other scaffolds such as HPMA, polydextran, 15 cytes. polysaccharides, ethylene-glycol, poly-ethylene-glycol, The compounds can be formulated in pharmaceutically glycerol, Sugars, and Sugar alcohols (e.g., Sorbitol, mannitol). acceptable compositions which comprise a therapeutically In one embodiment, recombinant ATGL is incorporated effective amount of the compound, formulated together with within liposomes for delivery across the cell membrane, or one or more pharmaceutically acceptable carriers (additives) conjugated to lipophilic moieties. A wide variety of lipo and/or diluents. The compounds can be specially formulated Somes and liposome like particles are well known to those of for administration in Solid or liquid form, including those skill in the art. adapted for the following: (1) oral administration, for Alternatively, the recombinant ATGL can be expressed example, drenches (aqueous or non-aqueous solutions or Sus within the cell of a subject following introduction of a DNA pensions), lozenges, dragees, capsules, pills, tablets (e.g., encoding the protein, e.g., a nucleic acid encoding the recom 25 those targeted for buccal, Sublingual, and systemic absorp binant ATGL functional protein (e.g. using a plasmid or viral tion), boluses, powders, granules, pastes for application to the vectors (e.g. AAV or lentiviral vectors) well known to those of tongue; (2) parenteral administration, for example, by Subcu skill in the art). In some embodiments, the nucleic acid com taneous, intramuscular, intravenous or epidural injection as, prises a nucleic acid sequence encoding a fusion protein for example, a sterile Solution or Suspension, or Sustained comprising recombinant ATGL and a cell penetration peptide 30 release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray and/or target moiety. applied to the skin; (4) intravaginally or intrarectally, for Formulations and Administration example, as a pessary, cream or foam; (5) Sublingually; (6) For administration to a subject, the compounds can be ocularly; (7) transdermally; (8) transmucosally; or (9) administered by any means known to those of skill in the art, 35 nasally. Additionally, compounds can be implanted into a e.g., orally, parenterally, Subcutaneously, intravenously, patient or injected using a drug delivery system. See, for intramuscularly, intraperitoneally, by intranasal instillation, example, Urquhart, et al., Ann. Rev. Pharmacol. Toxicol. 24: or by application to mucous membranes, such as, that of the 199-236 (1984); Lewis, ed. “Controlled Release of Pesticides nose, throat, and bronchial tubes. One method for targeting and Pharmaceuticals” (Plenum Press, New York, 1981): U.S. the nervous system, Such as spinal cord glia, is by intrathecal 40 Pat. No. 3,773.919; and U.S. Pat. No. 353,270,960. delivery. The targeted compound is released into the Sur As used here, the term “pharmaceutically acceptable' rounding CSF and/or tissues and the released compound can refers to those compounds, materials, compositions, and/or penetrate into the spinal cord parenchyma, just after acute dosage forms which are, within the scope of Sound medical intrathecal injections. For a comprehensive review on drug judgment, Suitable for use in contact with the tissues of delivery strategies, See Ho et al., Curr. Opin. Mol. Ther. 45 human beings and animals without excessive toxicity, irrita (1999), 1:336-3443, Groothuis et al., J. Neuro Virol. (1997), tion, allergic response, or other problem or complication, 3:387-400; and January, Drug Delivery Systems: Technolo commensurate with a reasonable benefit/risk ratio. gies and Commercial Opportunities, Decision Resources, As used here, the term “pharmaceutically-acceptable car 1998. rier” means a pharmaceutically-acceptable material, compo The compounds can be administered alone or with suitable 50 sition or vehicle, such as a liquid or solid filler, dilutent, pharmaceutical carriers, and can be in Solid or liquid form excipient, manufacturing aid (e.g., lubricant, talc magnesium, Such as, tablets, capsules, powders, Solutions, Suspensions, or calcium or Zinc Stearate, or steric acid), or solvent encapsu emulsions. lating material, involved in carrying or transporting the Sub As used herein, the term “administered’ refers to the place ject compound from one organ, or portion of the body, to ment of a compound described herein, into a Subject by a 55 another organ, or portion of the body. Each carrier must be method or route which results in at least partial localization of “acceptable in the sense of being compatible with the other the compound at a desired site. A compound described herein ingredients of the formulation and not injurious to the patient. can be administered by any appropriate route which results in Some examples of materials which can serve as pharmaceu effective treatment in the Subject (e.g. a significant reduction tically-acceptable carriers include: (1) Sugars, such as lactose, in lipid accumulation within cells), i.e. administration results 60 glucose and Sucrose; (2) starches, such as corn starch and in delivery to a desired location in the subject where at least a potato starch; (3) cellulose, and its derivatives, such as portion of the composition delivered. Exemplary modes of sodium carboxymethyl cellulose, methylcellulose, ethyl cel administration include, but are not limited to, injection, infu lulose, microcrystalline cellulose and cellulose acetate; (4) Sion, instillation, or ingestion. "Injection' includes, without powdered tragacanth; (5) malt, (6) gelatin; (7) lubricating limitation, intravenous, intramuscular, intraarterial, intrathe 65 agents. Such as magnesium Stearate, Sodium lauryl Sulfate and cal, intraventricular, intracapsular, intraorbital, intracardiac, talc.; (8) excipients, such as cocoa butter and Suppository intradermal, intraperitoneal, transtracheal, Subcutaneous, waxes; (9) oils, such as peanut oil, cottonseed oil, safflower US 9,393,221 B2 31 32 oil, sesame oil, olive oil, corn oil and soybean oil: (10) gly present invention can be injected in association with a phar cols, such as propylene glycol; (11) polyols. Such as glycerin, maceutical carrier Such as normal saline, physiological sorbitol, mannitol and polyethylene glycol (PEG); (12) saline, bacteriostatic water, CremophorTM EL (BASF, Parsip esters, such as ethyl oleate and ethyl laurate; (13) agar, (14) pany, N.J.), phosphate buffered saline (PBS), Ringer's solu buffering agents, such as magnesium hydroxide and alumi- 5 tion, dextrose solution, ethanol, polyol (e.g., glycerol, propy num hydroxide; (15) alginic acid, (16) pyrogen-free water; lene glycol, and liquid polyethylene glycol), vegetable oils, (17) isotonic saline: (18) Ringer's solution; (19) ethyl alco and Suitable mixtures thereof, and other aqueous carriers hol; (20) pH buffered solutions; (21) polyesters, polycarbon known in the art. Appropriate non-aqueous carriers may also ates and/or polyanhydrides; (22) bulking agents, such as be used and examples include fixed oils and ethyl oleate. In all polypeptides and amino acids (23) serum component, such as 10 cases, the composition must be sterile and should be fluid to serum albumin, HDL and LDL, (22) C-C alcohols, such as the extent that easy syringability exists. It must be stable ethanol; and (23) other non-toxic compatible Substances under the conditions of manufacture and storage and must be employed in pharmaceutical formulations. Wetting agents, preserved against the contaminating action of microorgan coloring agents, release agents, coating agents, Sweetening isms such as bacteria and fungi. The proper fluidity can be agents, flavoring agents, perfuming agents, preservative and 15 maintained, for example, by the use of a coating such as antioxidants can also be present in the formulation. The terms lecithin, by the maintenance of the required particle size in the such as “excipient”, “carrier”, “pharmaceutically acceptable case of dispersion and by the use of surfactants. Prevention of carrier' or the like are used interchangeably herein. the action of microorganisms can be achieved by various Pharmaceutically-acceptable antioxidants include, but are antibacterial and antifungal agents, for example, parabens, not limited to, (1) water soluble antioxidants, such as ascorbic 20 chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. acid, cysteine hydrochloride, Sodium bisulfate, Sodium met In many cases, it will be preferable to include isotonic agents, abisulfite, sodium sulfite and the like; (2) oil-soluble antioxi for example, Sugars, polyalcohols such as mannitol, Sorbitol, dants, such as ascorbyl palmitate, butylated hydroxyanisole and Sodium chloride in the composition. Prolonged absorp (BHA), butylated hydroxytoluene (BHT), lectithin, propyl tion of the injectable compositions can be brought about by gallate, alpha-tocopherol, and the like; and (3) metal chelat- 25 including in the composition an agent which delays absorp ing agents, such as citric acid, ethylenediamine tetraacetic tion, for example, aluminum monostearate and gelatinA Suit acid (EDTA), sorbitol, tartaric acid, phosphoric acids, and the able carrier is 5% dextrose in saline. Frequently, it is desirable like. to include additives in the carrier such as buffers and preser “PEG' means an ethylene glycol polymer that contains Vatives or other Substances to enhance isotonicity and chemi about 20 to about 2000000 linked monomers, typically about 30 cal stability. 50-1000 linked monomers, usually about 100-300. Polyeth In some embodiments, compounds can be administrated ylene glycols include PEGs containing various numbers of encapsulated within liposomes. The manufacture of such linked monomers, e.g., PEG20, PEG30, PEG40, PEG60, liposomes and insertion of molecules into Such liposomes PEG80, PEG100, PEG115, PEG200, PEG300, PEG400, being well known in the art, for example, as described in U.S. PEG500, PEG600, PEG1000, PEG1500, PEG2000, 35 Pat. No. 4.522,811. Liposomal Suspensions (including lipo PEG3350, PEG4000, PEG4600, PEG5000, PEG6000, Somes targeted to particular cells, e.g., a muscle cell, liver PEG8000, PEG11000, PEG12000, PEG2000000 and any cell, heart cell etc.) can also be used as pharmaceutically mixtures thereof. acceptable carriers. The compounds can be formulated in a gelatin capsule, in In one embodiment, the compounds are prepared with tablet form, dragee, syrup, Suspension, topical cream, Sup- 40 carriers that will protect the compound against rapid elimi pository, injectable solution, or kits for the preparation of nation from the body, Such as a controlled release formula syrups, Suspension, topical cream, Suppository or injectable tion, including implants and microencapsulated delivery sys Solution just prior to use. Also, compounds can be included in tems. Biodegradable, biocompatible polymers can be used, composites, which facilitate its slow release into the blood Such as ethylene vinyl acetate, polyanhydrides, polyglycolic stream, e.g., silicon disc, polymer beads. 45 acid, collagen, polyorthoesters, and polylactic acid. Methods The formulations can conveniently be presented in unit for preparation of such formulations will be apparent to those dosage form and may be prepared by any of the methods well skilled in the art. The materials can also be obtained commer known in the art of pharmacy. Techniques, excipients and cially from Alza Corporation and Nova Pharmaceuticals, Inc. formulations generally are found in, e.g., Remington's Phar In the case of oral ingestion, excipients useful for Solid maceutical Sciences, Mack Publishing Co., Easton, Pa. 1985, 50 preparations for oral administration are those generally used 17th edition, Nema et al., PDA J. Pharm. Sci. Tech. 1997 in the art, and the useful examples are excipients such as 51:166-171. Methods to make invention formulations include lactose, Sucrose, sodium chloride, starches, calcium carbon the step of bringing into association or contacting an ActRIIB ate, kaolin, crystalline cellulose, methyl cellulose, glycerin, compound with one or more excipients or carriers. In general, Sodium alginate, gum arabic and the like, binders such as the formulations are prepared by uniformly and intimately 55 polyvinyl alcohol, polyvinyl ether, polyvinyl pyrrolidone, bringing into association one or more compounds with liquid ethyl cellulose, gum arabic, shellac, Sucrose, water, ethanol, excipients or finely divided solid excipients or both, and then, propanol, carboxymethylcellulose, potassium phosphate and if appropriate, shaping the product. the like, lubricants such as magnesium Stearate, talc and the The preparative procedure may include the sterilization of like, and further include additives Such as usual known col the pharmaceutical preparations. The compounds may be 60 oring agents, disintegrators such as alginic acid and Primo mixed with auxiliary agents such as lubricants, preservatives, gelTM, and the like. stabilizers, salts for influencing osmotic pressure, etc., which The compounds can be orally administered, for example, do not react deleteriously with the compounds. with an inert dilutent, or with an assimilable edible carrier, or Examples of injectable form include Solutions, Suspen they may be enclosed in hard or soft shell capsules, or they sions and emulsions. Injectable forms also include sterile 65 may be compressed into tablets, or they may be incorporated powders for extemporaneous preparation of injectable solu directly with the food of the diet. For oral therapeutic admin tions, Suspensions or emulsions. The compounds of the istration, these compounds may be incorporated with excipi US 9,393,221 B2 33 34 ents and used in the form of tablets, capsules, elixirs, Suspen N.Y., NY: Physicians Desk Reference, 50" Edition, 1997, sions, syrups, and the like. Such compositions and Oradell N.J., Medical Economics Co.: Pharmacological preparations should contain at least 0.1% of compound. The Basis of Therapeutics, 8" Edition, Goodman and Gilman, percentage of the agent in these compositions may, of course, 1990; United States Pharmacopeia, The National Formulary, be varied and may conveniently be between about 2% to USP XII NF XVII, 1990, the complete contents of all of about 60% of the weight of the unit. The amount of compound which are incorporated herein by reference. In some embodi in Such therapeutically useful compositions is such that a ments, the pharmaceutically active agent is selected from the suitable dosage will be obtained. Preferred compositions group consisting of butyrates, valproic acid, hydroxyuirae according to the present invention are prepared so that an oral and Riluzole. dosage unit contains between about 100 and 2000 mg of 10 The compound and the pharmaceutically active agent may compound. be administrated to the Subject in the same pharmaceutical Examples of bases useful for the formulation of supposi composition or in different pharmaceutical compositions (at tories are oleaginous bases such as cacao butter, polyethylene the same time or at different times). In some embodiments, glycol, lanolin, fatty acid triglycerides, witepsol (trademark, the pharmaceutically active compound is a Dynamite Nobel Co. Ltd.) and the like. Liquid preparations 15 The amount of compound which can be combined with a may be in the form of aqueous or oleaginous Suspension, carrier material to produce a single dosage form will gener Solution, syrup, elixir and the like, which can be prepared by ally be that amount of the compound which produces a thera a conventional way using additives. peutic effect. Generally out of one hundred percent, this The compositions can be given as a bolus dose, to maxi amount will range from about 0.1% to 99% of compound, mize the circulating levels for the greatest length of time after preferably from about 5% to about 70%, most preferably the dose. Continuous infusion may also be used after the from 10% to about 30%. bolus dose. The tablets, capsules, and the like may also containabinder The compounds can also be administrated directly to the Such as gum tragacanth, acacia, corn starch, or gelatin; excipi airways in the form of an aerosol. For administration by ents such as dicalcium phosphate; a disintegrating agent Such inhalation, the compounds in Solution or Suspension can be 25 as corn Starch, potato starch, alginic acid; a lubricant Such as delivered in the form of an aerosol spray from pressured magnesium Stearate; and a Sweetening agent Such as Sucrose, container or dispenser which contains a Suitable propellant, lactose, or saccharin. When the dosage unit form is a capsule, e.g., a gas such as carbon dioxide, or hydrocarbon propellant it may contain, in addition to materials of the above type, a like propane, butaneorisobutene. The compounds can also be liquid carrier, such as a fatty oil. administrated in a no-pressurized form such as in an atomizer 30 Various other materials may be present as coatings or to or nebulizer. modify the physical form of the dosage unit. For instance, The compounds can also be administered parenterally. tablets may be coated with shellac, sugar, or both. A syrup Solutions or Suspensions of these compounds can be prepared may contain, in addition to the active ingredient, Sucrose as a in water Suitably mixed with a Surfactant, such as hydrox Sweetening agent, methyl and propylparabens as preserva ypropylcellulose. Dispersions can also be prepared in glyc 35 tives, a dye, and flavoring Such as cherry or orange flavor. erol, liquid polyethylene glycols, and mixtures thereof in oils. The pharmaceutical compositions can be included in a Illustrative oils are those of petroleum, animal, vegetable, or container, pack, or dispenser together with instructions for synthetic origin, for example, peanut oil, soybean oil, or administration. mineral oil. In general, water, saline, aqueous dextrose and In some embodiments, the compounds of the invention are related Sugar Solution, and glycols such as, propylene glycol 40 administered in conjunction with additional therapies known or polyethylene glycol, are preferred liquid carriers, particu to be beneficial in the treatment of symptoms of the lipid/ larly for injectable solutions. Under ordinary conditions of glycogen disorder to be treated. storage and use, these preparations contain a preservative to As used herein, the term “therapeutically effective prevent the growth of microorganisms. amount’ means an amount of the compound which is effec It may be advantageous to formulate oral or parenteral 45 tive to reduce the accumulation of lipid or glycogen within compositions in dosage unit form for ease of administration cells by a significant amount as compared to an untreated and uniformity of dosage. As used herein, "dosage unit' control. Determination of a therapeutically effective amount refers to physically discrete units Suited as unitary dosages for is well within the capability of those skilled in the art. In one the Subject to be treated; each unit containing a predetermined embodiment the therapeutically effective amount is an quantity of compound calculated to produce the desired 50 amount capable of shifting cellular energy metabolism from therapeutic effect in association with the required pharma fatty acid oxidation to glycolysis, methods for measuring this ceutical carrier. shift are described in the examples section. Generally, a thera Administration can also be by transmucosal or transdermal peutically effective amount can vary with the subject’s his means. For transmucosal or transdermal administration, pen tory, age, condition, sex, as well as the severity and type of the etrants appropriate to the barrier to be permeated are used in 55 medical condition in the Subject, and administration of other the formulation. Such penetrants are generally known in the agents that inhibit pathological processes in neurodegenera art, and include, for example, for transmucosal administra tive disorders. tion, detergents, bile salts, and fusidic acid derivatives. Trans Guidance regarding the efficacy and dosage which will mucosal administration can be accomplished through the use deliver a therapeutically effective amount of a compound to of nasal sprays or Suppositories. For transdermal administra 60 treat the lipid/glycogen storage disorders described herein tion, the compounds are formulated into ointments, salves, can be obtained from cell culture models and the adjusted in gels, or creams as generally known in the art. animal models (e.g. gene knockout models) of the disorders, The compounds can be administrated to a subject in com which are well established in the art. Non-limiting examples bination with a pharmaceutically active agent. Exemplary of animal models of glygogen storage disorder are described pharmaceutically active compound include, but are not lim 65 in: Akman et al. Animal models of glycogen storage disorders ited to, those found in Harrison's Principles of Internal Medi Prog Mol Biol Transl Sci. 2011; 100:369-88: Agnes G. A. cine, 13" Edition, Eds. T. R. Harrison et al. McGraw-Hill Generalized glycogen storage and cardiomegaly in a knock US 9,393,221 B2 35 36 out mouse model of Pompe disease Human Molecular Genet e.g., 2-4 Subdoses and administered over a period of time, ics, 1998, Vol. 7, No. 153-62; West, J. Gross, Animal models e.g., at appropriate intervals through the day or other appro of glycogen storage conditions. Their relation to human dis priate schedule. Such sub-doses can be administered as unit ease. Med. 1975 September: 123(3): 194-201: Specht et al. dosage forms. Examples of dosing schedules are administra Glycogen Storage Disease Type Ia in Canines: A Model for 5 tion once a week, twice a week, three times a week, daily, Human Metabolic and Genetic Liver Disease Journal of Bio twice daily, three times daily or four or more times daily. medicine and Biotechnology, 2011, Article ID 646257. 9 In one embodiment, recombinant ATGL is administered in pages; Non-limiting examples of animal models of lipid stor conjunction with compounds that known to upregulate man age disorder are described in, for example: Tybulewicz et al., nose-6-phosphate receptors (e.g. Dexamethasone). Gaucher's disease from targeted disruption of the mouse 10 The compound (e.g., in a composition) can be administered Glucocerebrosidase gene. Nature 357:407-410; Kazunori to a subject, e.g., a Subject in need of treatment to reduce lipid Sango et al., Mouse models of Tay-Sachs and Sandhoff dis accumulation in cells. The method can include evaluating a eases differin neurologic phenotype and ganglioside metabo Subject, e.g., to evaluate LPD, BMI, genetic analysis, or trig lism, Nature Genetics, 1995, 11, 170-176: Wasserstein & lyceride levels in tissue samples or cells, to thereby identify a McGovern, Genetic basis of lipid disorders, Future Lipidol 15 Subject as having excess, or abnormal lipid deposition. ogy, 2001, 3(2): 189; and ATGL knock out animal model High Throughput Screen of Compounds described herein, as well as others well established in the art. In another aspect of the invention a high throughput assay Toxicity and therapeutic efficacy can be determined by stan for screening of compounds or agents that reduce intracellu dard pharmaceutical procedures in cell cultures or experi lar accumulation of lipid within cells is provided, the assay mental animals, e.g., for determining the LD50 (the dose comprises: (a) contacting a test population of induced pluri lethal to 50% of the population) and the ED50 (the dose potent stem cells (iPSCs) derived from a somatic cell that therapeutically effective in 50% of the population). The dose lacks expression of wild-type adipose triglyceride lipase ratio between toxic and therapeutic effects is the therapeutic (ATGL), or that comprises a mutation in PNPLA2 gene, with index and it can be expressed as the ratio LD50/ED50. Com a test compound; (b) differentiating the cells of step (a) in the positions that exhibit large therapeutic indices, are preferred. 25 presence of the test compound; and (c) selecting a compound The data obtained from the cell culture assays and animal that decreases lipid accumulation within the cells as com studies can be used informulating a range of dosage for use in pared to a differentiated control population of induced pluri humans. The dosage of Such compounds lies preferably potent stem cells (iPSCs) that has not been contacted with a within a range of circulating concentrations that include the test compound. The control population is derived from the ED50 with little or no toxicity. The dosage may vary within 30 same Somatic cell or somatic cell type as the test population. this range depending upon the dosage form employed and the The intracellular lipid accumulation phenotype of route of administration utilized. NLSD-M can be quantified using colorimetric lipid staining The therapeutically effective dose can be estimated ini assays and thus represents a robust Surrogate phenotype for tially from cell culture assays. A dose may be formulated in the pleiotropic disease presentation found in both clinical animal models to achieve a circulating plasma concentration 35 NLSD-M and the ATGL-KO mouse model (Pinent et al., range that includes the IC50 (i.e., the concentration of the 2008: Haemmerle et al., 2006; Kobayashi, K. et al. 2008). therapeutic which achieves a half-maximal inhibition of Furthermore, these lipid staining assays can be readily imple symptoms) as determined in cell culture. Levels in plasma mented in a high throughput two-dimensional culture system may be measured, for example, by high performance liquid to facilitate screening applications. Given that excess lipid chromatography. The effects of any particular dosage can be 40 accumulation is also the molecular basis for the pathology of monitored by a suitable bioassay. Examples of suitable bio NLSD-M, a screen for modulators of this phenotype may assays include DNA replication assays, transcription based Suggest useful therapeutic approaches for the disease. assays, GDF-8 binding assays, and immunological assays. In some embodiments, the Somatic cell is from a subject The dosage may be determined by a physician and (e.g. human) that has neutral lipid storage disease with adjusted, as necessary, to Suit observed effects of the treat 45 myopathy (NLSD-M), i.e. the cell has a mutation in the ment. Generally, the compositions are administered so that PNPLA2 gene. compound is given at a dose from 1 g/kg to 100 mg/kg, 1 In some embodiments, the Somatic cell is from an knock g/kg to 50 mg/kg, 1 g/kg to 20 mg/kg, 1 Lig/kg to 10 mg/kg. out animal that has had the PNLAP2 gene for adipose trig 1 g/kg to 1 mg/kg, 100 ug/kg to 100 mg/kg, 100 g/kg to 50 lyceride lipase (ATGL) deleted from its genome, or is a cell mg/kg, 100 ug/kg to 20 mg/kg, 100 ug/kg to 10 mg/kg, 100 50 with a mutation in the gene for ATGL (i.e. PNLAP2). g/kg to 1 mg/kg, 1 mg/kg to 100 mg/kg, 1 mg/kg to 50 The Somatic cells can be reprogrammed into induced pluri mg/kg, 1 mg/kg to 20 mg/kg, 1 mg/kg to 10 mg/kg, 10 mg/kg potent stem cells using means well known those of skill in the to 100 mg/kg, 10 mg/kg to 50 mg/kg, or 10 mg/kg to 20 art. For example by the use of the Yamanaka factors (Oct3/4, mg/kg. For antibody compounds, one preferred dosage is 0.1 Sox2, Klf4, c-Myc), as described in the Examples disclosed mg/kg of body weight (generally 10 mg/kg to 20 mg/kg). If 55 herein. Alternative methods known to those of skill in the art the antibody is to act in the brain, a dosage of 50 mg/kg to 100 can be used, e.g. as described in International patent applica mg/kg is usually appropriate. tions: WO2007/069666; WO2008/118820; WO2008/ With respect to duration and frequency of treatment, it is 124133; WO2008/151058: WO2009/006997; and U.S. typical for skilled clinicians to monitor subjects in order to Patent Applications US2010/0062533: US2009/0227032: determine when the treatment is providing therapeutic ben 60 US2009/0068742; US2009/0047263; US2010/0015705; efit, and to determine whether to increase or decrease dosage, US2009/0081784; US2008/0233610; U.S. Pat. No. 7,615, increase or decrease administration frequency, discontinue 374; U.S. patent application Ser. No. 12/595,041, treatment, resume treatment or make other alteration to treat EP2145000, CA2683056, AU8236629, Ser. No. 12/602,184, ment regimen. The dosing schedule can vary from once a EP2164951, CA2688539, US2010/0105100; US2009/ week to daily depending on a number of clinical factors, such 65 0324559, US2009/0304646, US2009/0299763, US2009/ as the subject’s sensitivity to the polypeptides. The desired 0191159, EP1970446, US2009/0047263, US2009/0068742, dos can be administered at one time or divided into Subdoses, and 2009/0227032, the contents of which are incorporated US 9,393,221 B2 37 38 herein in their entirety by reference. The IPSCs should be In some embodiments, amino acid based molecules, such a clonally expanded prior to initiating differentiation and Sub peptides, oligopeptides and proteins, can be used in Screen to jecting the cells to the test compounds (or for example to identify lipid modulating agents. DMSO for control). In vitro differentiation can be initiated by In some embodiments, the test agent is an antibody. As plating cells either as hanging-droplets (Wobus et al., 1991) used herein, the term “antibody' includes complete immuno or as a monolayer in feeder-free gelatin-coated welled plates globulins, antigenbinding fragments of immunoglobulins, as (e.g. 96 wells) (Huang and Wu, 2010). Cells are then incu well as antigen binding proteins that comprise antigen-bind bated in differentiation medium for the desired number of ing domains of immunoglobulins. Antigenbinding fragments days prior to Subsequent treatment with the test compounds. of immunoglobulins include, for example, Fab, Fab'. F(ab')2. The iPSCs can be differentiated into any desired cell type 10 scFv and dAbs. (e.g. skeletal muscle cells, neuronal cells, or Smooth muscle The number of possible test compounds and agents runs cells), protocols for differentiation of iPSCs are well known into millions. Methods for developing small molecule, poly to those of skill in the art, e.g. as described in Kaichi et al. meric and genome based libraries are described, for example, Cardiovasc Res. 2010 Nov. 1; 88(2):314-23; Bilousova et al. in Ding, et al. J. Am. Chem. Soc. 124: 1594-1596 (2002) and Journal of Investigative Dermatology, 2011, 131, 857-864; 15 Lynn, et al., J. Am. Chem. Soc. 123: 8,155-8156 (2001). Fujiwara et al., PloS One, 2011, 6(2) (cardiac cells), e16734; Commercially available compound libraries can be obtained Hu et al. Proc. Natl. Acad. Sci. U.S.A., 2010, 107(9): 4335 from, e.g., Sigma Aldrich (St. Louis, Mo.), ArCRule (Woburn, 4340 (neuronal cells); Zhanget al., Cell Stem Cell, 2010, 8(1): Mass.), Panvera (Madison, Wis.), Vitas-M Lab (Moscoe, 31-45 (smooth muscle cells), which are herein incorporated Russia), Biomol International (Plymouth, Mass.). These by reference in their entirety. libraries can be screened using the screening devices and In one embodiment, the cells are differentiated into cardiac methods described herein. Chemical compound libraries muscle cells by incubation in differentiation medium com such as those from NIH Roadmap, Molecular Libraries prising IMDM, 15% FBS, 2 mM L-glutamine, 0.001% V/v/ Screening Centers Network (MLSCN) can also be used. The monothioglycerol, 50 g/ml ascorbic acid. libraries may consist of a plurality of stored chemicals/agents, In some embodiments, the test compounds or agents are 25 each chemical/agent having associated information stored in not added until after about 1 day, about 2, days, about 3 days, a database with information Such as the chemical structure, about 4 days, about 5 days, about 6 days, or more after purity, quantity, and physiochemical characteristics of the differentiation is initiated. compound. After addition of the test compounds or agents, the cells Depending upon the particular embodiment being prac may be cultured in the presence of differentiation medium for 30 ticed, the test compounds or agents can be provided free in additional time, e.g. 1 day, 2 days, 3 days, 4 days, 5 days, 6 solution, or may be attached to a carrier. Additionally, for the days, 7 days, 8 days or more, prior to assessing the amount of methods described herein, test compounds or agents may be lipid accumulation, e.g. by the use of Oil Red O (ORO) screened individually, or in groups. Group screening is par staining. ticularly useful where hit rates for effective test compounds As used herein, the term “test compound or agent” refers to 35 are expected to be low such that one would not expect more compounds or agents and/or compositions of the same that than one positive result for a given group. are to be screened for their ability to modulate (e.g. inhibit or In some embodiments, the test compound or agent increase) accumulation of lipids within cells The test com decreases lipid accumulation by at least 5%, 10%, 20%, 30%, pounds or agents can be small molecules, peptides, antibod 40%, 50%, 50%, 70%, 80%, 90%, 1-fold, 1.1-fold, 1.5-fold, ies, antibody fragments, peptidomimetics (e.g., peptoids), 40 2-fold, 3-fold, 4-fold, 5-fold amino acids, amino acid analogs, polynucleotides, poly Generally, compounds can be tested at any concentration nucleotide analogs, nucleotides, nucleotide analogs, organic that can inhibit lipid accumulation relative to a control over an or inorganic compounds (i.e., including heteroorganic and appropriate time period. In some embodiments, compounds organometallic compounds) having a molecular weight less are tested at concentration in the range of about 0.1 nM to than about 10,000 grams per mole, organic or inorganic com 45 about 1000 mM. In some embodiments, the compound is pounds having a molecular weight less than about 5,000 tested in the range of about 0.1 M to about 20 uM, about 0.1 grams per mole, organic or inorganic compounds having a uM to about 10 uM, or about 0.1 uM to about 5 uM. In one molecular weight less than about 1,000 grams per mole, embodiment, compounds are tested at 1 uM. organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and 50 DEFINITIONS other pharmaceutically acceptable forms of such compounds. In some embodiments, the test compound is a small mol Unless otherwise defined herein, scientific and technical ecule. As used herein, the term “small molecule' can refer to terms used in connection with the present application shall compounds that are “natural product-like.” however, the term have the meanings that are commonly understood by those of “small molecule' is not limited to “natural product-like' 55 ordinary skill in the art. Further, unless otherwise required by compounds. Rather, a small molecule is typically character context, singular terms shall include pluralities and plural ized in that it contains several carbon-carbon bonds, and has terms shall include the singular. a molecular weight of less than 5000 Daltons (5 kD), prefer As used herein the term “comprising or “comprises” is ably less than 3 kD, still more preferably less than 2 kD, and used in reference to compositions, methods, and respective most preferably less than 1 kD. In some cases it is preferred 60 component(s) thereof, that are essential to the invention, yet that a small molecule have a molecular weight equal to or less open to the inclusion of unspecified elements, whether essen than 700 Daltons. tial or not. Nucleic acid agents, include but are not limited to, anti As used herein the term “consisting essentially of refers to sense oligonucleotide, RNA interfering agents (e.g. siRNA, those elements required for a given embodiment. The term shRNA), ribozyme, aptamers, and decoy oligonucleotides. 65 permits the presence of additional elements that do not mate Methods of preparing Such nucleic acids are known in the art rially affect the basic and novel or functional characteristic(s) and easily available to those skilled in the art. of that embodiment of the invention. US 9,393,221 B2 39 40 The term “consisting of refers to compositions, methods, pared to ATGL activity observed in normal cells, i.e. the and respective components thereof as described herein, ATGL enzyme shows significantly reduced activity as com which are exclusive of any element not recited in that descrip pared to normal wild-type ATGL enzyme. The term “non tion of the embodiment. functional is also intended to include ATGL enzymes, that Other than in the operating examples, or where otherwise while having enzyme activity, can not traffic to the lipid indicated, all numbers expressing quantities of ingredients or droplets within cells to perform their enzymatic activity. reaction conditions used herein should be understood as As used herein, the term “PNPLA2 refers to patatin-like modified in all instances by the term “about.” The term phospholipase domain containing 2 (PNPLA2) gene (i.e. the "about when used in connection with percentages may gene encoding adipose triglyceride lipase (ATGL) mRNA), meant 1%. 10 The singular terms “a,” “an.” and the include plural refer or refers to the ATGL mRNA sequence encoded by PNPLA2. ents unless context clearly indicates otherwise. Similarly, the In humans PNPLA2 is located on chromosome 11 at position word or is intended to include and unless the context clearly 15.5. The nucleotide sequence for Homo sapiens PNPLA2 indicates otherwise. It is further to be understood that all base that is found on chromosome 11 an accessible at Accession: sizes oramino acid sizes, and all molecular weight or molecu 15 NG_023394.1 (e.g. GI:3008.63141) of GeneBank. Homo lar mass values, given for nucleic acids or polypeptides are sapiens ATGL mRNA is found at Accession AY8948.04.1 approximate, and are provided for description. Although (GI:58759050) (SEQID NO: 1). methods and materials similar or equivalent to those As used herein, “loss of function PNPLA2 gene mutations' described herein can be used in the practice or testing of this refers to mutations in the PNPLA2 gene that result in loss of disclosure, suitable methods and materials are described expression of ATGL, or that result in the expression of a below. The term “comprises' means “includes.” The abbre non-functional or partially functional ATGL enzyme. At least viation, "e.g. is derived from the Latin exempligratia, and is five mutations in the PNPLA2 gene have been found to cause used herein to indicate a non-limiting example. Thus, the neutral lipid storage disease with myopathy. Some of these abbreviation “e.g. is synonymous with the term “for mutations cause the enzyme to function abnormally. Other example.” 25 mutations prevent the enzyme from ever reaching lipid drop As used herein ATGL refers to adipose triglyceride lets, so it is unable to interact with triglycerides. Non-limiting lipase enzyme (also known as desnutrin). ATGL is expressed examples of loss of function PNPLA2 gene mutations in a variety of tissues, including cardiac and skeletal muscle include, but are not limited to, those described in Fischer et al. (Lake et al., 2005; Pinent et al., 2008), and as it cleaves the The gene encoding adipose triglyceride lipase (PNLPLA2) is first ester bond in triacylglycerol (TAG), it is the rate-limiting 30 mutated in neutral lipid storage disease with myopathy, enzyme in the breakdown of intracellular TAG droplets to Nature Genetics 39, 28-30 (2007); and in Hirano et al. Trig provide freefatty acid for cellular energy metabolism (Haem lyceride Deposit Cardiomyovasculopathy, N Engl. J. Med., merle et al., 2006). Homo sapiens ATGL mRNA (wt) is found at Accession AY8948.04.1 (GI:58759050) (SEQ ID NO: 1). 3549 (22):2396-2398 (2008), herein incorporated by refer Homologues and variant protein and nucleic acids of Homo 35 ence in their entirety. sapiens ATGL (protein and nucleic acid encoding ATGL) are As used herein, the term “modulate” means to cause or encompassed in embodiments of the invention. For example facilitate a qualitative or quantitative change, alteration, or Genbank Accession No.'s: JF809663.1; RefSeq (protein) modification in lipid accumulation within cells. Without such ACT09361.1 : ABS58651.1, AAW81962. 1: ACTO9362.1; change may be an increase or decrease in lipid accumulation. ADA57171.1; ABW93560.2: ADX66713.2; ACO05728.1; 40 The term “modulator” refers to any molecule or compound ADP24694.1; ADP24691.1; ADP24690.1; ABVO4327.1 etc. that causes or facilitates a qualitative or quantitative change in As used herein, "homologous', when used to describe a poly lipid accumulation within cells. nucleotide, indicates that two polynucleotides, or designated As used herein, a “subject’ means a human or animal. sequences thereof, when optimally aligned and compared, are Usually the animal is a vertebrate Such as a primate, rodent, identical, with appropriate nucleotide insertions or deletions, 45 domestic animal or game animal. In certain embodiments, the in at least 70% of the nucleotides, usually from about 75% to Subject is a mammal, e.g., a primate, e.g., a human. The terms, 99%, and more preferably at least about 98 to 99% of the “patient' and “subject” are used interchangeably herein. nucleotides. The term “homolog’ or “homologous as used The terms “decrease”, “reduced, “reduction”, “decrease' herein also refers to homology with respect to structure and/ or “inhibit are all used herein generally to mean a decrease or function. With respect to sequence homology, sequences 50 by a statistically significant amount. In some embodiments, are homologs if they are at least 50%, at least 60 at least 70%, “reduced, “reduction' or “decrease' or “inhibit means a at least 80%, at least 90%, at least 95% identical, at least 97% decrease by at least 10% as compared to a reference level, for identical, or at least 99% identical. The term “substantially example a decrease by at least about 20%, or at least about homologous' refers to sequences that are at least 90%, at least 30%, or at least about 40%, or at least about 50%, or at least 95% identical, at least 97% identical or at least 99% identical. 55 about 60%, or at least about 70%, or at least about 80%, or at Homologous sequences may be the same functional gene or least about 90%. protein in different species. The terms “increased, “increase' as used herein generally As used herein, “functional ATGL refers to ATGL enzyme mean an increase by a statically significant amount. In some that is capable of cleaving the first ester bond in triacylglyc embodiments, the terms “increased”, “increase' or erol (TAG) within cells. Methods for assessing ATGL enzyme 60 "enhance' or “activate” means an increase of at least 10% as activity are well known to those of skill in the art, e.g. as compared to a reference level, for example an increase of at described in Zimmermann et al. Science: Vol. 306 no. 5700 least about 20%, or at least about 30%, or at least about 40%, pp. 1383-1386. or at least about 50%, or at least about 60%, or at least about As used herein, "Non-functional ATGL refers to ATGL 70%, or at least about 80%, or at least about 90% or up to and enzyme that is not capable of cleaving the first ester bond in 65 including a 100% increase or any increase between 10-100% triacylglycerol (TAG) within cells, or to ATGL enzyme exhib as compared to a reference level, or at least about a 2-fold, or iting ATGL activity that is only “partially functional as com at least about a 3-fold, or at least about a 4-fold, or at least US 9,393,221 B2 41 42 about a 5-fold or at least about a 10-fold increase, or any group, a phosphate group, a fatty acid group, a linker for increase between 2-fold and 10-fold or greater as compared to conjugation, functionalization, etc. ... A polypeptide that has a reference level. a nonpolypeptide moiety covalently or noncovalently associ The term “statistically significant’ or “significantly refers ated therewith is still considered a “polypeptide'. Exemplary to statistical significance and generally means a two standard 5 modifications include glycosylation and palmitoylation. deviation (2SD) below or above a reference measurement. Polypeptides may be purified from natural sources, produced The term refers to statistical evidence that there is a differ using recombinant DNA technology, synthesized through ence. It is defined as the probability of making a decision to chemical means Such as conventional Solid phase peptide reject the null hypothesis when the null hypothesis is actually synthesis, etc. The term “polypeptide sequence' or "amino true. The decision is often made using the p-value. 10 acid sequence' as used herein can refer to the polypeptide As used herein, an "RNA interference molecule” refers to material itself and/or to the sequence information (e.g., the a compound which interferes with or inhibits expression of a succession of letters or three letter codes used as abbrevia target gene or genomic sequence by RNA interference tions for amino acid names) that biochemically characterizes (RNAi). Such RNA interfering agents include, but are not a polypeptide. A polypeptide sequence presented herein is limited to, nucleic acid molecules including RNA molecules 15 presented in an N-terminal to C-terminal direction unless which are homologous to the target gene or genomic otherwise indicated. sequence, or a fragment thereof, short interfering RNA The term “identity” as used herein refers to the extent to (siRNA), short hairpin or small hairpin RNA (shRNA), which the sequence of two or more nucleic acids or polypep microRNA (miRNA) and small molecules which interfere tides is the same. The percent identity between a sequence of with or inhibit expression of a target gene by RNA interfer interest and a second sequence over a window of evaluation, ence (RNAi). e.g., over the length of the sequence of interest, may be The term “polynucleotide' is used herein interchangeably computed by aligning the sequences, determining the number with “nucleic acid' to indicate a polymer of nucleosides. of residues (nucleotides oramino acids) within the window of Typically a polynucleotide of this invention is composed of evaluation that are opposite an identical residue allowing the nucleosides that are naturally found in DNA or RNA (e.g., 25 introduction of gaps to maximize identity, dividing by the adenosine, thymidine, guanosine, cytidine, uridine, deoxyad total number of residues of the sequence of interest or the enosine, deoxythymidine, deoxyguanosine, and deoxycyti second sequence (whichever is greater) that fall within the dine) joined by phosphodiester bonds. However the term window, and multiplying by 100. When computing the num encompasses molecules comprising nucleosides or nucleo ber of identical residues needed to achieve a particular per side analogs containing chemically or biologically modified 30 cent identity, fractions are to be rounded to the nearest whole bases, modified backbones, etc., whether or not found in number. Percent identity can be calculated with the use of a naturally occurring nucleic acids, and such molecules may be variety of computer programs known in the art. For example, preferred for certain applications. Where this application computer programs such as BLAST2, BLASTN, BLASTP, refers to a polynucleotide it is understood that both DNA, Gapped BLAST, etc., generate alignments and provide per RNA, and in each case both single- and double-stranded 35 cent identity between sequences of interest. The algorithm of forms (and complements of each single-stranded molecule) Karlin and Altschul (Karlin and Altschul, Proc. Natl. Acad. are provided. “Polynucleotide sequence” as used herein can Sci. USA 87:22264-2268, 1990) modified as in Karlin and refer to the polynucleotide material itself and/or to the Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993 is sequence information (e.g. The Succession of letters used as incorporated into the NBLAST and XBLAST programs of abbreviations for bases) that biochemically characterizes a 40 Altschul et al. (Altschul, et al., J. Mol. Biol. 215:403-410, specific nucleic acid. A polynucleotide sequence presented 1990). To obtain gapped alignments for comparison pur herein is presented in a 5' to 3’ direction unless otherwise poses, Gapped BLAST is utilized as described in Altschulet indicated. al. (Altschul, et al. Nucleic Acids Res. 25:3389-3402, 1997). The nucleic acid molecules that inhibit lipid accumulation When utilizing BLAST and Gapped BLAST programs, the can be inserted into vectors and used as gene therapy vectors. 45 default parameters of the respective programs may be used. A Gene therapy vectors can be delivered to a subject by, for PAM250 or BLOSUM62 matrix may be used. Software for example, intravenous injection, local administration (see performing BLAST analyses is publicly available through the U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., National Center for Biotechnology Information (NCBI). See Chen et al. Proc. Natl. Acad. Sci. USA91:3054-3057, 1994). the Web site having URL www.ncbi.nlm.nih.gov for these The pharmaceutical preparation of the gene therapy vector 50 programs. In a specific embodiment, percent identity is cal can include the gene therapy vector in an acceptable dilutent, culated using BLAST2 with default parameters as provided or can comprise a slow release matrix in which the gene by the NCBI. delivery vehicle is imbedded. Alternatively, where the com All patents and other publications identified are expressly plete gene delivery vector can be produced intact from recom incorporated herein by reference for the purpose of describ binant cells, e.g., retroviral vectors, the pharmaceutical 55 ing and disclosing, for example, the methodologies described preparation can include one or more cells which produce the in Such publications that might be used in connection with the gene delivery system. present invention. These publications are provided solely for The terms “polypeptide' as used herein refers to a polymer their disclosure prior to the filing date of the present applica of amino acids. The terms “protein’ and “polypeptide' are tion. Nothing in this regard should be construed as an admis used interchangeably herein. A peptide is a relatively short 60 sion that the inventors are not entitled to antedate such dis polypeptide, typically between about 2 and 60 amino acids in closure by virtue of prior invention or for any other reason. All length. Polypeptides used herein typically contain amino statements as to the date or representation as to the contents of acids such as the 20 L-amino acids that are most commonly these documents is based on the information available to the found in proteins. However, other amino acids and/or amino applicants and does not constitute any admission as to the acid analogs known in the art can be used. One or more of the 65 correctness of the dates or contents of these documents. amino acids in a polypeptide may be modified, for example, To the extent not already indicated, it will be understood by by the addition of a chemical entity such as a carbohydrate those of ordinary skill in the art that any one of the various US 9,393,221 B2 43 44 embodiments herein described and illustrated may be further Generation and Characterization of a TGL-KO and WT iPSC modified to incorporate features shown in any of the other Lines embodiments disclosed herein. We introduced the pluripotency reprogramming factors The following examples illustrate some embodiments and (Oct4, Sox2, Klf4, and c-Myc) (Takahashi and Yamanaka, aspects of the invention. It will be apparent to those skilled in 5 2006) into embryonic fibroblasts derived from ATGL-KO and the relevant art that various modifications, additions, Substi WT littermates (Haemmerle et al., 2006). When maintained tutions, and the like can be performed without altering the in an undifferentiated state, the resulting KO and WT iPSC spirit or scope of the invention, and Such modifications and lines expressed pluripotency markers such as SSEA-1, variations are encompassed within the scope of the invention Nanog, Sox2, and alkaline phosphatase at levels similar to an as defined in the claims which follow. The following 10 established undifferentiated ES cell line ((data not shown). examples do not in any way limit the invention. Upon invitro differentiation, both KO and WT iPSCs and the control ES cell line downregulated their expression of pluri EXAMPLES potency genes (Oct4. SoX2, and Nanog) and upregulated their expression of cardiac (cTnT. NRkX2.5, Gata4), hematopoi Example 1 15 etic (Gata1), endodermal (FoxA2, AFP), and neuronal mark ers (Nestin) (FIG. 1). We confirmed that the KO iPSC line did High Throughput Screening for Small Molecules not express ATGL throughout the course of differentiation that Modulate Intracellular Lipid Accumulation (FIG. 1). Quantitative PCR confirmed the propertime-depen dent expression patterns of Oct4, Brachyury, Mlc-2V, FoxA2, Induced pluripotent stem cells (iPSCs) hold great promise and Nestin in differentiating KO and WT iPSCs and control for a wide variety of biomedical applications, including ES cells (FIG. 2), and immunocytochemistry for the expres regenerative medicine (Lengner, 2010), cell therapy for sion of germ-layer markers in Nestin, AFP, and cTNT in the genetic diseases (Raya et al., 2009), and drug discovery (Gu WT, KO iPSCs and ES cells at day 12 of differentiation naseeli et al., 2010). While significant progress has been confirmed the presence of cardiac troponin T (cTnT), D-fe made in the generation of pluripotent stem cell models to 25 toprotein (AFP), and Nestin-positive cells in differentiated study physiological and disease processes of major organs ATGL-KO and WTIPSC and control ES cell cultures. These such as the heart (Laflamme et al., 2007: van Laake et al., data indicate that the loss of ATGL does not affect germ layer 2007; Moretti et al., 2010), central nervous system (Werniget differentiation, as expected given the viable ATGL-KO al., 2008: Dimos et al., 2008:Tsuji et al., 2010), blood (Ride mouse phenotype observed in vivo (Haemmerle et al., 2006). out et. al., 2002; Grigoriadis et al., 2010), and pancreas (Chen 30 We measured the levels of intracellular lipid accumulation et al., 2009; Kobayashi, T. et al., 2010), the successful appli using Oil Red O (ORO) staining in differentiating ATGL-KO, cation of iPSC-based disease modeling in high throughput WT, and ES cells at days 0, 7, 12, and 17. While all three cell drug discovery has not yet been reported. The development of lines exhibited a progressive increase in ORO accumulation, iPSCs as a drug discovery platform presents a number of by day 12 this increase was significantly more pronounced in challenges, including the need to control lineage-specific dif 35 ATGL-KO iPSCs than in WT iPSCs or ES cells (data not ferentiation, recapitulate complex disease phenotypes in shown). The ratio of normalized ORO levels between KO and vitro, and develop robust, quantitative measurements of these WT iPSCs increased from 1.2+0.1-fold (meants.d., P<0.05) phenotypes in order to assess efficacy of drug treatment. In at day 0 to 1.8+0.3-fold (P<0.05) at day 17 of differentiation light of these considerations, we chose to examine neutral (FIG. 3). A detailed composition profile of the accumulated lipid storage disease, myopathy subtype (NLSD-M), based 40 lipids in differentiated ATGL-KO iPSCs was obtained using a on several features that render it particularly amenable for high sensitivity, targeted LC-MS-based analysis (Rhee et al. iPSC-based drug screening. 2010), and it confirmed that most TAG species were elevated In the present study, we developed both a murine and a in KO cells compared to WT cells (FIG. 4a). Interestingly, human iPSC model of NLSD-M for high throughput appli cholesteryl esters were also elevated, while phosphatidylcho cations using fibroblasts derived from ATGL-KO mice and 45 line species were decreased (FIGS. 4b-d). NLSD-M patients. Differentiation of murine ATGL-KO and Given the massive lipid accumulation in the ATGL-KO human NLSD-M iPSCs recapitulated the intracellular lipid mouse heart (Haemmerle et al., 2006), we examined whether accumulation phenotype observed in Vivo in humans and cardiomyocytes and Smooth muscle cells derived from mice. From the mouse model, We established a robust, high ATGL-KO iPSCs display preferential lipid uptake. Immun throughput invitro differentiation and Small molecule screen 50 ofluorescent and ORO co-staining of differentiated KO iPSCs ing platform, using a quantitative colorimetric assay for intra for cTnT-positive cardiomyocytes revealed enhanced lipid cellular lipid to evaluate for reversal of the disease phenotype. accumulation in these cells compared with similar cells Examination of the top-scoring screen hits in secondary derived from WT iPSCs or ES cells (data not shown). Lipid assays confirmed their lipid-lowering effects in both mouse accumulation was somewhat less pronounced in KO iPSC ATGL-KO and human NLSD-M iPSCs. Further mechanistic 55 derived Smooth muscle cells compared to that in cardiomyo studies revealed that treatment with compounds that shift cytes (data not shown), consistent with the reported in vivo cellular energy metabolism from fatty acid oxidation to gly phenotype of the KO mouse (Haemmerle et al., 2006). ORO colysis led to reduced lipid accumulation. Thus, in addition to staining in cTnT. and SM-MHC-positive ATGL-WT iPSC identifying pharmacological modulators of a disease pheno and ES-derived cells. Immuno-costaining for ORO and cTnT type, the use of an iPSC-based high throughput drug screen 60 and SM-MHC in ATGL-WT iPSCs and control ES cells was ing platform has also allowed us to explore the dysregulated performed at day 12 of differentiation. metabolic processes underlying the disease. Our demonstra High throughput screening for Small molecules that modu tion here of a Successful application of high throughput drug late intracellular lipid accumulation The ATGL-KO iPSCs screening using differentiated murine iPSCs and secondary were then adapted to 96-well plate cultures to facilitate validation using human iPSC, provides a paradigm for the 65 screening of the PrestwickD collection of 1118 structurally utility of iPSC-based disease modeling in drug screening and diverse, off-patent drugs, many with established bioavailabil novel disease pathway discovery. ity and safety profiles in humans. ATGL-KO iPSCs were US 9,393,221 B2 45 46 differentiated in the presence of candidate compounds for 7 In Vivo Validation of Top Screening Candidates to Reduce days, after which ORO uptake was measured in each sample Intracellular Lipid Accumulation and normalized against cell number, as assessed by a resa While the ability of top screen hits to reduce intracellular Zurin cell viability assay (screen protocol depicted in FIG. lipid accumulation in vitro is encouraging, the demonstration 5a). Individual compound results were converted to Z-scores of an effect in vivo is essential in order to translate these to reflect their performances relative to DMSO-treated con findings into a clinically relevant setting. We designed an trol cells (see Table 1). Compounds that induced a decrease in 18-week observer-blinded placebo-controlled study treating lipid accumulation while preserving cell viability resulted in both wild type and ATGL-KO mice with mefloquine, per negative Z-scores. Inspection of the compounds with the most hexyline, and high and low doses of vinpocetin starting from 10 3 weeks after birth. We assess the survival of each animal negative Z-scores (the top-scoring hits) revealed several throughout the entire treatment course. We also measured the drugs that shift cellular metabolism from mitochondrial res cardiac function of each animal before treatment and at 10 piration towards glycolysis (either by activating glycolysis or and 14 weeks of age. As shown in FIG. 8a, significant pro inhibiting oxidative respiration) (Gohil et al., 2010), as well longation in overall survival (-30% increase) was observed in as a number of calcium channel blockers, anticholinergics of 15 all treatment groups compared with untreated ATGL-KO ani the muscarinic type, and other cardioprotectants such as anti mals. This was corroborated by the echocardiographic hypertensives and vasodilators (FIG.5b). improvements in cardiac function in mefloquine and perhexy Compounds that shift energy metabolism away from oxi line treated animals at 14 weeks of age (data not shown and dative respiration towards glycolysis (glycolytic Switch FIG. 8b). In addition, the hearts of ATGL-KO mice exhibit inducers') may mitigate the demand for fatty acids as an significant increase in triglyceride content compared with energy source, which in turn could reduce the drive for fatty wildtype mice (~ 190 ug/gvs. 45ug/g) (FIG.8c). Remarkably, acid uptake or synthesis and decrease intracellular lipid accu treatment with mefloquine, perhexyline, and vinpocetin all mulation. To examine this hypothesis in a more systematic led to reduction in the overall triglyceride content in the heart manner, we tested whether compounds with potential glyco (FIG. 8d and as determined by ORO staining of frozen heart lytic Switch activity are statistically enriched among the top 25 sections, data not shown). The effect of these drugs on trig hits in our screen. We identified a set of 41 potential glycolytic lyceride content was observed variably in other tissues such Switch inducers from the screening library using a previously as liver, lung, and kidney (FIG. 8e). While these drugs were reported data set of such compounds (Gohil et al., 2010) able to elicit a similar reduction in triglyceride content, they (Table 2). We then calculated a weighted Kolmogorov appear to do so by recruiting genes involved in distinct path Smirnov-like statistic, the normalized enrichment score 30 ways. (FIG. 8f) (NES), that reflects the extent to which members of this Reduction of Intracellular Lipid Accumulation in NLSD-M compound set are statistically enriched among compounds Human iPSCs with the most negative Z-scores (Shaw et al., 2010, Subrama The ability of top drug screen hits to reduce intracellular nian et al., 2005). The NES statistic revealed enrichment of lipid accumulation in the hearts of ATGL-KO mice supports glycolytic Switch inducers among the top-scoring com 35 the utility of these drugs to regulate metabolic pathways in pounds; five out of the top 10 screen hits and 9 out of the top patients with NLSD-M. However, the limited access to such 50 were members of the glycolytic switch compound set patient population (currently only 17 patients world-wide (p<0.001 by random permutation of compound sets) (FIG.5c carrying Such diagnosis) makes it very challenging to validate and Table 2). the utility of the drug screen hits. As a proof-of-principal of The lipid-lowering effect of seven of the top-scoring hits 40 the ability of our drug hits to reduced intracellular lipid accu are listed in Table 3. mulation in human NLSD-M, we generated human iPSC from two Japanese patients (LC1 and LC2) with NLSD-M (also known as Triglyceride Cardiomyovasculopathy TABLE 3 (TGCV) in Japan) and demonstrated the ability of their skin Validated screen hits 45 fibroblasts to fully reprogram into iPSCs. that express high levels of pluripotency genes such as Nanog, Oct4, and Sox2 Screen concentration by immunofluresence microscopy (FIG. 9a, data not shown). Compound (M) Known or putative functions' Injection of these human iPSCs into immunedeficient mice resulted in the formation of teratoma that contains cells from Fendiline 15 Ca"-channel blocker; coronary 50 hydrochloride vasodilator all three germ layers as determined using hematoxylin and Vinpocetine 15 Phosphodiesterase inhibitor; eosin staining (data not shown). The staining showed thae vasodilator; glycolytic switch" presence of chondrocyte, boney spicule, squamous cells, cili Mefloquine 12 Antimalarial; glycolytic switch" ated columnar epithelium, and neurons interatoma (data not hydrochloride Perhexiline maleate 12 CPT-1 inhibitor: vasodilator: shown). Upon in vitro differentiation, these iPSC lines glycolytic switch?' 55 formed beating cardiomyocytes that stained positive for sar Dicyclomine 15 Anticholinergic (muscarinic) comeric actinin usinfanti-sarcomeric actinin antibody and hydrochloride co-staining with oil Red O (data not shown). Tomatine 5 Antifungal Remarkable, most of the cardiomyocytes from NLSD-M Clidinium bromide 15 Anticholinergic (muscarinic) iPSCs co-stained with Oil Red O while none of the cardi 60 omyocytes from control normal iPSCs show Oil Red O posi These represent a variety of functional classes, and were tive staining (data not shown). Given the faithful recapitula confirmed in secondary assays demonstrating dose-depen tion of the lipid accumulation phenotype, we assess whether dent effects (FIG. 6a) as well as sustained drug efficacy in our top drug hits can reduce lipid accumulation inhuman cells older, lineage-committed ATGL-KO iPSCs (FIG. 6b). We in vitro. As shown in FIG. 9b, treatment with mefloquine confirmed that drug treatment did not alter the course of 65 appears to significantly reduce intracellular lipid content. differentiation of the iPSCs, as assessed by the expression Metabolic and Energetic Effects of Screen Positives on a levels of differentiation markers (FIG. 6c). TGL-KO and WY iPSCs US 9,393,221 B2 47 48 While the energy starvation and cold intolerance pheno ni's anemia (Raya et al., 2009), long QT syndrome (Morettiet types of ATGL-KO mice are consistent with the decreased al., 2010), ALS (Dimos et al., 2008), familial dysautonomia availability of fatty acids as an energy source, the compensa (Lee et al., 2009), Type 1 diabetes (Maehr et al., 2009), and tory mechanism by which KO cells generate the necessary LEOPARD syndrome (Carvajal-Vergara et al., 2010) have all amount of ATP for growth and survival remains unclear been recently reported. These studies demonstrate the ability (Haemmerle et al., 2006). The limited availability of intrac of in vitro differentiated iPSCs to recapitulate relevant ellular free fatty acid as an energy source in ATGL-KO mice aspects of a disease phenotype; however, to the best of our Suggests that these animals have adapted to greater glucose knowledge, no report has yet been made of their use in high utilization. In accordance with this hypothesis, ATGL-KO throughput screens to identify new molecules or pathways mice exhibit increased glucose tolerance and uptake (Haem 10 merle et al., 2006). To study this adaptation at the cellular that regulate the disease process. level, we measured oxygen consumption rates (OCR) and We have demonstrated here that the intracellular lipid extracellular acidification rates (ECAR) on day 10 of ATGL accumulation phenotype of ATGL-1KO mice and patients KO and WT iPSC differentiation. OCR and ECAR measure with NLSD-M was faithfully recapitulated in murine ATGL ments reflect cellular oxidative respiration and glycolytic lac 15 KO and human NLSD-M iPSCs, allowing for the develop tic acid production, respectively. Interestingly, we observed ment of an effective screening platform. From screening that WT and KO iPSCs exhibited similar OCRs (FIG. 7a), murine ATGL-KO iPSCs, we identified a number of mecha Suggesting similar rates of oxidative respiration, while the nistically distinct families of compounds that reduce intrac ECAR of KO cells was reduced by 34+15% (meants.d. ellular lipid accumulation. These results support the use of P<0.001; FIG.7b). This suggests eitheran overall decrease in iPSC disease modeling not only as a platform for drug screen glycolysis in KO iPSCs, an unlikely event given the energy ing, but also as a tool for novel disease or physiological starvation phenotype, or more probably, an increased adap pathway discovery. In the case of reversing the ATGL-KO tation to glucose and the utilization of pyruvate in the TCA phenotype in vitro, the most effective compounds have pur cycle at the expense of its conversion to lactic acid. ported activities that either directly or indirectly impact cel We next investigated whether the top-scoring compounds 25 lular energy metabolism. For example, we found that glyco with reported glycolytic switch properties could in fact lytic Switch inducers, the most commonly represented class modulate the OCR and ECAR of differentiated WT and KO of compounds among the top hits, consistently reduced lipid iPSCs. We pre-treated day 9 differentiated cells overnight accumulation in ATGL-KO iPSCs. This was achieved by with mefloquine, Vinpocetine, and perhexyline at their screen increased rates of glycolysis and decreased rates of oxidative concentrations (Table 3) and measured the changes in OCR 30 respiration. These results suggest that a regulatory feedback and ECAR. As expected, treatment with each of these com loop may link energy Substrate usage to the import or synthe pounds resulted in a decreased OCR and an increased ECAR sis of fatty acids and thus influence overall accumulation of in both WT and KO iPSCs (FIGS. 7a and 7b), suggesting that lipid droplets in cells (see model in FIG. 7e-f). In WT cells, the cells have decreased rates of TCA cycle and electron this process is finely balanced against TAG hydrolysis to meet transport chain utilization and increased rates of glycolysis 35 the metabolic demands of the cell. In ATGL-KO cells, and lactic acid production. Interestingly, perhexyline, an impaired hydrolysis of TAG results in TAG accumulation in inhibitor of carnitine palmitoyltransferase 1 (CPT-1), which lipid droplets and decreases the supply of fatty acid substrate regulates mitochondrial fatty acid import/utilization via the for B-oxidation, resulting in a compensatory increased in TCA cycle (Kennedy et al., 1996), had a smaller impact on oxidation of glucose-derived pyruvate in the mitochondria. In OCR in KO cells compared to WT cells. This is consistent 40 drug-treated ATGL-KO cells, the modulation of energy with the increased adaptation to glucose in ATGL-KO cells. metabolism towards increased glycolysis reduces the demand To determine whether the glycolytic switch inducers work for fatty acid uptake and hence reduces overall lipid accumu through common or distinct mechanisms, we next examined lation. how the responses of ATGL-KO and WT cells to challenge This drug-mediated change in cellular metabolism is with carbonyl cyanide m-chlorophenyl hydrazone (CCCP) 45 analogous to a reversion to a fetal metabolic profile in the differed upon pre-treatment with glycolytic switch inducers. ATGL-KO cells, whereby glycolysis and lactate production CCCP is an uncoupler of the mitochondrial hydrogen gradi are upregulated and fatty acid uptake and oxidation are down ent that induces maximal cellular oxidative respiration (Gold regulated (Girard et al. 1992). This metabolic profile may be sby et al., 1963). Interestingly, in both WT and KO differen responsible for protecting ATGL-KO mice from accumulat tiated iPSCs that had been pre-treated with mefloquine and 50 ing intracellular lipid droplets until after birth, when aerobic vinpocetine, the addition of CCCP increased the ratio of metabolism becomes predominant. This would explain the OCAR/ECAR (FIGS. 7c and 7d), similar to the response postnatal disease phenotype observed in the KO mice and observed in DMSO control cells. This was due entirely to an progressive increase in lipid accumulation in the hearts of KO increase in OCAR, as the ECAR levels remained relatively mice (FIG. 8c), despite the loss of ATGL function throughout unchanged (data not shown). However, treatment with per 55 embryonic development (Haemmerle et al., 2006). Reverting hexyline resulted in no increase in the OCR/ECAR ratio to the fetal metabolic profile via pharmaceutical intervention (FIGS. 7c and 7d), consistent with the direct inhibition of should thus be protective in these mice, and potentially, in mitochondrial fatty Oxidation by perhexyline. These data Sug human NLSD-M patients. In support of this, we show that gest that mefloquine and vinpocetine regulate cell metabo iPSCs derived from patients with NLSD-M exhibit intracel lism via a different mechanism(s) from that of perhexyline. 60 lular lipid accumulation in cardiomyocytes (data not shown) Recent advances in cellular reprogramming biology have and this phenotype can be reversed by treatment with one of enabled the generation of patient-specific iPSCs for in vitro the top hits from our high throughput Screen. The continued disease modeling. In principle, the availability of these cell exploration of the role of metabolic programming and its lines should facilitate therapeutic screening for molecules or molecular basis in NLSD-M will be the focus of future studies pathways that modulate the development of the disease phe 65 using murine and human NLSD-MiPSC models, as the clear notype (Gunaseeli et al., 2010; Ebert and Svendsen, 2010; ability of glycolytic Switch inducers to reduce lipid accumu Kiskinis and Eggan, 2010). Patient-specific iPSCs for Fanco lation can be used for both in vitro and in vivo therapeutic use. US 9,393,221 B2 49 50 Our investigation of NLSD-M using murine ATGL-KO transactivator (rtTA). Forty-eight hours post-infection, the and human iPSCs as in vitro disease models has provided cells were plated onto a feeder layer of mitomycin c-treated novel insights into the metabolic disturbances that take place mouse embryonic fibroblasts (mMEF) in ES cell medium in the absence of ATGL and their recovery in the presence of (high-glucose DMEM, 15% FBS, 2 mM L-glutamine, 100 Small molecule modulators. In the process, we have taken 5 uM NEAA 100 LM 2-mercaptoethanol, 103 units/mL LIF). care to address an important caveat to the use of iPSCs as Doxycycline (1 g/mL) was added and Subsequently disease models, namely, that differentiated cells derived from refreshed every 2-3 days to induce viral expression. Colonies iPSCs are largely immature and hence may fail to display the with ES cell-like morphology were observed at approxi expected disease phenotype. The fact that ATGL-KO mice do mately 10 to 14 days post-infection and were manually not exhibit increased lipid accumulation in tissues until after 10 selected for clonal expansion. birth initially raised concerns that we would observe minimal For the generation of human NLSD-M iPSCs, we infected or no disease phenotype in differentiated KO iPSCs (Haem skin fibroblasts from two patients (LC1 and LC2) with merle et al., 2006). Surprisingly, we found that the KO iPSCs NLSD-M and one normal individual for two day with poly developed robust lipid accumulation in a differentiation-de cystronic lentiviruses containing human cDNA sequences for pendent fashion over a relatively short period of time. This 15 Octa, Sox2, Klf4, and c-Myc. The infected cells were plated Suggests that diseases that manifest clinically well after birth onto mMEF in embryonic fibroblasts medium followed by (i.e. in the adolescent or adult years) may still be amenable to mTeSRR) medium. Colonies with ES cell-like morphology in vitro modeling via iPSC technology. Ultimately, the most were observed approximately 10 to 14 days post-infection important confirmation of the utility of iPSCs for novel drug and were manually selected for clonal expansion. and pathway discovery will be to show that the findings In Vitro iPSC Differentiation identified in vitro and in animal models are relevant to treat The ATGL-KO and WT iPSC lines and a control ES cell ment of human patients. The current demonstration of the line (NK5-2) (Wu, S. M. et al., 2006) were maintained feasibility of a high throughput Small molecule screen utiliz according to a previously described protocol (Huang and Wu, ing disease-specific iPSCs is an important first step towards 2010). In vitro differentiation was initiated by plating cells accomplishing this goal. 25 either as hanging-droplets (Wobus et al., 1991) or as a mono layer in feeder-free gelatin-coated 96-well plates (Huang and Experimental Procedures Wu, 2010). The cells were then incubated in differentiation medium (IMDM, 15% FBS, 2 mM L-glutamine, 0.001% v?v Murine and Human iPSC Generation and monothioglycerol, 50 ug/mL ascorbic acid) for the desired Maintenance 30 number of days prior to Subsequent assays. Gene Expression Analysis Unless otherwise specified, all cell cultures were main Cells were solubilized in Trizol reagent (Invitrogen) and tained in 37° C., 5% CO2 incubators. Using a previously total RNA was purified using the RNeasy Mini Kit (Qiagen). described tetracycline-inducible lentiviral expression system cDNA was synthesized using iScript (BioRad), and RT-PCR (Stadtfeld et al., 2008), we generated murine ATGL-KO and 35 was performed using GoTaq polymerase (Promega). Quanti WT iPSC lines from embryonic fibroblasts derived from tative PCR was performed using USB SYBR-Green master ATGL-1KO and WT littermates (Haemmerle et al., 2006), mix. (Affymetrix) on an EP Realplex thermal cycler (Eppen respectively. Briefly, ATGL-KO and WT fibroblasts were dorf). Gene expression was calculated using the standard infected with tet-inducible lentiviruses containing mouse curve method and normalized against the expression of cDNA sequences for c-Myc (T58A mutant), Klf4, Oct4, and 40 GAPDH in the same sample. A list of primers used is given in SoX2, as well as a lentivirus expressing reverse tetracycline Table 4. TABLE 4 Gene expression primers Target Forward (5' to 3') Reverse (5' to 3')

Oct 4 CTCCCGAGGAGTCCCAGGACAT GATGGTGGTCTGGCTGAACACCT (SEQ ID NO: 2) (SEQ ID NO : 3)

Sox2 GCGGAGTGGAAACTTTTGTCC CGGGAAGCGTGTACTTATCCTT (SEQ ID NO : 4) (SEO ID NO. 5)

Nanog CAAGGGTCTGCTACTGAGATGC TTTTGTTTGGGACTGGTAGAAGAA TCTG TCAG (SEQ ID NO : 6) (SEO ID NO : 7)

cTnT. CAGAGGAGGCCAACGTAGAAG CTCCATCGGGGATCTTGGGT (SEQ ID NO: 8) (SEO ID NO: 9)

Nkx2.5 GACAAAGCCGAGACGGATGG CTGTCGCTTGCACTTGTAGC (SEQ ID NO: 10) (SEQ ID NO: 11)

Galta4 CTGTCATCTCACTATGGGCA CCAAGTCCGAGCAGGAATTT SEQ ID NO: 12) (SEQ ID NO: 13)

FoxA2 CCCTACGCCAACATGAACTCG GTTCTGCCGGTAGAAAGGGA (SEQ ID NO: 14) (SEQ ID NO: 15)

AFP AACTCTGGCGATGGGTGTTTA ACACTGATGTCTTTCCACTCCA US 9,393,221 B2 51 52 TABLE 4 - continued Gene expression primers Target Forward (5' to 3') Reverse (5' to 3') (SEQ ID NO: 16) (SEO ID NO : 17)

Nestin CCCTGAAGTCGAGGAGCTG CTGCTGCACCTCTAAGCGA (SEQ ID NO: 18) (SEQ ID NO: 19)

Gata1 ACTGGCCTACTACAGAGAAGC GTAGAGTGCCGTCTTGCCATA (SEQ ID NO: 2O) (SEQ ID NO: 21)

PECAM CTGCCAGTCCGAAAATGGAAC CTTCATCCACCGGGGCTATC (SEQ ID NO: 22) (SEQ ID NO: 23)

Mc2W GCCAAGAAGCGGATAGAAGG CTGTGGTTCAGGGCTCAGTC (SEQ ID NO: 24) (SEQ ID NO: 25) Brachyury GCTGGATTACATGGTCCCAAG GGCACTTCAGAAATCGGAGGG (SEQ ID NO: 26) (SEO ID NO: 27)

GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 28) (SEQ ID NO: 29)

ATGL CAACGCCACTCACATCTACGG GGACACCTCAATAATGTTGGCAC (SEQ ID NO: 3 O) (SEQ ID NO: 31)

25 Immunocytochemistry resaZurin and ORO assays. Normalized ORO values were ATGL-KO and WT iPSCs and control ES cells were grown calculated for each compound- or DMSO-treated well and a on mMEF feeders in 24-well plates and fixed in 4% PFA for Z-score (see Statistical analysis section below) was subse immunostaining Cells from embryoid body (EB) cultures quently calculated for each compound treatment. Functional Were dissociated using collagenase (Roche Applied Science) 30 annotations of select top-scoring compounds were compiled at day 10 of differentiation and incubated on gelatin-coated from the NCBI PubChem database (http://pubchem.ncbi.n- chamber slides for an additional two days prior to fixation. A lm.nih.gov). list of antibodies used is given in the Supplemental Proce- Cellular Metabolism Assays dures. In co-staining experiments with Oil Red O, antibody ATGL-KO and WT iPSCs were differentiated as EBS to staining was performed first, followed by Oil Red O staining 35 day 9, then collagenase-dissociated and re-plated onto gela Evoo, Soo, were capturs on 53. tin-coated XF24 plates (Seahorse Bioscience, Andover, O m1croscope uS1ng a Le1.ca Mass.) at a density of 250,000 cells/well. Following an over (color, fluorescence) or DFC350FX camera (black and white, night incubation (12-16 hrs) in differentiation medium 2. ). supplemented with drugs or DMSO, the cells were accli 1. Ke taining " mated to atmospheric CO2 in drug-containing buffer-free Prior to ORO staining, cell cultures were first assessed for medium (Wu, M. et al., 2007) for 1 hour at 37° C. Oxygen yay s th E. tO t tal (Sigma), consumption rates (OCR) and extracellular acidification rates wnic N R e culture meE. at a fina R. R. (ECAR) were measured on the Seahorse Extracellular Flux tion of 50-75 uM. ResaZurin-treated cells were incubated for 24 Analyzer using previously established procedures (Gohil 2.5 hrs prior to reading the resoflurin fluorescent signal (exci- 45 et al., 2010; Wu, M. et al., 2007) and normalized against cell E. at is E. E. se e. O Wi Safire2 number as assessed by the resaZurinassay described above. In p A. Ca i ecan, y R l ..). The cu E.s R" all wells, antimycin, an electron transport chain inhibitor, was subsequently removed, and cells were washed wit : added at the end of the assay to ascertain that mitochondrial fixed in 10% formalin overnight, and stained with filtered Oil function in the drug-treated cells had been intact and that the Red O (Sigma) solution (60% isopropanol, 40% ddH2O). 50 OCR and ECAR results were not due to direct mitochondrial After removal of ORO solution, cells were washed multiple toxicity effects from drug treatment times with ddH2O water prior to visualization with phase- Statistical Analysis contrast microscopy. TO quantify the level of ORO, ORO- Z-scores were calculated as Z-scores were calculated as equivalent volumes of 100% isopropanol were added to each well and the absorbance at 500 nm was measured using the 55 Tecan Safire2 reader. The ratio of ORO absorbance units to O, - O resorufin fluorescence units (i.e. normalized ORO level) was Z = 2. calculated for each sample. For details of the preparation of DSO cell cultures for resaZurin/ORO staining. High Throughput iPSC Chemical Screening 60 where O, normalized ORO level of ATGL-KOcells treated ATGL-KO iPSCs were plated in 96-well plates at an initial with compound X, ODMSO-mean normalized ORO level of density of ~8000 cells/well in differentiation medium. Fol- DMSO-treated cells, and ODMSO=standard deviation of nor lowing one day of adherence and differentiation, the malized ORO levels in DMSO-treated samples. For all other PrestwickR) collection and DMSO controls were applied to analyses, the significance between two populations was the cells in duplicate wells using a CyBio Vario (R) automated 65 determined using a two-tailed students-test assuming normal pin-transfer robot (CyBio, Jena, Germany). The cells were distribution and unequal variances. A compound-set enrich then incubated for 6 additional days prior to analysis with the ment analysis, analogous to a gene set enrichment analysis US 9,393,221 B2 53 54 (Shaw et al., 2010; Subramanian et al., 2005), was performed pounds being included in the analysis. The glycolytic Switch to assess overrepresentation of glycolysis Switch inducers in set was obtained from a published dataset of such compounds the top-scoring screen hits. (Gohil et al., 2010). The top 41 compounds from the pub Lipidomics Assay lished dataset that were also in our ranked list (representing The lipidomic profiles for ATGL-KO and -WT iPSCs dif ~1% of total compounds in Gohil et al., 2010) were analyzed ferentiated to day 12 were obtained using LC-MS as (Table S2). described previously (Rhee et al., 2010), with the following Calculations were performed using the GSEA module of modifications for cultured cells. Cellular lipids were the GenePattern software suite (http://www.broadinstitute extracted from pelleted EB cultures (~106 cells) with 250 L .org/cancer/software/genepattern/) (Reich et al., 2006) using HPLC grade isopropanol (Sigma), and 2 L of the Supernatant 10 was directly injected onto a reversed-phase 150x3.0 mm Pro standard settings for pre-ranked lists. P-value for the glyco sphere HP C4 column (Grace, Columbia, Md.) for separation lytic switch set was calculated by randomly generating 1000 prior to analysis by a 4000 QTRAP triple quadrupole mass compound sets with the same number of compounds as our spectrometer (Applied Biosystems/Sciex, Foster City, glycolytic Switch set, and generating a null distribution from Calif.). MultiQuant software (version 1.1, Applied Biosys 15 the enrichment scores for these 1000 random compound sets. tems/ScieX) was used for automated peak integration and peaks were manually reviewed for quality of integration. REFERENCES Immunocytochemistry Primary antibodies used included those against Sox2 (Ab Carvajal-Vergara, X. Sevilla, A., D'Souza, S. L., Ang, Y. S., cam 59776-100), Nanog (CosmoBio REC-RCAB0002 PF), Schaniel, C., Lee, D. F., Yang, L., Kaplan, A. D., Adler, E. SSEA-1 (Hybridoma Bank MC-480), cTnT (NeoMarkers D. Rozov, R., et al. (2010). Patient-specific induced pluri MS-295-p1), sarcomeric actinin (Sigma A781 1), smooth potent stem cell-derived models of LEOPARD syndrome. muscle myosin heavy chain (Biomedical Technologies Nature 465, 808-812. BT-562), AFP (Santa Cruz 15375), and nestin (Abcam 6142). Chen, S., Borowiak, M., Fox, J. L., Maehr, R., Osafune, K., Alexafluor-488 conjugated secondary antibodies (Molecular 25 Davidow, L., Lam, K., Peng, L. F. Schreiber, S. L. Rubin, Probes) were used for visualization. L. L., et al. (2009). A small molecule that directs differen Oil Red O Staining tiation of human ESCs into the pancreatic lineage. Nat. To prepare differentiating ATGL-KO and -WT iPSCs for Chem. Biol. 5, 258-265. Oil Red O (ORO) staining, EBs were dissociated at day 6 Dimos, J.T., Rodolfa, K.T., Niakan, K.K., Weisenthal, L. M., using 0.25% trypsin/EDTA (Invitrogen, Carlsbad, Calif.) and 30 Mitsumoto, H., Chung, W., Croft, G. F. Saphier, G., Lei re-plated onto gelatin-coated 35-mm plates in serial dilutions bel, R., Goland, R., et al. (2008). Induced pluripotent stem to allow for similar cell numbers at different time points of cells generated from patients with ALS can be differenti staining. For certain experiments, the re-plated iPSCs were ated into motor neurons. Science 321, 1218-1221. incubated in the presence of select compounds from the high Ebert, A. D., and Svendsen, C. N. (2010). Human stem cells throughput screen prior to staining. Cells differentiated and 35 and drug screening: opportunities and challenges. Nat. treated as monolayers in 96-well plates were stained in situ. Rev. Drug. Discov. 5, 367-372. ResaZurin was added to the culture medium at a final concen Fischer, J., Lefevre, C., Morava, E., Mussini, J. M., Laforet, tration of 50 or 75 M for 96-well or 35-mm plates, respec P. Negre-Salvayre, A. Lathrop, M., and Salvayre, R. tively. For 35-mm plate samples, aliquots of medium were (2007). The gene encoding adipose triglyceride lipase (PN transferred to blank 96-well plates after the incubation period 40 PLA2) is mutated in neutral lipid storage disease with to enable reading on the TECAN machine. The culture myopathy. Nat. Genet. 39, 28-30. medium was Subsequently removed, and cells were washed Girard, J., Ferré, P. Pégorier, J. P., and Duée, P. H. (1992). with PBS, fixed in 10% formalin overnight, and stained with Adaptations of glucose and fatty acid metabolism during 35uIL (per well of a 96-well plate) or 1 mL (per 35-mm plate) perinatal period and Suckling-weaning transition. Physiol. of filtered Oil Red O solution (60% isopropanol, 40% 45 Rev. 72,507-562. ddH2O) for 3 or 5 minutes, respectively. After removal of Gohil, V.M., Sheth, S.A., Nilsson, R., Wojtovich, A. P. Lee, ORO solution, cells were washed multiple times withddH2O J. H., Perocchi, F., Chen, W., Clish, C. B. Ayata, C., water prior to elution with OR equivalent volumes of 100% Brookes, P.S., et al. (2010). Nutrient-sensitized screening isopropanol. for drugs that shift energy metabolism from mitochondrial Compound Set Enrichment Analysis (CSEA) 50 respiration to glycolysis. Nat. Biotech. 28, 249-255. CSEA is adapted from the Gene Set Enrichment Algorithm Goldsby, R. A., and Heytler, P. G. (1963). Uncoupling of developed to identify sets of coordinately regulated genes oxidative phosphorylation by carbonyl cyanide phenylhy within gene expression data (Shaw et al., 2010; Subramanian drazones. IL Effects of carbonyl cyanide m-chlorophenyl et al., 2005). Given a list of compounds ranked according to hydrazone on mitochondrial respiration. Biochemistry 2, normalized ORO score, and a pre-specified set of compounds 55 1142-1147. S (defined by a shared attribute), CSEA asks if members of set Grigoriadis, A. E., Kennedy, M., Bozec, A., Brunton, F. S are randomly distributed throughout the ranked list, or are Stenbeck, G., Park, I. H. Wagner, E. F., and Keller, G. M. enriched at the top or bottom. A normalized enrichment score (2010). Directed differentiation of hematopoietic precur (NES) is calculated by walking down the ranked list, increas sors and functional osteoclasts from human ES and iPS ing a running-Sum statistic whenever a member of set S is 60 cells. Blood 115, 2769-2776. encountered, and decreasing the running-Sum statistic when Gunaseeli, I., Doss, M. X., Antzelevitch, C., Hescheler, J., ever a compound not in set S is encountered. The enrichment and Sachinidis, A. Induced pluripotent stem cells as a score is a weighted Kolmogorov-Smirnov-like statistic. model for accelerated patient- and disease-specific drug Our ranked list consisted of all screened compounds, but discovery. (2010). Curr. Med. Chem. 17, 759-766. excluded those that significantly impaired cell viability (i.e. 65 Haemmerle, G., Lass, A. Zimmermann, R., Gorkiewicz, G., Z-score for ORO assay>2, or the extreme tail of the Z-score Meyer, C., Rozman, J., Heldmaier, G., Maier, R., Theussl, distribution (see FIG. 7b). This resulted in 1016/1118 com C., Eder, S., et al. (2006). Defective lipolysis and altered US 9,393,221 B2 55 56 energy metabolism in mice lacking adipose triglyceride Rideout, W. M. 3rd, Hochedlinger, K., Kyba, M., Daley, G. lipase. Science 312, 734-737. Q., Jaenisch, R. (2002). Correction of a genetic defect by Huang, X. and Wu, S.M. (2010). Isolation and characteriza nuclear transplantation and combined cell and gene tion of cardiac progenitor cells from pluripotent stem cells. therapy. Cell 109, 17-27. Curr. Protoc. Stem. Cell. Biol. In Press. 5 Shaw, S.Y., Blodgett, D. M., Ma, M. S., Westly, E. C., Clem Kennedy, J. A., Unger, S. A., and Horowitz, J. D. (1996). ons, P. A., Subramanian, A., and Schreiber, S. L. (2010). Inhibition of carnitine palmitoyltransferase-1 in rat heart Disease allele-dependent small-molecule sensitivities in and liver by perhexyline and amiodarone. Biochem. Phar blood cells from monogenic diabetes. Proc. Natl. Acad. macol. 52, 273-280. Sci. USA, in press. Kiskinis, E. and Eggan, K. (2010). Progress toward the clini 10 Stadtfeld, M., Brennand, K., and Hochedlinger, K. (2008). cal application of patient-specific pluripotent stem cells. J. Reprogramming of pancreatic Clin. Invest. 120, 51-59. Wobus, A. M., Wallukat, G. and Hescheler, J. (1991). Pluri Kobayashi, K., Inoguchi, T., Maeda, Y., Nakashima, N., potent mouse embryonic stem cells are able to differentiate into cardiomyocytes expressing chronotropic responses to Kuwano, A., Eto, E., Ueno, N., Sasaki, S., Sawada, F., 15 Fujii, M., et al. (2008). The lack of the C-terminal domain adrenergic and cholinergic agents and Ca2+ channel block of adipose triglyceride lipase causes neutral lipid storage ers. Differentiation 48, 173-182. disease through impaired interactions with lipid droplets. J. Wu, M., Neilson, A., Swift, A. L., Moran, R., Tamagnine, J., Parslow, D., Armistead, S., Lemire, K., Orrell, J., Teich, J., Clin. Endocrinol. Metab. 93,2877-2884. et al. (2007). Multiparameter metabolic analysis reveals a Kobayashi, T., Yamaguchi, T., Hamanaka, S. Kato-Itoh, M., close link between attenuated mitochondrial bioenergetic Yamazaki, Y., Ibata, M., Sato, H., Lee, Y. S., Usui, J., function and enhanced glycolysis dependency in human Knisely, A. S., et al. (2010). Generation of rat pancreas in tumor cells. Am. J. Physiol. Cell Physiol. 292, C125-C136. mouse by interspecific blastocyst injection of pluripotent Wu, S. M., Fujiwara, Y., Cibulsky, S. M., Clapham, D. E., stem cells. Cell 142, 787-799. Lien, C. L., Schultheiss, T. M., and Orkin, S. H. (2006). Laflamme, M.A., Chen, K.Y., Naumova, A.V., Muskheli, V., 25 Developmental Origin of a Bipotential Myocardial and Fugate, J. A., Dupras, S. K. Reinecke, H., Xu, C., Hassa Smooth Muscle Cell Precursor in the Mammalian Heart. nipour, M., Police, S., et al. (2007). Cardiomyocytes Cell 127, 1137-1150. derived from human embryonic stem cells in pro-survival Reich, M., Liefeld, T., Gould, J., Lerner, J., Tamayo, P., and factors enhance function of infarcted rat hearts. Nat. Bio Mesirov, J. P. (2006). GenePattern 2.0 Nat. Genet. 38, technol. 25, 1015-1024. 30 500-5O1. Lake, A.C., Sun, Y., Li, J. L., Kim, J. E., Johnson, J. W., Li, D., Revett, T., Shih, H. H., Liu, W., Paulsen, J. E., et al. (2005). TABLE 1 Expression, regulation, and triglyceride hydrolase activity Rank order of compounds according to their z-score of adiponutrin family members. J. Lipid Res. 46, 2477 35 2487. Compound Name Z-score Lee, G., Papapetrou, E. P. Kim, H., Chambers, S. M., Tom Fendiline hydrochloride -2.53 ishima, M. J., Fasano, C. A., Ganat, Y. M., Menon, J., Vinpocetine -24105 Shimizu, F. Viale, A., et al. (2009). Modelling pathogen Mefloquine hydrochloride -2.3573 Perhexiline maleate -2.3117 esis and treatment of familial dysautonomia using patient 40 Dicyclomine hydrochloride -2.1533 specific iPSCs. Nature 461, 402-406. Tacrine hydrochloride hydrate -2.143 Lengner, C. J. (2010). iPS cell technology in regenerative Tomatine -2.0901 Gossypol -2O704 medicine. Ann. N.Y. Acad. Sci. 1192, 38-44. 2-Aminobenzenesulfonamide -19389 Maehr, R., Chen, S., Snitow, M., Ludwig, T., Yagasaki, L., Napelline -1.869 Goland, R., Leibel, R. L., Melton, D.A. (2009). Generation 45 Clidinium bromide -1.8548 of pluripotent stem cells from patients with type 1 diabetes. Estrone -1.8166 Zuclopenthixol hydrochloride -1.8O38 Proc. Natl. Acad. Sci. USA 106, 15768-15773. Cortisone -1.8033 Moretti, A., Bellin, M., Welling, A., Jung, C. B., Lam, J. T., Bepridil hydrochloride -1.7961 Bott-Flügel, L., Dorn, T., Goedel, A., Höhnke, C., Hof Monocrotaline -1.7819 mann, F., et al. (2010). Patient-Specific Induced Pluripo 50 Solanine alpha -1.7798 Nitrendipine -1.7782 tent Stem-Cell Models for Long-QT Syndrome. N. Engl.J. Metyrapone -1.7744 Med. 363, 1397-1409. Estropipate -1.7711 Pinent, M., Hackl, H., Burkard, T.R., Prokesch, A., Papak, C., Lorglumide Sodium salt -1.7664 Scheideler, M., Hämmerle, G. Zechner, R., Trajanoski, Z. Spironolactone -1.7632 55 Butylparaben -1.7629 and Strauss, J. G. (2008). Differential transcriptional Epitiostanol -1.7564 modulation of biological processes in adipocyte triglycer Seneciphylline -1.7519 ide lipase and hormone-sensitive lipase-deficient mice. Caffeic acid -1.7446 Genomics 92, 26-32. Ethopropazine hydrochloride -1.7382 Raya, A., Rodriguez-Piza, I., Guenechea, G., Vassena, R. Monobenzone -1.7289 Cromolyn disodium salt -1.7273 Navarro, S., Barrero, M. J., Consiglio, A., Castella, M., 60 Beta-Escin -1.7261 Río, P. Sleep, E., et al. (2009). Disease-corrected haemato Tocopherol (RS) -1.721 poietic progenitors from Fanconi anaemia induced pluri Nadolol -1.72O1 Nisoxetine hydrochloride -1699 potent stem cells. Nature 460, 53-59. Nimodipine -16971 Rhee, E.P., Souza, A., Farrell, L., Pollak, M.R., Lewis, G. D., Spiperone -16819 Steele, D. J., Thadhani, R., Clish, C. B., Greka, A., and 65 Chenodiol -1.6767 Gerszten, R. E. (2010). Metabolite profiling identifies Clotrimazole -16708 markers of uremia. J. Am. Soc. Nephrol. 21, 1041-1051. US 9,393,221 B2 57 58 TABLE 1-continued TABLE 1-continued Rank Order of compounds according to their z-score Rank Order of compounds according to their z-score Compound Name Z-score 5 Compound Name Z-score Dioxybenzone -16584 Memantine Hydrochloride -1.2487 Tracazolate hydrochloride -16368 Fosfosal -12351 Fluspirilen -16301 Fluvoxamine maleate -12293 Sertraline hydrochloride -16299 Skimmianine -1.2252 Cefoxitin sodium salt -1.629 Thiethylperazine malate -1.2229 L(-)-vesamicol hydrochloride -1.6146 10 Adenosine 5'-monophosphate monohydrate -1.2202 Cinnarizine -1.6064 Iodixanol -12199 Fenofibrate -16051 (-)-Cinchonidine -12185 Cyproheptadine hydrochloride -1.6O13 Antazoline hydrochloride -1.2181 Benzthiazide -1594 Picotamide monohydrate -1.2123 Tetrahydroxy-14-quinone monohydrate -1588S Trichlorimethiazide -1.2081 ocetamic acid -15742 15 Meclofenamic acid sodium salt monohydrate -1.2044 Novobiocin sodium salt -1.5591 Trifusal -1.2041 Nilutamide -1.SS82 Trolox -1.1986 Ebselen -1.5273 Pivampicillin -1.1929 Perphenazine -15218 Tetrandrine -1.1905 Clioquinol -1.5.195 Tamoxifen citrate -1.1882 Trigonelline -1518 Proadifen hydrochloride -1.1876 Ribavirin -15081 2O Diethylcarbamazine citrate -1.1872 Labetalol hydrochloride -1.5O17 Chrysene-1,4-quinone -11808 Pantothenic acid calcium salt monohydrate -15008 Haloperidol -1.1776 Acenocoumarol -1.4804 Biperiden hydrochloride -1.1752 dazoxan hydrochloride -1.447 Methylprednisolone, 6-alpha -1.1745 Ethynodiol diacetate -1.4458 Harpagoside -1.174 Mevalonic-D, L. acid lactone -14333 25 Oxybenzone -1.1732 Ricinine -14299 Triamcinolone -11722 Dyclonine hydrochloride -14276 Cinchonine -11697 Promethazine hydrochloride -1.4251 Fluorocurarine chloride -1.1648 fosfamide -1.424 AZlocillin Sodium salt -1.1617 Indoprofen -1.4204 Sotretinoin -1.1597 Trimeprazine tartrate -1.418 30 Pentoxifylline -1.1547 Karakoline -14178 Meglumine -11536 Pipemidic acid -1.4165 Disopyramide -1.1535 Betulin -1.4148 Dizocilpine maleate -1.1SOS Delcorine -1.4115 Methylatropine nitrate -1.1494 Cyclopenthiazide -14107 Cephalexin monohydrate -1.1486 S-(+)-ibuprofen -14076 35 Famotidine -1.1457 (cis-) Nanophine -1.4074 Hippeastrine hydrobromide -1.1441 Gabexate mesilate -1.4041 Methocarbamol -1.1429 Sulfinpyrazone -1.4O16 Diclofenac sodium -1137 Flurbiprofen -1.4 Apramycin -1.1349 Bumetanide -13983 Aminohippuric acid -1.1341 Ampicillin trihydrate -13793 Nitrocaramiphen hydrochloride -1.1255 Cyclosporin A -1.3785 * Thioridazine hydrochloride -1.1212 THIP Hydrochloride -1.3776 Ungerine nitrate -1.1174 Piribedill hydrochloride -13522 Oxyphenbutazone -1.1165 Mianserine hydrochloride -1.3517 Cefsulodin sodium salt -1.1155 Oxalamine citrate salt -1.3452 Benfluorex hydrochloride -11069 Reserpinic acid hydrochloride -1.3417 ohexol -1.1016 Lymecycline -13365 45 Nalbuphine hydrochloride -10996 Hesperetin -13358 Oxybutynin chloride -10993 Delsoline -13301 Pirenzepine dihydrochloride -1.096 Suxibuzone -13282 Rilmenidine hemifumarate -10936 Cyanocobalamin -13236 Levopropoxyphene napSylate -1.0896 Ciprofloxacin hydrochloride -1.3212 Benzamil hydrochloride -1.083 Lynestrenol -1.3181 50 Convolamine hydrochloride -1.0829 Sulfamonomethoxine -13171 Metoclopramide monohydrochloride -1.0824 Nomifensine maleate -1.3149 doxuridine -1.0734 Dexamethasone acetate -13076 Bacitracin -10707 Acetylsalicylsalicylic acid -13067 Ticlopidine hydrochloride -10702 Triamterene -1.3O39 Proscillaridin A -10698 Pyrilamine maleate -13015 55 Eburnamonine (-) -10688 Pizotifen malate -12994 Equilin -10652 Danazol -12973 Triprolidine hydrochloride -1.0644 Deltaline -12966 Meptazinol hydrochloride -10631 Urapidil hydrochloride -12828 Spiramycin -1.0612 Heliotrine -1.2812 Pipenzolate bromide -1.06 Esculin Hydrate -12808 Xylazine -1.0585 Nortriptyline hydrochloride -1.28 Stilfasalazine -1.0569 Corticosterone -12709 Aminophylline -1.OSS2 Carbenoxolone disodium salt -1.2656 Fluoxetine hydrochloride -1.OS33 Prilocaine hydrochloride -1.2624 Digoxigenin -10521 Dimaprit dihydrochloride -1.2574 S(-)-terguride hydrogen maleate -10498 Soconazole -1.2562 Oxolinic acid -10488 Cyproterone acetate -1.2528 65 (+,-)-Synephrine -1.0448 N-Acetyl-L-leucine -12512 Etifenin -10427 US 9,393,221 B2 59 60 TABLE 1-continued TABLE 1-continued Rank Order of compounds according to their z-score Rank Order of compounds according to their z-score Compound Name Z-score Compound Name Z-score Tolmetin sodium salt dihydrate -10425 Prednisolone -08986 Metanephrine hydrochloride DL -1.0419 Trimethadione -0.8958 Yohimbine hydrochloride -1.0356 Flucytosine -08908 Hexestrol -10339 alpha-Santonin -08908 D-cycloserine -10332 Terfenadine -O.8896 Pyrazinamide -1.0312 10 Beta-sistosterol -O.8867 Lanatoside C -10291 Chlorambucil -O.8818 Clemastine fumarate -10269 Dextromethorphan hydrobromide monohydrate -0.8776 Thalidomide -1.026 Cefazolin sodium salt -O.8698 Roxithromycin -1.026 Serotonin hydrochloride -O.8664 Adrenosterone -1025 Nitrofural -O.866 Graveoline -1.0242 Quercetine dihydrate -08659 Tiapride hydrochloride -101.78 15 Clorgyline hydrochloride -O-8658 Azacyclonol -10159 Flumequine -0.8648 FluticaSone propionate -1.O154 Nitrarine dihydrochloride -0.8582 Nimesulide -1.0153 Railoxifene hydrochloride -O-8574 Flumixin meglumine -1.0122 Levamisole hydrochloride -O.8539 Doxazosin meSylate -1.01.21 Cefnetazole sodium salt -O.8537 GBR 12909 dihydrochloride -1.0102 Econazole nitrate -0.8488 Cloxacillin Sodium salt -1.01.01 3-Acetylcoumarin -O.8473 Luteolin -10098 Naphazoline hydrochloride -0.8458 Doxepin hydrochloride -10091 Cefotiam hydrochloride -0.8453 Oxaprozin -1009 Etofylline -O.84O6 Phthalylsulfathiazole -10074 Calycanthine -O.8381 Dehydrocholic acid -1.006 25 Ketorolac tromethamine -O.8373 Salbutamol -O.9959 Cefalonium -O.8363 Flecainide acetate -O.9948 Carbimazole -O.836 Ganciclovir -O.99.45 Epiandrosterone -0.835 Clopamide -O.99.45 Cefotaxime sodium salt -O.8289 Ethionamide -O.9932 Niacin -O.8285 Bucladesine sodium salt -O.9927 30 Tolfenamic acid -0.8256 Fludrocortisone acetate -O.9911 Homochlorcyclizine dihydrochloride -O.8178 Propantheline bromide -O.98.62 Amoxapine -O.8161. Chlorprothixene hydrochloride -O.9824 Digoxin -O.815 Diloxanide furoate -O.9785 Flufenamic acid -0.8139 Catechin-(+,-) hydrate -0.9777 Metixene hydrochloride -0.8136 Fusaric acid -O.977 35 Tolbutamide -O.8086 Diethylstilbestrol -O.977 Pempidine tartrate -08069 Fipexide hydrochloride -O.9747 Methacholine chloride -0.8044 Diltiazem hydrochloride -O.974 Hydrocotarnine hydrobromide -O.8038 Clomipramine hydrochloride -O.9732 Benfotiamine -O.7979 Avermectin B1 -O.9704 beta-Belladonnine dichloroethylate -O.7978 Methylhydantoin-5-(L) -O.97 Benzylpenicillin Sodium -O.794 Conessine -O.969 40 Galanthamine hydrobromide -O.7931 Propofol -O.9649 Lisuride (S)(-) -O.7927 Pentolinium bitaritrate -O.9629 Soetharine mesylate salt -O.7902 Meprylcaine hydrochloride -0.9597 Norethynodrel -O.7872 Trimethoprim -0.9568 indomethacin -0.7862 Tiratricol, 3,3',5-triiodothyroacetic acid -0.9554 Rolipram -0.7794 Estradiol-17 beta -0.9541 45 Anabasine -0.7781 Felbinac -0.9529 Dimenhydrinate -0.7776 Alverine citrate salt -0.9516 Vigabatrin -0.7771 Oxethazaine -0.9515 opanoic acid -0.7767 Talampicillin hydrochloride -0.9508 Bromocryptine mesylate -0.775 Gliquidone -O.94.95 Homosalate -0.7744 Dimethadione -O.94.93 50 Sulfamethizole -0.7734 Ambroxol hydrochloride -O.9433 Hymecromone -0.7731 LidocaOne hydrochloride -O.9429 SR-95639A -0.7703 Prednicarbate -O.94.08 Socorydine (+) -0.7668 Mephenesin -O.94O1 Soxicam -0.7646 Ajmaline -O.937 Mometasome furoate -0.7613 Ethynylestradiol 3-methyl ether -O.93 55 Moxalactam disodium salt -0.7608 Esculetin -O.9295 Zimelidine dihydrochloride monohydrate -0.7577 Butacaine -O.9284 Suprofen -O.7SO1 Digitoxigenin -O.9264 Pimozide -0.7483 Cyclizine hydrochloride -O.9231 Metolazone -0.7452 Naftopidil dihydrochloride -O.9212 Fenoterol hydrobromide -0.7445 Paroxetine Hydrochloride -O.91.82 Imipenem -07436 Alprostadil -O.9154 60 Folinic acid calcium salt -0.7409 Piperacillin sodium salt -0.9149 Enoxacin -0.7386 Tetrahydrozoline hydrochloride -O.9102 Aminopurine, 6-benzyl -0.7385 Hydroxyzine dihydrochloride -0.9071 Tomatidine -0.7378 Metaraminol bittartrate -O.9024 Pargyline hydrochloride -O.73S Acemetacin -O.90OS Foliosidine -0.7349 Pronethalol hydrochloride -O.90O2 65 S(-)Eticlopride hydrochloride -O.7335 Ajmalicine hydrochloride -O.8989 Ethotoin -0.7327 US 9,393,221 B2 61 62 TABLE 1-continued TABLE 1-continued Rank Order of compounds according to their z-score Rank Order of compounds according to their z-score Compound Name Z-score 5 Compound Name Z-score Proxyphylline -0.7317 Cefaclor -0.5619 Diphenidol hydrochloride -0.7294 Clofazimine -0.5584 Bergenin monohydrate -0.7293 Bicuculline (+) -O.SSS6 (+)-Isoproterenol (+)-bitartrate salt -0.728 Hydrastinine hydrochloride -0.5549 Astemizole -O.7215 Mesoridazine besylate -O.SS25 Tribenoside -0.7171 1O Laudanosine (RS) -0.5493 Rauwolscine hydrochloride -0.7161 Chlortetracycline hydrochloride -O.S479 Chrysin -0.7142 Flutamide -0.5472 Halcinonide -0.7085 Bephenium hydroxynaphthoate -0.5444 Dydrogesterone -0.7044 Aceclofenac -0.5442 Retinoic acid -0.7042 Lobeline alpha (-) hydrochoride -0.5438 Sisomicin sulfate -0.7041 15 Troleandomycin -0.5429 Methantheline bromide -0.7033 Cefadroxi -0.5419 Dihydroergotamine tartrate -0.7032 Chlorpromazine hydrochloride -0.5417 Epirizole -0.7031 Oxaglic acid -0.54 Loxapine Succinate -0.6976 Chlorpheniramine maleate -O.S399 Dehydroisoandosterone 3-acetate -0.697 Solasodine -0.5386 Zardaverine -0.6963 Flupentixol dihydrochloride cis-(Z) -O.S309 Fursultiamine Hydrochloride -0.696 20 N6-methyladenosine -O.S287 Asiaticoside -0.6936 Hydroxytacrine maleate (RS) -O.S25 Ondansetron Hydrochloride -0.6933 Rifampicin -O.S227 Amyleine hydrochloride -0.692 Procaine hydrochloride -O.S215 Amiprilose hydrochloride -0.6893 Praziquantel -O.S159 Moxonidine -0.6893 Lactobionic acid -0.5092 Carteolol hydrochloride -0.6876 25 Kawain -OSO48 OZagrel hydrochloride -0.6787 Colistin sulfate -OSO41 Nabumetone -0.6754 Securinine -OSO36 Indapamide -0.6747 Tenoxicam -0.5O16 Nystatine -0.6743 Midodrine hydrochloride -OSOO1 Norethindrone -0.6688 QuinethaZone -0.4993 Sulconazole nitrate -0.6576 3O Prenylamine lactate -0.492 Chlorotrianisene -0.6534 Piperidolate hydrochloride -0.4895 Chlormezanone -0.6525 Pimethixene maleate -0.4872 Acetaminophen -0.6512 Nalidixic acid sodium salt hydrate -0.4868 AZapropaZone -0.6493 Zaprinast -0.4842 Propafenone hydrochloride -0.6438 Vincamine -0.4826 Niflumic acid -0.6436 35 Piperacetazine -O.4798 Bromperidol -0.6428 (-)-Eseroline fumarate salt -0.478 Alfaxalone -0.6412 Harmane hydrochloride -O.4768 Boldine -0.6389 Ribostamycin sulfate salt -O.4737 Benserazide hydrochloride -0.638 Dobutamine hydrochloride -O.4732 Naftifine hydrochloride -0.6354 Moxisylyte hydrochoride -O.4722 Mifepristone -0.6348 Lansoprazole -0.4696 Glycocholic acid -0.6342 Gelsemine -0.4693 Lobelanidine hydrochloride -0.6.306 Fenoprofen calcium salt dihydrate -04668 Ethambutol dihydrochloride -0.63O3 Guanadrel sulfate -0.4661 Tiaprofenic acid -0.6.271 Sertaconazole nitrate -0.4658 Penbutolol sulfate -0.6.27 Remoxipride Hydrochloride -0.4559 Methylhydantoin-5-(D) -0.6204 Alfadolone acetate -0.4554 Pirlindole mesylate -0.619 45 Furaltadone hydrochloride -0.4516 Glycopyrrolate -0.6161 (R)-Propranolol hydrochloride -0.4494 Thioperamide maleate -0.6114 Vidarabine -0.443 Naltrexone hydrochloride dihydrate -0.609 (S)-(-)-Cycloserine -0.4402 Procyclidine hydrochloride -0.6O71 Metoprolol-(+,-) (+)-tartrate salt -0.4304 Diperodon hydrochloride -0.6048 Brinzolamide -0.419 Norcyclobenzaprine -0.6O46 50 Rimexolone -0.4134 Demecarium bromide -0.6009 proniazide phosphate -0.4106 Hexamethonium dibromide dihydrate -0.5997 Butoconazole nitrate -0.4077 Droperidol -0.5996 Zidovudine, AZT -0.4063 Ciprofibrate -0.5993 Sulfamethoxazole -0.4061 TetracaCone hydrochloride -0.5979 Dapsone -0.4061 osamycin -0.5964 55 Thioproperazine dimeSylate -0.4051 Roxarsone -0.5936 Glafenine hydrochloride -0.4014 Acetopromazine maleate salt -0.5926 Tinidazole -0.3977 Vancomycin hydrochloride -0.5906 Diflunisal -0.3972 2-Chloropyrazine -0.5863 Atractyloside potassium salt -0.3937 Omeprazole -0.5848 Naloxone hydrochloride -0.3899 Clindamycin hydrochloride -0.5846 Fenbufen -0.3877 Austricine -0.5795 9. Bethanechol chloride -0.3853 Harmaline hydrochloride dihydrate -0.5714 Metaproterenol sulfate, orciprenaline sulfate -0.3842 Cefamandole sodium salt -0.5703 Lysergol -03809 Clemizole hydrochloride -O.S701 Terconazole -0.3786 Canavanine Sulfate monohydrate (L+) -0.5687 Diprophylline -0.3767 (-)-Levobunolol hydrochloride -O.S665 Cetirizine dihydrochloride -0.3764 Ethamivan -O.S6S 65 Tiabendazole -O.3752 Ranitidine hydrochloride -0.5642 Naproxen -0.3678 US 9,393,221 B2 63 64 TABLE 1-continued TABLE 1-continued Rank Order of compounds according to their z-score Rank Order of compounds according to their z-score Compound Name Z-score 5 Compound Name Z-score Guanabenz acetate -O.3SS1 Medrysone -0.1611 Bemegride -0.3526 Clorsulon -0.1576 Sparteine (-) -0.3524 Levonordefrin -0.1 SSS Rolitetracycline -0.3523 Ursolic acid -0.1541 Benzbromarone -0.349 Khellin -0.1533 Benzydamine hydrochloride -0.3467 10 Moricizine hydrochloride -0.1525 Practolol -O.3373 Sulfameter -0.15O1 Dantrollene Sodium salt -0.3347 Nafcillin sodium salt monohydrate -0.1498 Evoxine -0.3336 Ticarcillin sodium -0.1446 Pergolide mesylate -0.3289 Cyclobenzaprine hydrochloride -0.1421 Hydrastine hydrochloride -O.3277 Gabazine -0.1416 odipamide -0.3225 15 Xamoterol hemifumarate -0.1402 Chlorthalidone -0.3195 Furazolidone -0.1396 Sulfacetamide sodic hydrate -O.3059 Trimipramine maleate salt -0.138 Propoxycaine hydrochloride -O.3049 Nizatioline -01369 Orphenadrine hydrochloride -O.3046 Etidronic acid, disodium salt -0.1368 Ethacrynic acid -0.3O2 Protriptyline hydrochloride -0.1298 Dacarbazine -0.3O16 Spectinomycin dihydrochloride -0.1287 Ampyrone –0.2996 20 Trapidil -0.1226 Heptaminol hydrochloride -O.2987 Sulfadoxine -0.1202 Glipizide -O.2981 Quilpazine dimaleate salt -0.1189 Tropine -O.2952 Mepenzolate bromide -0.115 Sopropamide iodide -O.2928 Helveticoside -0.1112 Menadione -0.29 Clebopride maleate -0.108 Sulfaphenazole -O.2854 25 Ipratropium bromide -0.1032 Millrinone -O.2851 Ginkgolide A -0.1024 Methionine Sulfoximine (L) -0.2829 Sulfamerazine -O.O984 Pilocarpine nitrate -O.2819 Deptropine citrate -O.O889 Ergocryptine-alpha -O.2816 Decamethonium bromide -O.O864 Beclomethasone dipropionate -O.2791 Propylthiouracil -O.O857 Phenformin hydrochloride -0.2777 3O Phenethicillin potassium salt -O.O851 Canrenoic acid potassium salt -O.274 Buspirone hydrochloride -O.O845 obenguane Sulfate -O.2715 Reserpine -O.O83 Benperidol -O.2696 Guanfacine hydrochloride -O.O783 Captopri -O.2654 Harmol hydrochloride monohydrate -O.O757 Gemfibrozil -O.2634 Terazosin hydrochloride -O.O723 R(-) Apomorphine hydrochloride hemihydrate -0.2622 35 Panthenol (D) -O.O69 Tetracycline hydrochloride -O.2579 Risperidone -O.OS33 Bezafibrate -O.2571 Sulfisoxazole -O.O512 Ethisterone -O.2541 Ethoxyquin -O.O471 Corynanthine hydrochloride -0.2498 Meticrane -O.O455 Phenazopyridine hydrochloride -0.2483 Drofenine hydrochloride -O.O455 Gabapentin -0.2478 Buflomedil hydrochloride -O.O451 Leucomisine -0.2458 * Flurandrenolide -O.O4O2 Mefenamic acid -0.24O7 Kaempferol -O.O374 Verteporfin -O-2331 Nefopam hydrochloride -O.O3O8 Procainamide hydrochloride -0.2319 Yohimbinic acid monohydrate -O.O239 Tranylcypromine hydrochloride -0.2314 Sulfamethoxypyridazine -O.O234 Azathymine, 6 -O-2304 Miconazole -O.O18 Repaglinide -O.2231 45 Paromomycin Sulfate -O.O138 Apigenin -O.2208 Acyclovir -O.OO91 Ketoprofen -O.219 Vitexin -O.OO89 Pivmecillinam hydrochloride -O.219 Primidone -O.OO45 Sulpiride -O.218.7 Enilconazole -0.0014 Hydrocortisone base -0.2176 Lomefloxacin hydrochloride O.OO477 Mefexamide hydrochloride -O.21.69 50 Parthenolide O.OO611 Cimetidine -0.2141 Ceftazidime pentahydrate O.OO611 Antipyrine -O.2127 DoSulepin hydrochloride O.OO689 Neomycin sulfate -O.2127 Streptozotocin O.OO88 (-)-MK 801 hydrogen maleate -0.2074 Promazine hydrochloride O.O1386 Oxprenolol hydrochloride -0.2057 Bupivacaine hydrochloride O.O187 Chlorothiazide -O.1987 55 Tridihexethyl chloride O.O1977 Denatonium benzoate -O.1971 Cisapride O.O2O62 Amoxicillin -O.1957 Orosiol O.0218.7 Pyrantel tartrate -O.1933 Methyldopa (L.-) O.O2395 Dicloxacillin sodium salt -0.1893 Methylergometrine maleate O.O2492 Betamethasone -0.1891 Phensuximide O.O2844 3-alpha-Hydroxy-5-beta-androstan-17-one -0.187 Citalopram Hydrobromide O.O3052 Methapyrilene hydrochloride -01861 60 Sopyrin hydrochloride O.O325 Loperamide hydrochloride -0.1814 Bisoprolol fumarate O.O3425 (+)-Levobunolol hydrochloride -0.1813 Pindolol O.O3656 Mesalamine -0.1803 Maprotiline hydrochloride O.O3741 Picrotoxinin -0.1703 Trazodone hydrochloride O.O3974 Betazole hydrochloride -0.1702 Clonidine hydrochloride O.O4408 Flumethasone -0.1671 65 Triflupromazine hydrochloride O.04449 Levodopa -0.1655 Ethamsylate O.O4738 US 9,393,221 B2 65 66 TABLE 1-continued TABLE 1-continued Rank Order of compounds according to their z-score Rank Order of compounds according to their z-score Compound Name Z-score 5 Compound Name Z-score Mephentermine hemisulfate O.O4889 Tolnaftate O.24408 Moroxidine hydrochloride 0.05075 Diphenylpyraline hydrochloride O.24596 Prednisone O.OS393 opromide O.24811 Tranexamic acid O.OS824 Nifurtimox O.24846 Natamycin O.O6039 Piretanide O.2S211 Benzonatate O.O6563 1O Imidurea O.2S671 Minoxidi O.06676 Calciferol O.25816 3-Acetamidocoumarin O.O6786 Piromidic acid O.26041 Methazolamide O.O6841 Phenylpropanolamine hydrochloride O.26251 Estriol O.O6999 Gentamicine sulfate O.26288 Doxylamine Succinate 0.07172 Myosmine O.26499 Baclofen (R.S.) O.O7861 15 Phenindione O.26543 Methiothepin maleate O.O8061 Trichlorfon O.26SS Melatonin O.O8162 Pancuronium bromide O.27081 oversol O.08392 Griseofulvin 0.27278 Retrorsine O.O8676 Sradipine 0.273.71 Theobromine O.O9359 Althiazide O.281S6 Bacampicillin hydrochloride O.O9702 Fenspiride hydrochloride O.28266 Sulfadiazine O.O9783 2O Glutethimide, para-amino 0.28575 Biotin O.1016 Carbamazepine O.28917 Glimepiride O. 10429 Butamben O.29028 Mebeverine hydrochloride O.1096S Merbromin O.29325 Nifenazone O. 11312 Sulfanilamide 0.29595 Amiodarone hydrochloride O.11386 SOXSuprine hydrochloride O.301.38 Epivincamine O. 11611 25 Carbarsone O.30387 Riboflavine O.1165 Harmine hydrochloride O.30855 Oxymetazoline hydrochloride O.11989 Glibenclamide O.31123 Sulfathiazole O.12264 Condelphine O.31433 Betonicine O.12346 Pheniramine maleate O.31528 Proglumide O.12348 Pinacidil O.31625 Chloropyramine hydrochloride O.124 30 Cephalosporanic acid, 7-amino O.32239 Dienestrol O.12678 Arcaine Sulfate O.32368 Fluorometholone O.1317 Phentolamine hydrochloride O.32447 Tetramisole hydrochloride O.13328 Tolazoline hydrochloride 0.32559 Arecoline hydrobromide 0.13727 Amodiaquin dihydrochloride dihydrate O.33145 Nadide O.13852 Capsaicin O.33827 Etilefrine hydrochloride O.13978 35 Amidopyrine O.34699 Quinacrine dihydrochloride dihydrate O.141 Syrosingopine O.351.93 Zoxazolamine O.14233 Flavoxate hydrochloride O.35347 Guaifenesin O.14397 Alcuronium chloride O.35398 Chlorogenic acid O.14857 Tremorine dihydrochloride O.35834 Torsemide O.15409 Acetohexamide 0.35837 Kynurenine, 3-hydroxy (RS) O.15671 Ascorbic acid O.35986 Dichlorphenamide O.16242 Nitrofurantoin O.36312 Enalapril maleate O.16449 (S)-propranolol hydrochloride O.368O1 Aztreonam O.17282 Ritodrine hydrochloride O.37869 N-Acetyl-DL-homocysteine Thiolactone 0.17718 Fluocinonide O.38463 Arbutin O.18061 Harmalol hydrochloride dihydrate O.38884 Hydroflumethiazide O.18552 Sulfadimethoxine O.40771 Bambuterol hydrochloride O.18583 45 Sulmazole O.4O971 Pseudopelletierine hydrochloride O.19111 Betulinic acid O.411.89 Liothyronine O.19538 Trimethylcolchicinic acid O41268 Thyroxine (L) 0.19553 Clozapine O4154 Dilazep dihydrochloride O.19669 Acacetin O4211 (-)-Adenosine 3',5'-cyclic monophosphate O.1984 Methoxamine hydrochloride O42389 Chlorpropamide O.19899 50 Dipyridamole O42819 Phenoxybenzamine hydrochloride O.2O314 Minaprine dihydrochloride O.42897 Adamantamine fumarate O.2O847 Fluphenazine dihydrochloride O.4.317 Butirosin disulfate salt O.21213 Benoximate hydrochloride O43982 Desipramine hydrochloride O.21679 Verapamyl hydrochloride O44356 Carbinoxamine maleate Salt O.21805 Salmeterol O.45O2S 6-Furfurylaminopurine O.21921 55 Edrophonium chloride O.4533 Flunarizine dihydrochloride O.22066 Alfuzosin hydrochloride O.45337 Debrisoquin sulfate 0.22275 Acebutolol hydrochloride 0.45776 Funisolide O.22409 Chlorphensin carbamate O.45833 Stachydrine hydrochloride O.22476 Timolol maleate salt O.45917 Telenzepine dihydrochloride 0.22572 Dimethisoquin hydrochloride O-46311 Etomidate 0.22737 Cholecalciferol O.47012 Dibucaine O.22741 60 Isoquinoline, 6,7-dimethoxy-1-methyl-1,2,3,4-tetrahydro, 0.47558 Sotalol hydrochloride O.2363 hydrochloride Benzathine benzylpenicillin O.238O1 Bisacodyl O.47699 Dubinidine O.23846 CefoperaZone dihydrate O48465 Clenbuterol hydrochloride O.2390S Meclofenoxate hydrochloride O.494.45 Gliclazide O.24038 Mebhydroline 1,5-naphtalenedisulfonate O49991 (1-(4-Chlorophenyl)phenyl-methyl-4-methylpiperazine) O.241 65 Phenacetin O.49998 Nicergoline O.24329 Pyrithyldione OSO424 US 9,393,221 B2 67 68 TABLE 1-continued TABLE 1-continued Rank Order of compounds according to their z-score Rank Order of compounds according to their z-score Compound Name Z-score 5 Compound Name Z-score Methyldopate hydrochloride O.SOS4 Lithocholic acid O.80216 Oleandomycin phosphate O.S.0691 Piracetam O.8O376 Furosemide O.SO742 Gibberellic acid O.8O894 Tropicamide O.S.0832 Cefuroxime sodium salt 0.81772 Isosorbide dinitrate O.S.0835 ChlorZoxazone O.82S22 Racecadotril O.S1604 10 Allantoin O.82S59 Pramoxine hydrochloride O.S1947 Chloroquine diphosphate O.83011 Antipyrine, 4-hydroxy O.S1999 Amprolium hydrochloride O.83287 Amphotericin B O.S223 Articaine hydrochloride O.836O4 Flucloxacillin Sodium O.S2413 Ifenprodil tartrate O.83989 Sulfapyridine O.S2561 Mafenide hydrochloride O.84681 Trifluoperazine dihydrochloride O.S386 15 Cephalothin Sodium salt O.85664 6-Hydroxytropinone O.S4003 Gallamine triethiodide O.864.36 Lisinopril O.S.4031 Salsolinol hydrobromide 0.87725 Metergoline O.S4738 Acetazolamide 0.87732 Midecamycin O.SS145 Zomepirac sodium salt O.87942 Carisoprodol 0.55907 Mephenytoin O.88643 Altretamine O.S6O1 NoScapine O.89477 Ketotifen fumarate O.S681.1 2 Tubocurarine chloride pentahydrate (+) O.89614 Sulfaquinoxaline sodium salt 0.579 Conessine O.89622 Meropenem O.S8062 Eserine Sulfate, physostigmine Sulfate O.89896 Diazoxide O.S969S Mimosine 0.90752 Scopoletin O.6O268 Pentetic acid 0.90771 Tocainide hydrochloride O.60385 Eucatropine hydrochloride O.91.331 Diphemanil methylsulfate O.6O45 25 Dihydroergocristine mesylate O.91569 Vitamin K2 O.61285 Hecogenin O.92O76 Sometheptene mucate 0.61974 Alprenolol hydrochloride O.92386 Atovaquone O.629O1 Epicatechin-(-) O.92S13 Metampicillin sodium salt O.63804 Proparacaine hydrochloride 0.93675 Dropropizine (RS) O.63963 AlclometaSone dipropionate 0.93751 Cotinine (-) 0.64395 30 Ivermectin O.94.188 Loracarbef 0.64573 Isoniazid O.94728 Deoxycorticosterone O.65231 Bromopride O.94.863 Nafronyl oxalate O.65457 Tyloxapol 0.95711 Riluzole hydrochloride O.65742 Trimetazidine dihydrochloride O.96S43 Lumicolchicine gamma 0.65958 Spaglumic acid O.96658 Prazosin hydrochloride 0.65967 35 Scopolamine hydrochloride O.96721 Pentylenetetrazole 0.66528 (+,-)-Octopamine hydrochloride O.97366 Homatropine hydrobromide (RS) 0.66534 (R)-(+)-Atenolol O.9856 (+)-Nipecotic acid 0.66549 Fusicic acid sodium salt O.99728 Norfloxacin O.66664 Scopolamin-N-oxide hydrobromide 0.99975 Phenelzine sulfate 0.66718 Morantel tartrate OO459 Etanidazole O.66812 Saquinavir meSylate O2698 Letrozole 0.66925 Cytisine (-) O4863 Strophanthidin O.67316 Sulfaguanidine OSO18 BufeXamac 0.67799 Mexiletine hydrochloride OS417 Amitryptiline hydrochloride O.67811 Trimethobenzamide hydrochloride O6OOS Nialamide 0.67945 Dipyrone O6107 Carcinine O.68382 Netilmicin sulfate O6215 Diflorasone Diacetate O.68417 45 Finasteride O6736 Hexylcaine hydrochloride O.68.701 Ethosuximide O7586 Famprofazone O.69114 Pregnenolone O7634 Methimazole O.69343 Levocabastine hydrochloride O7813 Chicago sky blue 6B O.69581 Rescinnamin O9684 Lincomycin hydrochloride O.69604 Quinic acid O976 Theophylline monohydrate O.7OOO8 50 Clomiphene citrate (ZE) 10749 Metronidazole O.71596 opamidol 10767 Bupropion hydrochloride O.71934 Muramic acid, N-acetyl 12835 Piroxicam 0.72535 Erythromycin 13118 Carbachol O.73838 Sulfachloropyridazine .13444 Testosterone propionate O.74885 Succinylsulfathiazole 13893 Probenecid 0.75398 55 Benzocaine 14853 Aspartic acid, N-acetyl (R.S.) 0.75587 Androsterone 15571 Dinoprost trometamol O.76121 Cefepime hydrochloride 17243 Fillalbin O.76212 Hydrochlorothiazide 18029 Ofloxacin O.76233 Atracurium besylate 18219 Cloperastine hydrochloride O.76609 Atropine Sulfate monohydrate 18251 Metformin hydrochloride O.76638 Oxytetracycline dihydrate 18459 Xylometazoline hydrochloride O.76862 60 Ramipril 1884.4 (S)-(-)-Atenolol O.77869 Methoxy-6-harmalan 2O104 Ornidazole O.78241 Hyoscyamine (L) 2O3S4 Aconitine 0.79071 Clocortolone pivalate 21739 Aminocaproic acid O.80001 Dihydroergotoxine meSylate 21744 Cinoxacin O.80O88 Ketoconazole 22425 Adiphenine hydrochloride O.80097 65 Hydroquinine hydrobromide hydrate 2243 Guanethidine sulfate O.80139 Meclozine dihydrochloride 22725 US 9,393,221 B2 69 70 TABLE 1-continued TABLE 1-continued Rank Order of compounds according to their z-score Rank Order of compounds according to their z-score Compound Name Z-score 5 Compound Name Z-score Thiorphan 24.462 Bendroflumethiazide 2.29669 Cyclopentolate hydrochloride 251.84 Clofibric acid 2.29712 Dihydrostreptomycin sulfate 2S288 Methacycline hydrochloride 2.3O871 Folic acid 25318 Zalcitabine 2.32288 Ketanserin tartrate hydrate 2SS64 Progesterone 2.34418 Leflunomide 25767 10 Doxycycline hydrochloride 2.35563 Trihexyphenidyl-D.L. Hydrochloride 258O2 Cyclacillin 2.4O237 Pepstatin A 26143 Kanamycin A Sulfate 2.43561 Nifuroxazide 27857 Amikacin hydrate 2.44368 Pralidoxime chloride 281 Domperidone maleate 2.55153 Tiletamine hydrochloride 2858 Mecamylamine hydrochloride 2.56274 Diphenhydramine hydrochloride 3O809 15 Cefotetan 2.58.364 (-)-Quinpirole hydrochloride 31073 Naringin hydrate 2.67993 Chloramphenicol 31761 Thonzonium bromide 2.814 Naringenine 33643 Crotamiton 2.88584 Felodipine 33682 Hemicholinium bromide 2.90974 Trioxsalen 35921 Azaguanine-8 2.94.804 Megestrol acetate 36176 Pyrimethamine 2.95897 Dipivefrin hydrochloride 36.276 2O Strophantine octahydrate 3.18827 Pyridoxine hydrochloride 36599 (d.1)-Tetrahydroberberine 3.2577 Neostigmine bromide 38596 Propidium iodide 4O1365 Betaxolol hydrochloride 39325 (-)-Isoproterenol hydrochloride 4.26697 Hexetidine 39587 Artemisinin 4.8OO61 Norgestrel-(-)-D 41243 Primaquine diphosphate S.SO982 Streptomycin sulfate 41669 25 Minocycline hydrochloride 5.77623 Lidoflazine 41971 Quinidine hydrochloride monohydrate 6.79757 Oxantel pamoate 421.85 Palmatine chloride 6.90475 Sulfamethazine sodium salt 43.137 Lovastatin 6.93472 Niridazole 44644 Coralyne chloride hydrate 7.27498 Sulindac 45062 Methotrexate 7.69712 Nicardipine hydrochloride 45096 3O Benzethonium chloride 8.10467 mipramine hydrochloride 45873 Meclocycline sulfosalicylate 8.326OS Halofantrine hydrochloride 45911 Hydralazine hydrochloride 9.34227 Nifedipine 51575 Papaverine hydrochloride 9.541.98 Cefixime S2O68 LaSalocid sodium salt 9.898.18 Rifabutin 52087 Fluvastatin Sodium salt 9.99.343 Ronidazole 5256 35 Thiocolchicoside 15611 Amrinone S3481 Resveratrol 1669 Dirithromycin S3969 Methylbenzethonium chloride 2.63.56 AZaperone S4327 Berberine chloride 2.68 Methotrimeprazine maleat salt S4806 Deferoxamine mesylate 2.8786 Soflupredone acetate S4992 Clofilium tosylate 3.6063 Nomegestrol acetate 551.65 Thiostrepton 3.9158 Tolazamide SS441 Pentamidineisethionate 4.9126 Betahistine mesylate 55566 Simvastatin 5.173 Thiamine hydrochloride 57589 Disulfiram 5.5036 Carbetapentane citrate S8129 Amethopterin (RS) S. 6786 Dorzolamide hydrochloride 58737 Proguanil hydrochloride 6.0329 Piperine S8811 AZacytidine-5 6.1728 Gramine 61758 45 Fenbendazole 6.3822 Probucol 62604 Piperlongumine 6.6479 Etodolac 6287 Thiamphenicol 6.8903 Viomycin Sulfate 64O15 Chelidonine (+) 6.9912 Procarbazine hydrochloride 67535 Azathioprine 7.2224 Tobramycin 69428 Ethaverine hydrochloride 7.3528 Molsidomine 76131 50 Nocodazole 8.0445 Demeclocycline hydrochloride 78735 Monensin Sodium salt 8.1768 Prochlorperazine dimaleate 82O24 Thioguanosine 8.3737 Brompheniramine maleate 884.54 Cantharidin 8.98.62 Metrizamide 8943 Budesonide 9.1411 Protoveratrine A 894.99 Methiazole 9.8245 Bretylium tosylate 9055 55 Scoulerine 9.9884 Socarboxazid .9.1031 Hycanthone 20.1467 Ceforanide 92883 Trifluridine 21.7513 Methoxy-8-psoralen .94157 Lycorine hydrochloride 21.788S Amiloride hydrochloride dihydrate 95.465 Sulocticil 21.8147 Sulfabenzamide 9.5989 Camptothecine (S+) 21.8871 Dicumarol 96616 Chlorhexidine 24.4911 Pridinol methanesulfonate salt 96964 Niclosamide 25.4633 Propranolol hydrochloride 2.04985 Cephaeline dihydrochloride heptahydrate 26.5614 Clobetasol propionate 2.1955 Myricetin 27.33 (R)-Naproxen sodium salt 2.24257 Daunorubicin hydrochloride 28.7571 Hesperidin 2.25367 Anisomycin 30.3787 Molindone hydrochloride 2.262S2 Antimycin A 30.555 Terbutaline hemisulfate 2.27824 65 Sanguinarine 31.0936 Selegiline hydrochloride 2.27886 Florfenicol 31.4352 US 9,393,221 B2 71 72 TABLE 1-continued TABLE 2-continued Rank Order of compounds according to their z-score List of Glycolytic Switch Compounds Compound Name Z-score 5 Rank Compound Name Doxorubicin hydrochloride 32.6438 130 Tamoxifen citrate Emetine dihydrochloride 32.7653 133 Chrysene-1,4-quinone Colchicine 35.6417 135 Biperiden hydrochloride Mycophenolic acid 36.1922 197 Clemastine fumarate Ellipticine 36.711 208 GBR 12909 dihydrochloride Parbendazole 39.1106 10 223 Chlorprothixene hydrochloride Etoposide 39.4033 230 Clomipramine hydrochloride Ciclopirox ethanolamine 40.334 320 Homosalate Albendazole 41.6509 330 Pimozide Dequalinium dichloride 42.6725 372 Sulconazole nitrate Alexidine dihydrochloride 43.2376 383 Naftifine hydrochloride Mitoxantrone dihydrochloride 45.21.69 15 449 Piperidolate hydrochloride Podophyllotoxin 46.4771 464 Sertaconazole nitrate Pyrwinium pamoate 47.9867 517 Menadione Paclitaxel 48.9183 524 Phenformin hydrochloride Mebendazole 49.935 579 Cyclobenzaprine hydrochloride Cycloheximide 56.1385 644 Triflupromazine hydrochloride Puromycin dihydrochloride 744112 2O 658 Methiothepin maleate 702 Phenoxybenzamine hydrochloride 720 (1-(4-Chlorophenyl)phenyl-methyl-4- methylpiperazine) 743 Merbromin TABLE 2 764 Ascorbic acid 791 Bisacodyl List of Glycolytic Switch Compounds 25 814 Altretamine : 857 Testosterone propionate Rank Compound Name 863 Cloperastine hydrochloride 924 Pregnenolone 1 Fendiline hydrochloride 928 isiphene citrate (Z, E) 2 Vinpocetine s 3 Mefloquine hydrochloride 30 957 Nifuroxazide 4 Perhexiline maleate Rankin normalized ORO score from screen 8 Gossypol 23 Butylparaben 37 Clotrimazole SEQUENCES 40 Fruspirilen 4452 CinnarizineEbselen as Homo sapiens adipose triglyceride lipase (ATGL) mRNA, 61 Ethynodiol diacetate complete cds. 118 Thiethylperazine malate ACCESSION AY894.804 VERSIONAY8948.04.1 GI:58759.050

(SEQ ID NO; 1) atgttt CCCC gcgagaaga C gtggalacat C togttcgcgg gctg.cggctt cotcggcgt.c 61 tactacgt.cg gcgtggcct C Ctgcctic cqc gagcacgc.gc cctt CCtggit ggccaacgc.c 121 acgca catct acggcgc.ctic ggc.cgggggg ct cacggcca C9gcgctggit caccggggit c 181 to Ctgggtg aggctggtgc caagttcatt gaggitat cta aagaggc.ccg galagcggttc 241 ctgggcc ccc tdcaccc ct c cittcaacct g g taaagat.ca to cqcagttt cotgctgaag 3O1 gtc.ctgcctg. Ctgatagcca tagcatgcc agtgggcgcc tdggcatct C cctgaccc.gc 361 gtgtcagacg gcgagaatgt cattatat co cacttcaact coaaggacga got catc.ca.g 421 gocaatgtct gcagoggttt catc.ccc.gtg tactgtgggc ticatcc.cticc ct coct coag 481 ggggtgcgct acgtggatgg togcatttca gacaacctgc cactictatga gCttaagaac 541 accat cacag tdtcc cc citt citcggg.cgag agtgacatct gtc.cgcagga cagotccacc 6O1 alacat coacg agctg.cgggit caccalacacic agcatccagt to aacctg.cg caac ct citac 661 cc ct ct coa aggcc ct ctt Cocgc.cggag cc cctggtgc tigcgagagat gtgcaa.gcag 721 ggataccggg atggcctgcg Ctttctgcag cigaacggcc toctgaaccg gcc.caa.cccC 781 ttgctggcgt tocc ccc.gc cc.gc.ccc.cac gg.cccagagg acaaggacca ggcagtggag 841 agcgc.ccaag C9gaggatta Ctc.gcagctg. cc.gggagaag at cacgt.cct ggagcacctg 901 ccc.gc.ccggc ticaatgaggc cct gctggag gcctg.cgtgg agcc cacgga cctgctgacc

US 9,393,221 B2 75 76 - Continued atgcgc.gcac cc.gc.cgaccc ggct ccc.gcc ccc.gcggacc cagcatcCCC gcagcaccag 144 O Ctggc.cgggc Ctgcc.ccctt gctgagcacc cct gctic ccg aggc.ccggcc cqtgatcggg 15OO gCCCtggggc tigtga 1515

<210s, SEQ ID NO 2 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 2

Ctc.ccgagga gtcc.caggac at 22

<210s, SEQ ID NO 3 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 3 gatggtggtc. tctgaaca Cct 23

<210s, SEQ ID NO 4 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 4 gcggagtgga aactitttgtc. C 21

<210s, SEQ ID NO 5 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 5 cgggaagcgt gtactitat co tt 22

<210s, SEQ ID NO 6 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 6

Caagggtctg. Ctactgagat gctctg 26

<210s, SEQ ID NO 7 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer US 9,393,221 B2 77 78 - Continued

<4 OO > SEQUENCE: 7 ttttgtttgg gactgg taga agaat cag 28

<210s, SEQ ID NO 8 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 8 cagaggaggc Caacgtagaa g 21

<210s, SEQ ID NO 9 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 9 CtcCatcggg gat Cttgggit

<210s, SEQ ID NO 10 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 10 gacaaa.gc.cg agacggatgg

<210s, SEQ ID NO 11 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 11 ctgtc.gcttg cacttgtagc

<210s, SEQ ID NO 12 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 12 ctgtcatcto actatogggca

<210s, SEQ ID NO 13 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer US 9,393,221 B2 79 80 - Continued

<4 OOs, SEQUENCE: 13 cCaagt ccga gcagga attt

<210s, SEQ ID NO 14 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 14 c cctacgc.ca acatgaactic g 21

<210s, SEQ ID NO 15 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 15 gttctg.ccgg tagaaaggga

<210s, SEQ ID NO 16 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 16 aact ctggcg atgggtgttt a 21

<210s, SEQ ID NO 17 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 17 acactgatgt ctitt coactic ca 22

<210s, SEQ ID NO 18 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 18

CCCtgaagtic gaggagctg 19

<210s, SEQ ID NO 19 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 19 US 9,393,221 B2 81 82 - Continued ctgctgcacc tictaagcga 19

<210s, SEQ ID NO 2 O &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 2O actggcctac tacagagaag C 21

<210s, SEQ ID NO 21 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 21 gtagagtgcc gtc.ttgc.cat a 21

<210s, SEQ ID NO 22 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 22

Ctgc.cagt cc gaaaatggaa c 21

<210s, SEQ ID NO 23 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 23 citt catccac cqgggctato

<210s, SEQ ID NO 24 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 24 gccaagaa.gc ggatagaagg

<210s, SEQ ID NO 25 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 25 US 9,393,221 B2 83 84 - Continued

Ctgtggttca gggcticagtic

<210s, SEQ ID NO 26 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 26 gctggattac atggtc.ccala g 21

<210s, SEQ ID NO 27 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 27 ggcact tcag aaatcggaggg 21

<210s, SEQ ID NO 28 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 28 aggit cqgtgt gaacggattt g 21

<210s, SEQ ID NO 29 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 29 tgtagaccat gtagttgagg tda 23

<210s, SEQ ID NO 3 O &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 30 caacgc.cact cacatctacg g 21

<210s, SEQ ID NO 31 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 31 ggacacct ca ataatgttgg cac 23 US 9,393,221 B2 85 86 - Continued

<210s, SEQ ID NO 32 &211s LENGTH: 9 212. TYPE: PRT <213> ORGANISM: Human immunodeficiency virus 1

<4 OOs, SEQUENCE: 32 Arg Llys Lys Arg Arg Glin Arg Arg Arg 1. 5

<210s, SEQ ID NO 33 &211s LENGTH: 13 212. TYPE: PRT <213> ORGANISM: Human immunodeficiency virus 1 <4 OOs, SEQUENCE: 33 Gly Arg Llys Lys Arg Arg Glin Arg Arg Arg Thr Pro Glin 1. 5 1O

<210s, SEQ ID NO 34 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Human immunodeficiency virus 1 <4 OOs, SEQUENCE: 34 Tyr Gly Arg Llys Lys Arg Arg Glin Arg Arg Arg 1. 5 1O

<210s, SEQ ID NO 35 & 211 LENGTH 26 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 35

Ala Ala Wall Ala Lieu Lleu Pro Ala Wall Lieu. Lieu Ala Lieu. Lieu Ala Pro 1. 5 1O 15 Val Glin Arg Lys Arg Glin Llys Lieu Met Pro 2O 25

<210s, SEQ ID NO 36 &211s LENGTH: 17 212. TYPE: PRT <213> ORGANISM: Caiman crocodylus

<4 OOs, SEQUENCE: 36 Met Gly Lieu. Gly Lieu. His Lieu. Lieu Val Lieu Ala Ala Ala Lieu. Glin Gly 1. 5 1O 15

Ala

<210s, SEQ ID NO 37 &211s LENGTH: 23 212. TYPE: PRT <213> ORGANISM: Human immunodeficiency virus 1

<4 OO > SEQUENCE: 37 Gly Ala Lieu. Phe Lieu. Gly Phe Lieu. Gly Ala Ala Gly Ser Thr Met Gly 1. 5 1O 15

Ala Pro Llys Ser Lys Arg Llys 2O

<210s, SEQ ID NO 38 &211s LENGTH: 16 212. TYPE: PRT US 9,393,221 B2 87 88 - Continued <213> ORGANISM: Drosophila sp.

<4 OOs, SEQUENCE: 38 Arg Glin Ile Lys Ile Trp Phe Glin Asn Arg Arg Met Lys Trp Llys Llys 1. 5 1O 15

<210s, SEQ ID NO 39 &211s LENGTH: 24 212. TYPE: PRT <213> ORGANISM: Influenza virus

<4 OOs, SEQUENCE: 39 Gly Lieu. Phe Glu Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1. 5 1O 15 Met Ile Asp Gly Gly Gly Tyr Cys 2O

<210s, SEQ ID NO 4 O &211s LENGTH: 27 212. TYPE: PRT <213s ORGANISM: Unknown 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Unknown: Transportan. A peptide

<4 OOs, SEQUENCE: 4 O Gly Trp Thir Lieu. Asn. Ser Ala Gly Tyr Lieu. Lieu. Gly Lys Ile Asn Lieu. 1. 5 1O 15 Lys Ala Lieu Ala Ala Lieu Ala Lys Lys Ile Lieu. 2O 25

<210s, SEQ ID NO 41 &211s LENGTH: 9 212. TYPE: PRT <213s ORGANISM: Unknown 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Unknown: Pre-S-peptide 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (1) . . (1) <223> OTHER INFORMATION: May or may not be present <4 OOs, SEQUENCE: 41 Ser Asp His Glin Lieu. ASn Pro Ala Phe 1. 5

<210s, SEQ ID NO 42 &211s LENGTH: 9 212. TYPE: PRT <213s ORGANISM: Unknown 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Unknown: Somatostatin (tyr-3-octreotate) peptide 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (1) . . (1) <223> OTHER INFORMATION: May or may not be present 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (2) ... (2) <223> OTHER INFORMATION: May be L-Phe or D-Phe 22 Os. FEATURE: <221s NAME/KEY: MOD RES <222s. LOCATION: (5) . . (5) <223> OTHER INFORMATION: May be L-Trp or D-Trp

<4 OOs, SEQUENCE: 42 Ser Phe Cys Tyr Trp Llys Thr Cys Thr 1. 5 US 9,393,221 B2 89 90 - Continued

SEQ ID NO 43 LENGTH: 8 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide

<4 OOs, SEQUENCE: 43 Ala Phe Asp Asn Val Gly Tyr Glu 1. 5

SEQ ID NO 44 LENGTH: 8 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic peptide FEATURE: NAMEAKEY: misc feature LOCATION: (1) ... (8) OTHER INFORMATION: This peptide may be 1-8 residues in length <4 OOs, SEQUENCE: 44 Gly Gly Gly Gly Gly Gly Gly Gly 1. 5

30 I claim: 5. The method of claim3, wherein the in vivo contact is in 1. A method for reducing intracellular lipid accumulation a human subject. in a cell comprising contacting the cell in vitro or in Vivo with 6. The method of claim 3, wherein the in vivo contact an effective amount of a compound selected from Table 3, comprises administering the compound using an administra wherein the effective amount of the compound shifts cellular 35 energy metabolism from fatty acid oxidation to glycolysis, tion route selected from the group consisting of oral, Subcu thereby reducing intracellular lipid accumulation within the taneous, intravenous, intramuscular, intraperitoneal, intrana cell, wherein the cell has reduced Adipose Triglyceride sal, and topical. Lipase (ATGL) function due to a loss of function mutation in 7. The method of claim 5, wherein the human subject has the gene PNPLA2. Neutral Lipid Storage Disease associated with myopathy 2. The method of claim 1, wherein the cell is selected from 40 (NLSD-M). the group consisting of a skeletal muscle cell, a heart muscle 8. The method of claim 1, wherein the compound is Meflo cell, a Smooth muscle cell, a neuronal cell, a leukocyte cell, a quine hydrochloride. bone marrow cell, an epithelial cell, and an endothelial cell. 3. The method of claim 1, wherein the contact is in vivo. 9. The method of claim 1, wherein the effective amount of 4. The method of claim 1, wherein the compound further 45 the compound ranges from about 0.1 uM to about 20 uM. comprises a pharmaceutically acceptable carrier. k k k k k