Global Gene Repression by the Steroid Receptor Coactivator SRC-1 Promotes Oncogenesis

Published OnlineFirst March 19, 2014; DOI: 10.1158/0008-5472.CAN-13-2133

Cancer Therapeutics, Targets, and Chemical Biology Research

Claire A. Walsh1, Jarlath C. Bolger1, Christopher Byrne1, Sinead Cocchiglia1, Yuan Hao1,2, Ailis Fagan1, Li Qin3, Aoife Cahalin1, Damian McCartan1, Marie McIlroy1, Peadar O'Gaora2, Jianming Xu3, Arnold D. Hill1, and Leonie S. Young1

Abstract Transcriptional control is the major determinant of cell fate. The steroid receptor coactivator (SRC)-1 enhances the activity of the estrogen receptor in breast cancer cells, where it confers cell survival benefits. Here, we report that a global analysis of SRC-1 target genes suggested that SRC-1 also mediates transcriptional repression in breast cancer cells. Combined SRC-1 and HOXC11 ChIPseq analysis identified the differentiation marker, CD24, and the apoptotic protein, PAWR, as direct SRC-1/HOXC11 suppression targets. Reduced expression of both CD24 and PAWR was associated with disease progression in patients with breast cancer, and their expression was suppressed in metastatic tissues. Investigations in endocrine-resistant breast cancer cell lines and SRC-1 / /PyMT mice confirmed a role for SRC-1 and HOXC11 in downregulation of CD24 and PAWR. Through bioinformatic analysis and liquid chromatography/mass spectrometry, we identified AP1 proteins and Jumonji domain containing 2C (JMD2C/KDM4C), respectively, as members of the SRC-1 interactome responsible for transcriptional repression. Our findings deepen the understanding of how SRC-1 controls transcription in breast cancers. Cancer Res; 74(9); 2533–44. 2014 AACR.

Introduction There is now substantial evidence that SRC-1 is central to The steroid receptor coactivator protein SRC-1 (NCoA1) was the ability of endocrine tumors to adapt and overcome first identified in a yeast two-hybrid system as an enhancer of targeted therapy (4, 6, 7). Though other members of the the progesterone receptor (1), with a role as a global nuclear p160 family, including SRC-2 (GRIP1/TIF2/NCoA2) and receptor coactivator quickly being established thereafter. More SRC-3 (AIB1/ACTR/RAC-3/pCIP/TRAM-1/NCoA3), have fi recently, a steroid-independent role for SRC-1 has been rec- been investigated in endocrine-related cancer (8), a speci c ognized and the coactivator has been shown to interact with role for SRC-1 in the development of metastatic disease has other transcription factors including members of the Ets been described (9, 10). Global analysis of SRC-1 targets in fi family, Ets2 and PEA3 (2, 3) and the developmental protein breast cancer cells has identi ed pathways involved in growth HOXC11 (4). SRC-1, a member of the p160 family of steroid factor signaling and cellular adaptability (11). Furthermore, in vivo coactivator proteins, is a master transcriptional regulator. It molecular and studies have provided evidence that was recently identified as the gene with the strongest selective SRC-1 promotes disease progression and the development pressure among ethnic populations analyzed by the Interna- of metastasis, through the transcriptional activation of tional HapMap Project (5), illustrating the importance of the tumorigenic genes, including integrin-a5, ADAM22, and Myc coactivator protein in human evolutionary adaptation. (3, 7, 12). All of the p160 family members have been described as transcriptional coactivators. However, SRC-2 has a somewhat amphipathic role in transcriptional regulation, working as Authors' Affiliations: 1Endocrine Oncology Research, Royal College of both a trans-activator and repressor of the glucocorticoid 2 Surgeons in Ireland; UCD School of Biomolecular and Biomedical Sci- receptor (GR) depending on the transcriptional context (13, ence, Conway Institute, University College Dublin, Dublin, Ireland; and 3Department of Molecular and Cellular Biology and Dan L. Duncan Cancer 14). This dual regulatory role for SRC-2 opens up the possibility Center, Baylor College of Medicine, Houston, Texas that SRC-1 could also suppress transcriptional activity to fulfill Note: Supplementary data for this article are available at Cancer Research its oncogenic potential. Online (http://cancerres.aacrjournals.org/). In this study, we used global analysis to identify a set of C.A. Walsh and J.C. Bolger contributed equally to this work. SRC-1 suppression targets, a number of which are coregulated by HOXC11. We investigated the mechanism of SRC-1 tran- Corresponding Author: Leonie S. Young, Endocrine Oncology Research, Department of Surgery, Royal College of Surgeons in Ireland, Dublin 2, scriptional repression of two of these targets, CD24 and PAWR. Ireland. Tel.: 353-1-402-8576; Fax: 353-1-402-8551; E-mail: In a similar manner to SRC-2, SRC-1 utilized AP1 sites to [email protected] identify suppression targets, which were then silenced through doi: 10.1158/0008-5472.CAN-13-2133 combined recruitment of histone deacetylase (HDAC) proteins 2014 American Association for Cancer Research. and histone methylation. Direct SRC-1 suppression targets

www.aacrjournals.org 2533

Walsh et al.

A B

C Pathways associated with SRC-1–downregulated genes Apoptosis Mitogenic signalling Immune system response Inflammatory response DNA damage response Cell differentiation Cystic fibrosis disease Vascular development Tissue remodeling and wound repair Cardiac hypertrophy Cell cycle and its regulation

0 5 10 15 20 25

2534 Cancer Res; 74(9) May 1, 2014 Cancer Research

SRC-1 Mediates Transcriptional Repression

included genes important in apoptosis and cellular differen- hybridized to whole-genome expression arrays as previously tiation, and both CD24 and PAWR were found to be markers of described (11). Overlapping peaks between the SRC-1 ChIP-seq prolonged disease-free survival (DFS) in patients with breast dataset and the HOXC11 ChIP-seq dataset were identified from cancer. This study describes a novel mechanism of coregula- ChIP sequencing of SRC-1 immunoprecipitated DNA with a tory gene repression and adds another layer of complexity to false discovery rate (FDR) of <1 and the identified peaks from the known functions of SRC-1. the HOXC11 immunoprecipitated DNA with a FDR of <10. Genes downregulated by SRC-1 were submitted to DAVID Materials and Methods bioinformatic database and arranged by functional annotation Cell culture, treatments, and transfections (11). Hypergeometric testing as implemented in R through the Endocrine-sensitive MCF7 cells were obtained from Amer- "phyper" function was used to calculate the P value significance ican Type Culture Collection and endocrine-resistant LY2 cells between the SRC-1 ChIP data and SRC-1 downregulated gene were a kind gift from R. Clarke, Georgetown University, from the expression array data. Washington DC (15) and have been classified as luminal B Accession codes. All ChIP-seq and expression array data (16). Cells were grown as previously described (17). Cells were are available from the Gene Expression Omnibus database maintained in steroid-depleted medium for 72 hours before under series entry codes GSE28987 (SRC-1 ChIP-seq), treatment with hormones [estradiol (E2), 10 8 mol/L; 4-hydro- GSE54027 (HOXC11 ChIP-seq), and GSE28645 (SRC-1 expres- xytamoxifen (4-OHT), 10 7 mol/L; Sigma-Aldrich] over varying sion array), respectively. time periods. All cell lines were tested (Source Biosciences, Life Sciences) for authenticity in accordance with American Type LC-mass spectrometry assay 7 Culture Collection guidelines. MCF7andLY2cellsweretreatedwith4-OHT(10 mol/L) siRNA directed against SRC-1 (Ambion, AM16706), HOXC11 for 45 minutes. Cells were harvested and lysed. Nuclear (Qiagen, Hs_HOXC11_2), and jumonji domain containing 2C protein extracts were combined and resolved by SDS-PAGE. (JMJD2C; Santa Cruz Biotechnology, sc-92765) were used to Peptides were analyzed by liquid chromatography/tandem transiently knock down gene expression. The pcDNA3.1 and mass spectrometry (LC/MS-MS) on a Bruker HCT Ultra ion- pcDest47 (both Invitrogen) plasmids containing full-length trap system. The mgf files were then searched using the SRC-1 and HOXC11, respectively, were used for overexpression X!Tandem search algorithm against the human SWISS-PROT studies. Empty plasmids were used as a negative control. protein database. Proteins identified via this search were Transfections were carried out using Lipofectamine 2000 checked for peptides that had E-values that did not exceed (Invitrogen) as per manufacturer's instructions. Experiments 3. MS spectra were then examined to identify the corre- were carried out 72 hours after transfection. sponding peak doublets. Endocrine-resistant LY2 SRC-1 stable knockdown cells were made using MISSION short hairpin RNA (shRNA) Coimmunoprecipitation and Western blotting lentiviral pLKO.1-puro-CMV-tGFP particles (Sigma). LY2 Western blotting was carried out as previously described (3). cells were transduced (multiplicity of infection of 5) with Primary antibodies used were rabbit anti-human PAWR either SRC-1 shRNA or shRNA control particles and cultured (1:1000, 2328 Cell Signaling Technology), rabbit anti-human in 1 ng/mL puromycin to select transduced cells. Stable SRC-1 (1:100, sc-8995, Santa Cruz Biotechnology), rabbit anti- knockdown of SRC-1 was confirmed by quantitative real- human HOXC11 (1:200, sc-788, Santa Cruz Biotechnology), or time PCR (qRT-PCR) and cells were continuously cultured in b-actin (1:7500; Sigma-Aldrich). 0.5 ng/mL puromycin. Protein was immunoprecipitated with rabbit anti–SRC-1. Briefly, protein AG beads were blocked overnight in bovine Chromatin immunoprecipitation sequencing serum albumin at 4C and beads were subsequently washed To identify SRC-1 target genes, chromatin immunoprecip- with protease inhibitors. Immunoglobulin G (IgG) or SRC-1 itation (ChIP)-seq was conducted in endocrine-resistant LY2 antibodies along with protein lysate were added to the cells that were treated with vehicle or tamoxifen (4-OHT, 10 7 beads. Following incubation, protein-bound beads were mol/L) for 45 minutes and immunoprecipitated with anti– isolated and prepared for immunoblot analysis for SRC-1, SRC-1 (sc-8995; Santa Cruz Biotechnology) and anti-HOXC11 c-Jun, JMJD2C, and HDAC1. Primary antibodies used were (Ab-37844; AbCam) antibodies as previously described (11). To rabbit anti-human SRC-1 (1:100, sc-8995, Santa Cruz Bio- identify functionally relevant SRC-1 target genes, DNA was technology), rabbit anti-human c-Jun (1:2000, sc-44, Santa

Figure 1. SRC-1 directly downregulates genes in endocrine-resistant breast cancer. A, heatmap showing increased intensity of SRC-1–binding events in treated endocrine-resistant breast cancer (LY2) cells compared with untreated resistant cells and endocrine-sensitive (MC7) cells. The window represents 5-kb regions from the center of the binding events. B, Venn diagram of crossover between SRC-1 cistrome and SRC-1–dependent gene suppression defined 1,007 SRC-1–dependent repressed genes. The Venn diagram shows the number of genes from the set of Affymetrix hgu133plus2 genes that were downregulated by SRC1 (2,047, P<0.05) and that had an SRC1 ChIP-seq peak in the promoter (5 kbp upstream) or first exon (8,867 with a MACS FDR <1%). A total of 1,007 genes overlapped these two conditions. The overlap was found to be significant (P ¼ 3.111317e-06). C, pathway analysis of direct SRC-1–repressed genes revealed a number of pathways being suppressed by SRC-1. An overrepresentation of apoptotic and cell differentiation pathways following treatment was seen. D, the top 50 SRC-1 downregulated genes were submitted to the DAVID bioinformatics database and arranged by functional annotation. The top seven functional groupings are represented. CD24 is represented in "Cell surface receptor linked signal transduction" and the "Wnt receptor signaling pathway."

www.aacrjournals.org Cancer Res; 74(9) May 1, 2014 2535

Walsh et al.

A B 20 Vehicle-treated LY2 5-Kb Promoter Forward strand HOXC-binding sites Reverse strand HOXC-binding sites 0 CHR6 20 Tamoxifen-treated LY2 CD24

0 CD24

C D

Promoter

Downstream 5'UTR

3'UTR

Coding exon

Intron

Distal Intergenic

E 5-Kb Promoter F SRC-1 recruitment HOXC11 recruitment Forward strand HOXC-binding sites

CHR12 Reverse strand HOXC-binding sites

PAWR

Figure 2. SRC-1 and HOXC11 are recruited to the promoters of luminal markers CD24 and PAWR. A, representative image of SRC-1 recruitment to the CD24 promoter displayed in the UCSC genome browser. A comparison is made between peaks under control conditions and following 4-OHT treatment, with 4-OHT treatment inducing a larger SRC-1–binding peak. B, illustration of HOXC family-binding motifs in the CD24 promoter as identified using Genomatrix. C, location of HOXC11-binding sites seen in LY2 cells on tamoxifen treatment. D, Venn diagram of crossover between the HOXC11 and the SRC-1 cistrome defined 54 genes as common targets. Thirty-two of these were for known protein coding regions. E, illustration of HOXC family-binding motifs in the PAWR promoter as identified using Genomatrix. F, representative image of SRC-1 and HOXC11 recruitment to the PAWR promoter displayed in the UCSC genome browser under control conditions and following 4-OHT treatment. G, ChIP analysis of SRC-1 and HOXC11 recruitment to the CD24 and PAWR promoters in LY2 cells following treatment with either vehicle or 4-OHT. Treatment with 4-OHT led to increased recruitment of SRC-1 and HOXC11 to the CD24 (, P ¼ 0.04 and , P ¼ 0.03) and PAWR (, P ¼ 0.007 and , P ¼ 0.05) promoters, respectively. Recruitment calculated relative to untreated samples (mean SEM, n ¼ 3).

Cruz Biotechnology), rabbit anti-human JMJD2C (1:2000, Knockout mouse NB110-38884, Novus Biologicals), and rabbit anti-human Knockout and wild-type (WT) mammary tumor cell lines HDAC1 (1:2000, ab7028, Abcam). were developed from primary tumors in SRC-1 / /PyMT

2536 Cancer Res; 74(9) May 1, 2014 Cancer Research

SRC-1 Mediates Transcriptional Repression

and WT/PyMT mice as described in the work of Xu and quantiﬁed after shearing using a Nanodrop (Thermo Scientiﬁc) colleagues (9). to ensure equal starting material in each sample. The following antibodies were incubated overnight at 4C with rotation in ChIP assay and PCR combination with the corresponding dynabeads (Life Tech- LY2 cells were steroid depleted for 72 hours, then treated nologies): 3 mg rabbit anti-human SRC-1 (sc-8995, Santa Cruz with vehicle or 4OHT for 45 minutes, and ChIP analysis was Biotechnology), rabbit anti-human c-Jun (sc-44, Santa Cruz carried out as previously described (4). Cell lysates were Biotechnology), 3 mg rabbit anti-human JMJD2C (NB110-

A B

CD24 expression in patient primary cultures

C evitisop42D CD24 negative lortnocGgI 3 Survival analysis of CD24 in a luminal population 1.00 2 0.75 0.50

DFS 1 MFIR for CD24 0.25

P = 0.0039 0 0.00 0 24 48 72 96 120 Luminal A tumors Luminal B tumors Analysis time (months) Patient primary cultures CD24 negative CD24 positive

C D Patient A Patient B Patient C

PPevitisopRWA AWR negativelortnocGgI H&E

Survival analysis of PAWR in a clinical patient population Primary 1.00 PAWR tumor IgG Ctrl 0.75

0.50 CD24 DFS IgG Ctrl 0.25

P = 0.01 H&E 0.00 0 24 48 72 96 120 Analysis time (months) PAWR negative PAWR positive Recurrence PAWR

CD24

Figure 3. CD24 and PAWR in endocrine-treated breast cancer patients. A, immunolocalization of CD24 in breast cancer patient TMA. Kaplan–Meier estimates of DFS according to CD24 in luminal breast cancer patients (n ¼ 243). CD24-positive patients have significantly improved 5-year survival compared with CD24-negative patients (P < 0.0039). B, significantly lower levels of CD24 protein were detected in patient luminal B cells in comparison with luminal A cells (P ¼ 0.03; n ¼ 3 patient tumors/group) by FACS analysis. C, immunolocalization of PAWR in total breast cancer patient population (n ¼ 560). PAWR-positive patients have significantly improved 5-year survival compared with PAWR-negative patients (P ¼ 0.01). D, CD24 and PAWR protein levels are reduced in metastatic tissue in comparison with matched breast cancer primary tissue from three SRC-1–negative luminal A patients. Tissue from three individual patients shown.

www.aacrjournals.org Cancer Res; 74(9) May 1, 2014 2537

Walsh et al.

A SRC-1 inhibits CD24 mRNA expression B HOXC11 inhibits CD24 mRNA expression

SRC-1 inhibits PAWR mRNA expression HOXC11 inhibits PAWR mRNA expression

C D

SRC-1 inhibits PAWR protein HOXC11 inhibits PAWR protein expression expression

PAWR PAWR

b-Actin b-Actin

Scram siSRC1 Scram siiHOXC11 LY2 cells LY2 cells

F CD24 PAWR

IgG IgG control control

Figure 4. SRC-1 and HOXC11 regulate CD24 and PAWR. A, transcript levels of CD24 and PAWR as analyzed by qRT-PCR following overexpression of SRC-1 using the pc3.1 vector in MCF7 cells and knock down of SRC-1 with siRNA in LY2 cells. There is a significant decrease in both CD24 and PAWR expression following overexpression of SRC-1 (, P ¼ 0.04 and , P ¼ 0.05, respectively). When SRC-1 is knocked down, there is a significant corresponding increase in CD24 and PAWR mRNA expression (, P ¼ 0.02 and , P ¼ 0.01, respectively). Results are mean SD, n ¼ 3. B, transcript levels of CD24 and PAWR as analyzed by qRT-PCR following overexpression of HOXC11 using the Dest47 vector in MCF7 cells and knockdown of HOXC11 with siRNA in LY2 cells. There is a significant decrease in both CD24 and PAWR expression following overexpression of HOXC11 (, P ¼ 0.005 and , P ¼ 0.01, respectively). When HOXC11 is knocked down, there is a significant corresponding increase in CD24 and PAWR mRNA expression (, P ¼ 0.03 and , P ¼ 0.001, respectively). Results are mean SEM, n ¼ 3. C, cell surface protein expression of CD24 in LY2 cells as measured by flow cytometry. Following SRC-1 knockdown, there is a restoration of CD24 cell surface expression in LY2 cells. D, PAWR protein levels following knockdown of SRC-1 and HOXC11 with siRNA in LY2 cells. Knock down of both SRC-1 and HOXC11 leads to reexpression of PAWR protein (n ¼ 3). E, elevated levels of CD24 and PAWR transcript, as determined by qRT-PCR were detected in mammary tumors from SRC-1 / /PyMTmice in comparison with wild-type mice (WT/PyMTmice); , P ¼ 0.019 and , P ¼ 0.02; n ¼ 4micetumors/ group; results for qRT-PCR expressed as mean SEM. F, immunohistochemistry was used to compare CD24 and PAWR expression in tumors from SRC-1 / /PyMTmice and WT/PyMT mice. Elevated levels of CD24 and PAWR were found in the SRC-1 / mouse (n ¼ 4; representative images shown).

2538 Cancer Res; 74(9) May 1, 2014 Cancer Research

SRC-1 Mediates Transcriptional Repression

38884, Novus Biologicals), 3 mg rabbit anti-human HDAC1 PE and FITC isotype controls were used as experimental (ab7028, Abcam), 3 mg rabbit anti-human H3K4 trimethyla- controls. tion (ab8580, Abcam), 3 mg mouse anti-human H3K27 (ab6002, Abcam), 3 mg rabbit anti-human Anti-Histone Immunohistochemistry H3K36 (ab9050, Abcam), 3 mg rabbit IgG, or 3 mgmouse Patient breast tumor samples were collected, the tissue IgG (sc-2343, Santa Cruz Biotechnology) as a negative con- microarray (TMA) constructed, and data recorded as previ- trol and 3.5 mL antiacetylated H4 (Millipore) as a positive ously described (18). Primary tumors from the knockout control. Reverse cross-linking and DNA recovery were car- mouse were formalin fixed and paraffin embedded. The TMA ried out, and real-time PCR was performed in duplicate by and full faces of knockout mouse tumors were immunostained SYBR Green PCR (Qiagen) using the 7500 Real-Time PCR using rabbit anti-PAWR (2 mg/mL, 2328 Cell Signaling Tech- system (Applied Biosystems). The primers for qRT-PCR were nology) and mouse anti-CD24. Immunostained slides were as follows: CD24 promoter: forward TCAGGATAAGTGG- called using the Allred scoring system (18). TAAGAG, reverse GAGATCGGAGACCATCCTGG and the PAWR promoter: forward CTAGCAGCTTCGCGGCGTCC, Statistical analysis reverse GAAGGGCGTGGAGTGCCGTT. For ChIP of gene Associations of CD24 and PAWR with clinicopathologic body methylation, the following primer sequences were variables and SRC-1 were examined using Fisher exact test. used: CD24 gene body: forward TAGTAGATTCGATGAA- Kaplan–Meier graphs were used as an estimate of DFS. Sta- GAC, reverse TATGAGAGTACGTGGAGGT and the PAWR tistical analyses were conducted using STATA 10 data analysis gene body: forward CAGGCAGGATGAAGTGAAT and software (Stata Corp. LP) and GraphPad Prism 6 (GraphPad reverse CTCACCGTAAGCATGAACTC. For measuring tran- software Inc) and values of P < 0.05 were considered significant. script levels, the primers used were CD24 forward primer: Statistical significance for molecular experiments was per- AACTAATGCCACCACCAAGG, reverse: CCTTGTTTTTCCT- formed using a paired Student t test, with significance accepted TGCCACAT. PAWR forward primer: ACATCCCTGCCGCAG- at P < 0.05. AGTGCT, reverse primer: TCTCGTTTCCGCTCTTTCTGC. Results Fluorescence-activated cell sorting SRC-1 directly downregulates genes in endocrine- Flow cytometry was performed using fluorescence-activated resistant breast cancer cell sorting (FACS) Aria II (BD Biosciences). Primary cell Increased intensity of SRC-1–binding events was observed in cultures derived from patient tumors were cultured for 72 endocrine resistant breast cancer cells in comparison with hours before experiments as described (4). The primary cells sensitive cells, in particular in the presence of the SERM were then centrifuged at 60 g for 4 minutes and washed once tamoxifen (Fig. 1A). Combining expression array and ChIP- with sterile PBS. The primary cells were counted manually seq analysis, we identified 1,007 genes directly repressed by using Trypan blue dye and a hemocytometer. The cells were SRC-1. The number of genes downregulated by SRC1 were then divided equally among the experimental samples. The found to have more SRC1 peaks in the promoter/first exon cells were then stained with FITC-conjugated-CD44 and phy- than expected by chance (P ¼ 3.111317e-06; Fig. 1B). Pathway coerythrin (PE)-conjugated-CD24 (555478, 555428 BD Bio- analysis of SRC-1–repressed genes revealed an overrepresen- sciences) for 1 hour in the dark at 4 C. Unstained sample and tation of pathways important in tumor suppression, including

A SRC-1 c-Jun coimmunoprecipitation B c-Jun recruitment to CD24 and PAWR promoters Vehicle 4OHT 10 SRC-1 * * 8 c-Jun

2 Relative recruitment

0 Jun lgG Jun lgG CD24 PAWR

Figure 5. SRC-1 uses AP-1 binding sites to identify candidates for transcriptional silencing. A, SRC-1 was immunoprecipitated from whole-cell extract from LY2 cells treated with vehicle or 4-OHT for 45 minutes and subsequently immunoblotted for Jun. Treatment with 4-OHT drives SRC-1–Jun interactions; representative blot of three independent experiments. B, conﬁrmation of the recruitment of the AP-1 protein Jun to the CD24 and PAWR promoters using ChIP analysis. LY2 were treated with 4-OHT (45 minutes, 10 7 mol/L). Jun ChIP was performed to the CD24 and PAWR promoters. Mean recruitment calculated relative to input controls (, P ¼ 0.001 and 0.009, respectively; mean SEM, n ¼ 3).

www.aacrjournals.org Cancer Res; 74(9) May 1, 2014 2539

Walsh et al.

B C Recruitment of JMJD2C to CD24 and PAWR promoter JMJD2C regulates CD24 and PAWR mRNA expression

D 42DC RWAP

E SRC-1 coimmunoprecipitation F Recruitment of HDAC1 to PAWR promoter

SRC-1

JMJD2C

HDAC1 Vehicle 4OHT

G H3K27 trimethylation at CD24 promoter H3K27 trimethylation at PAWR promoter

H H3K36 trimethylation in the CD24 gene body H3K36 trimethylation in the PAWR gene body *

2540 Cancer Res; 74(9) May 1, 2014 Cancer Research

SRC-1 Mediates Transcriptional Repression

recruitment of both SRC-1 and HOXC11 to the CD24 and 4-OHT PAWR promoters was confirmed in ChIP studies (Fig. 2F SRC-1 JMD2C and G). fos K27me3 HOXC11 K36me3 CD24 and PAWR in endocrine-treated breast cancer jun patients H2 H4 H3 H3 In a cohort of patients with breast cancer, expression of CD24 and PAWR was found to inversely associate with SRC-1 and positively associate with luminal A status (Supplementary Table S3). In line with the defined role of SRC-1 in promoting HDAC1 increased tumor aggression, the luminal marker CD24 was found to associate with increased time to disease progression in the total patient population, in luminal patients and in Figure 7. Putative SRC-1 interactome. Schematic illustrating the putative luminal A patients (Fig. 3A and Supplementary Fig. S1). In SRC-1 interactome regulating transcriptional repression of target genes. primary cell cultures derived from ER-positive tumors, elevated levels of CD24 expression also associated with luminal A apoptosis and cell differentiation (Fig. 1C). Grouping direct status (Fig. 3B). In a similar manner, the proapoptotic marker SRC-1 suppression targets by function identified CD24 as a PAWR also associated with prolonged DFS (Fig. 3C). Further- gene important in both cell surface signal transduction and more, in endocrine-resistant luminal A patients who did Wnt signaling processes (Fig. 1D). express CD24 and PAWR in their primary tumor, expression of both the luminal marker and the apoptotic protein was lost SRC-1 and HOXC11 are recruited to the promoters of in the metastatic setting (Fig. 3D and Supplementary Table S4). luminal markers CD24 and PAWR Conversely, expression of SRC-1 was gained in the metastatic Enhanced recruitment of SRC-1 to the CD24 promoter was tumors. These clinical studies support a role for CD24 and observed in the presence of tamoxifen (Fig. 2A). Furthermore, PAWR in advancing a good prognosis and suggest that loss of multiple HOXC-binding sites, capable of binding the defined these proteins may have a role in promoting a more aggressive SRC-1 transcription partner, HOXC11, were identified phenotype. upstream of the CD24 start-site (Fig. 2B). To identify further common SRC-1/HOXC11 targets, we performed HOXC11 SRC-1 and HOXC11 regulate CD24 and PAWR ChIP-seq in luminal B LY2 cells. In a similar manner to Overexpression and knockdown studies in luminal B breast SRC-1, enhanced HOXC11 genome binding was observed in cancer (LY2) cells with subsequent transcript analysis con- the presence of tamoxifen (Supplementary Table S1). Recruit- firmed a role for SRC-1 and its transcriptional partner HOXC11 ment of HOXC11 was found to be mainly to introns and distal in the transcriptional suppression of CD24 (Fig. 4A) and PAWR intergenic regions, with relatively little binding to promoter (Fig. 4B). Knockdown of SRC-1 enhanced protein expression of regions (Fig. 2C). Fifty-four genes were identified as common CD24 (Fig. 4C), whereas knockdown of either SRC-1 or HOXC11 SRC-1/HOXC11 targets, 32 of which were protein-coding restored PAWR expression in luminal B breast cancer cells (Fig. genes (Fig. 2D and Supplementary Table S2). The proapop- 4D). Furthermore, in the PyMT SRC-1 knockout mouse model totic protein PAWR was identified amongst the top five (SRC-1 / /PyMT), elevated levels of CD24 and PAWR tran- common targets (Supplementary Table S2). Consistent with script levels (Fig. 4E) and protein expression (Fig. 4F and the ChIP-seq studies, multiple HOXC family motifs were Supplementary Fig. S2) were observed in tumor tissue from the located in the PAWR promoter (Fig. 2E). Treatment-induced SRC-1 / in comparison with the wild-type animals. These

Figure 6. SRC-1 utilizes JMJD2C to silence CD24 and PAWR. A, LC/MS was used to identify endocrine-resistant specific SRC-1 interacting proteins. Endocrine-sensitive (MCF7) and endocrine-resistant (LY2) breast cancer cells were treated with 4-OHT (45 minutes, 10 7 mol/L) and were immunoprecipitated with anti–SRC-1. SRC-1–interacting proteins were separated on a one dimensional gel and the resultant lanes were analyzed by LC/MS. One hundred and twenty-six proteins were identified as unique to the endocrine-resistant phenotype. Proteins were arranged by functional annotation and Jumonji domain containing 2C (KDM4AC/JMJD2C) was identified as a potential transcriptional regulator. B, confirmation of JMJD2C recruitment to the CD24 and PAWR promoters with ChIP analysis. Elevated recruitment of JMJD2C to both the CD24 and PAWR promoters was observed following treatment with 4- OHT (45 minutes, 10 7 mol/L; , P ¼ 0.005 and 0.009). Mean recruitment calculated relative to untreated controls (mean SEM, n ¼ 3). C, elevated transcript levels of CD24 and PAWR as determined by qRT-PCR following knockdown of JMJD2C using siRNA (, P ¼ 0.01 and , P ¼ 0.001). mRNA levels expressed as mean SEM, n ¼ 3. D, schematic representing location for ChIP qPCR of HDAC1 (repression mark), H3K27me3 (repression mark), and H3K4me3 (activation mark) in the promoters of CD24 and PAWR (P) and for H3K36me3 (elongation mark) in the gene body of CD24 and PAWR (GB). E, SRC-1 was immunoprecipitated from LY2 cells treated with vehicle or 4-OHT (45 minutes, 10 7 mol/L) and subsequently immunoblotted for JMJD2C and HDAC1. Treatment with 4-OHT drives SRC-1 interactions with JMJD2C and HDAC1; representative blot of three independent experiments. F, mechanism of suppression of PAWR: there is a significant reduction in HDAC1 recruitment to the PAWR promoter in LY2 cells stably transfected with shSRC-1. Mean recruitment calculated relative to nontargeting controls (, P ¼ 0.01; mean SEM, n ¼ 3). G, there is a decrease in H3K27 trimethylation at the CD24 and PAWR promoters (, P ¼ 0.05 and , P ¼ 0.04, respectively) in LY2 cells stably transfected with shSRC-1. Mean recruitment calculated relative to the nontargeting control cells (mean SEM, n ¼ 3). H, there is an increase in H3K36 trimethylation in the CD24 gene body in LY2 cells stably transfected with siJMJD2C (, P ¼ 0.045). Alterations in H3K36 trimethlyation in the PAWR gene body were not found to be significant. Mean recruitment calculated relative to the scrambled siRNA control cells (mean SEM, n ¼ 3).

www.aacrjournals.org Cancer Res; 74(9) May 1, 2014 2541

Walsh et al.

data confirm a role for SRC-1 in the transcriptional repression vation (24). In this study, knockdown of JMJD2C was found to of CD24 and PAWR. activate H3K36 gene methylation in the gene body of CD24, and to a lesser extent PAWR (Fig. 6H). These data implicate that SRC-1 uses AP-1–binding sites to identify candidates for JMJD2C in SRC-1 mediated transcriptional repression in breast transcriptional silencing cancer cells. As SRC-1 is a known transcriptional activator, we wanted to Taken together these functional studies suggest that SRC-1 investigate how the coregulatory protein marked target genes can select genes for repression by utilizing AP1 transcription for transcriptional repression. Using bioinformatic studies, we factors and can induce transcriptional repression through both undertook motif analysis of the SRC-1 cistrome. Similar to histone deacetylation and JMJD2C-mediated histone methyl- SRC-2 downregulated genes, AP1 sites were observed to be ation mechanisms (Fig. 7). overrepresented in the promoters of SRC-1–repressed genes in comparison with SRC-1 activated genes (Supplementary Table S5). 4-OHT treatment-induced interactions between SRC-1 Discussion and the AP-1 protein Jun were observed in LY2 breast cancer SRC-1 functions at several levels to regulate gene expression, cells (Fig. 5A and Supplementary Fig. S3), this is due to, at least including transcription initiation, elongation, RNA splicing, in part, increased levels of SRC-1 in the presence of 4-OHT. receptor turn over, and translation. Its predominant role, Recruitment of Jun to both the CD24 and PAWR promoters was however, is as a transcriptional coactivator. In breast cancer, confirmed by ChIP analysis (Fig. 5B). overexpression of SRC-1 confers on the cell the ability to adapt and overcome targeted therapy by upregulating developmen- SRC-1 utilizes JMJD2C to silence CD24 and PAWR tal and dedifferentiation genes (7, 11). Challenging the classic To explore potential mechanisms of SRC-1 transcriptional role of SRC-1 as a transcriptional activator, global analysis of repression, we undertook LC/MS of SRC-1 interacting proteins direct SRC-1 targets described here, uncovered a significant in 4-OHT–treated (45 minutes) luminal B (LY2) and luminal A number of repressed genes. Pathway analysis revealed these (MCF7) breast cancer cells. One hundred and twenty-six genes to be important in cellular differentiation and apoptosis, proteins were identified as specific SRC-1 interacting proteins which is consistent with SRC-1's role in promoting an aggres- in the luminal B cells (Supplementary Table S6). Arranging sive phenotype. proteins by functional annotation, we identified JMJD2C/ In previous studies, we have identified HOXC11 as a tran- KDM4AC as a potential transcriptional regulator (Fig. 6A). scription factor partner for SRC-1, which can activate genes to JMJD2 proteins are demethylases that target histone H3 on mediate increased tumor plasticity and adaptation to the ther- lysines 9 and 36 (reviewed extensively in ref. 19). Immunopre- apeutic environment (4). Here, we identified the differentiation cipitation confirmed treatment regulated SRC-1/JMJD2C marker CD24 and the apoptotic protein PAWR as direct SRC1/ interactions in LY2 breast cancer cells (Supplementary Fig. HOXC11 suppression targets. CD24 has been identified as a S4). 4-OHT treatment also induced recruitment of JMJD2C to transcriptional target gene for hypoxia-inducible factor-1a the CD24 and PAWR promoters (Fig. 6B). Furthermore, knock- (HIF-1a) and has been linked to HIF-1a–mediated tumor down of JMJD2C in LY2 cells induced a concomitant increase in growth in both primary and metastatic tumors (25). Functions expression of both CD24 and PAWR (Fig. 6C). of CD24, however, may depend on the cellular context, in We looked at epigenetic marks in the promoter and gene body particular with regard to endocrine cancer. Both CD24 and of CD24 and PAWR (Fig. 6D). Previous studies have reported PAWR have documented roles as endocrine tumor suppressors that both AP1 proteins and JMJD2C can induce transcriptional (26–29). Moreover, loss of CD24 and PAWR are associated with silencing by recruiting the HDAC protein, HDAC1 (20, 21). In this poor differentiation and tumor progression (29, 30). Establishing study, treatment with tamoxifen was observed to induce SRC-1/ the functional consequences of SRC-1 target gene expression, HDAC1 interactions in LY2 cells (Fig. 6E) and recruitment of CD24 and PAWR were found to inversely associate with SRC-1 in HDAC1 to the PAWR promoter was found to be SRC-1 depen- primary and metastatic tumors from patients with breast dent (Fig. 6F and Supplementary Fig. S5). cancer. Furthermore, where SRC-1 associates with poor DFS To further elucidate the mechanism of SRC-1–mediated in patients (2, 7), CD24 and PAWR were found to be markers of transcriptional repression, we examined the role of SRC-1 and good prognosis. The fact that SRC-1 silences these functionally JMJD2C in promoter histone methylation. Histone 3 lysine relevant targets is of prime importance when considering the 27 (H3K27) trimethylation, which is a known mark of tran- role of SRC-1 as a transcriptional coregulator. Not only does scriptional silencing, was diminished with SRC-1 knockdown SRC-1 promote expression of oncogenes such as Myc (7), but it in LY2 breast cancer cells at both the CD24 and PAWR also can simultaneously work to suppress expression of genes promoters (Fig. 6G). There was no significant alteration in that are striving to maintain a well-differentiated phenotype. H3K27 trimethlyation seen with JMJD2C knockdown (Supple- As there is now evidence that SRC-1/HOXC11 can both mentary Fig. S6A). Conversely, no alteration was observed in promote and repress gene expression, the question therefore SRC-1–dependent H3K4 trimethylation, a known activation arises as to how SRC-1 can mark some genes for activation and mark, at either of the promoters (Supplementary Fig. S6B). others for repression. Clues may be resident in the SRC-2-GR In the gene body, H3K36 trimethylation facilitates transcrip- pairing. SRC-2 serves as a GR coactivator at palindromic GREs; tion through elongation (22, 23). JMJD2C has previously been however, when SRC-2 is tethered to GR-AP1 sites and GR-NF- shown to demethylate H3K36, leading to transcriptional acti- kB sites, it mediates transcriptional repression (31, 32). From

2542 Cancer Res; 74(9) May 1, 2014 Cancer Research

SRC-1 Mediates Transcriptional Repression

motif analysis of the SRC-1 cistrome, we found AP-1 sites to be In summary, here we have described for the first time that overrepresented in the promoters of SRC-1 repressed genes in the coactivator protein SRC-1 can act as a transcriptional comparison with activated genes. Furthermore, treatment- repressor and have proposed a model whereby SRC-1 can induced SRC-1–jun interactions and recruitment of jun to the select candidate genes for repression or activation in a pro- promoter of both CD24 and PAWR were confirmed, suggesting moter-specific context. SRC-1's ability to bi-directionally reg- that SRC-1 can regulate gene expression in a promoter-specific ulate key genes can drive functional change and enforce its end manner similar to that of SRC-2 (14). phenotype. This novel mechanism of coregulatory gene repres- To elucidate potential mechanisms of SRC-1–mediated sion significantly alters our perception of SRC-1 in the molec- repression, we investigated putative proteins of the SRC-1 ular pathogenesis of cancer. interactome. A number of SRC-1 interacting proteins specific fi to the luminal B breast cancer subtype were de ned. Several fl fi Disclosure of Potential Con icts of Interest transcriptional regulators were identi ed, including the his- No potential conflicts of interest were disclosed. tone demethylase, JMJD2C. Both AP1 proteins and JMJD2C have been shown previously to induce transcriptional repression through recruitment of the histone deacetylating protein Authors' Contributions Conception and design: C.A. Walsh, J.C. Bolger, D. McCartan, L.S. Young HDAC1 (20, 21). Molecular studies confirmed that SRC-1 can Development of methodology: C.A. Walsh, A. Cahalin, D. McCartan, mediate transcriptional repression, at least in part, by facili- M. McIlroy Acquisition of data (provided animals, acquired and managed patients, tating histone deacetylation. provided facilities, etc.): C.A. Walsh, J.C. Bolger, C. Byrne, S. Cocchiglia, L. Qin, JMJD2C has previously been associated with endocrine D. McCartan, M. McIlroy, J. Xu, A.D. Hill, L.S. Young tumors, including breast and prostate (33–36). It has to date Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): C.A. Walsh, J.C. Bolger, C. Byrne, S. Cocchiglia, Y. Hao, predominantly been described as a transcriptional activator, A. Fagan, P. O'Gaora, L.S. Young specifically through lysine demethylation (37, 38). A role for Writing, review, and/or revision of the manuscript: J.C. Bolger, C. Byrne, JMJD2C in transcriptional repression, however, has also P. O'Gaora, L.S. Young Administrative, technical, or material support (i.e., reporting or orga- been elucidated, where activation of the nuclear receptor nizing data, constructing databases): C. Byrne, L. Qin PPAR-g is suppressed by the tudor domain of JMJD2C (20). Study supervision: A.D. Hill, L.S. Young Because of the substantial number of studies describing a roleforJMJD2Cinmodulating histone methylation, we Acknowledgments examined the methylation status of both CD24 and PAWR. The authors thank Lance Hudson and Fiona Bane for their technical expertise Histone H3 lysine 27 trimethylation, a mark of transcrip- and Robert Clarke, Georgetown University, for his kind gift of LY2 cells. tional repression, was found to be SRC-1 dependent at both promoters, where no alteration in the activation mark, Grant Support histone H3 lysine 4 trimethylation was observed. JMJD2C The funding support was provided by Science Foundation Ireland (08-IN1- has previously been shown to demethylate gene body H3K36 B1853) and the Health Research Board of Ireland (HRB/POR/2012/101). This thereby inhibiting transcriptional elongation (19). Here, material is also based upon works supported by the Irish Cancer Society Collaborative Cancer Research Centre grant, CCRC13GAL. JMJD2C was found to demethylate H3K36 in the gene body The costs of publication of this article were defrayed in part by the payment of of CD24. Taken together, these mechanistic studies suggest page charges. This article must therefore be hereby marked advertisement in that SRC-1 achieves transcriptional silencing through a accordance with 18 U.S.C. Section 1734 solely to indicate this fact. combination of histone deacetylation and histone methyla- Received July 29, 2013; revised March 5, 2014; accepted March 6, 2014; tion, which are mediated at least in part through JMJD2C. published OnlineFirst March 19, 2014.

References 1. Onate~ SA, Tsai SY, Tsai MJ, O'Malley BW. Sequence and character- 7. McBryan J, Theissen SM, Byrne C, Hughes E, Cocchiglia S, Sande S, ization of a coactivator for the steroid hormone receptor superfamily. et al. Metastatic progression with resistance to aromatase inhibitors is Science 1995;270:1354–7. driven by the steroid receptor coactivator SRC-1. Cancer Res 2. Myers E, Hill AD, Kelly G, McDermott EW, O'Higgins NJ, Buggy Y, et al. 2012;72:548–59. Associations and Interactions between Ets-1 and Ets-2 and coregu- 8. Xu J, Wu RC, O'Malley BW. Normal and cancer-related functions of the latory proteins, SRC-1, AIB1, and NCoR in breast cancer. Clin Cancer p160 steroid receptor co-activator (SRC) family. Nat Rev Cancer Res 2005;11:2111–22. 2009;9:615–30. 3. Al-azawi D, Ilroy MM, Kelly G, Redmond AM, Bane FT, Cocchiglia S, 9. Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O'Malley BW. Partial et al. Ets-2 and p160 proteins collaborate to regulate c-Myc in endo- hormone resistance in mice with disruption of the steroid receptor crine resistant breast cancer. Oncogene 2008;27:3021–31. coactivator-1 (SRC-1) gene. Science 1998;279:1922–5. 4. McIlroy M, McCartan D, Early S, O Gaora P, Pennington S, Hill AD, et al. 10. Qin L, Liu Z, Chen H, Xu J. The steroid receptor coactivator-1 regulates Interaction of developmental transcription factor HOX11 with steroid twist expression and promotes breast cancer metastasis. Cancer Res receptor coactivator SRC-1 mediates resistance to endocrine therapy 2009;69:3819–27. in breast cancer. Cancer Res 2010;70:1585–94. 11. McCartan D, Bolger JC, Fagan A, Byrne C, Hao Y, Qin L, et al. Global 5. Voight BF, Kudaravalli S, Wen X, Pritchard JK. A map of recent positive characterization of the SRC-1 transcriptome identiﬁes ADAM22 as an selection in the human genome. PLoS Biol 2006;4:e72. ER-independent mediator of endocrine resistant breast cancer. 6. O'Hara J, Vareslija D, McBryan J, Bane F, Tibbitts P, Byrne C, et al. Cancer Res 2012;72:220–9. AIB1:ERalpha transcriptional activity is selectively enhanced in 12. Qin L, Chen X, Wu Y, Feng Z, He T, Wang L, et al. Steroid Receptor AI-resistant breast cancer cells. Clin Cancer Res 2012;18:3305–15. Coactivator-1 upregulates integrin alpha 5 expression to promote

www.aacrjournals.org Cancer Res; 74(9) May 1, 2014 2543

Walsh et al.

breast cancer cell adhesion and migration. Cancer Res 2011;71: 27. Kogel€ D, Reimertz C, Mech P, Poppe M, Fruhwald€ MC, Engemann H, 1742–51. et al. Dlk/ZIP kinase-induced apoptosis in human medulloblastoma 13. Dobrovolna J, Chinenov Y, Kennedy MA, Liu B, Rogatsky I. Gluco- cells: requirement of the mitochondrial apoptosis pathway. Br J Can- corticoid-dependent phosphorylation of the transcriptional coregula- cer 2001;85:1801–8. tor. Mol Cell Biol 2012;32:730–9. 28. Boehrer S, Chow KU, Puccetti E, Ruthardt M, Godzisard S, Krapohl A, 14. Uhlenhaut NH, Barish GD, Yu RT, Downes M, Karunasiri M, Liddle C, et al. Deregulated expression of prostate apoptosis response gene-4 et al. Insights into negative regulation by the glucocorticoid receptor in less differentiated lymphocytes and inverse expressional patterns of from genome-wide profiling of inflammatory cistromes. Mol Cell par-4 and bcl-2 in acute lymphocytic leukemia. Hematol J 2001;2: 2013;49;1–14. 103–7. 15. Bronzert DA, Greene GL, Lippman ME. Selection and characterization 29. BlickT,HugoH,WidodoE,Waltham M, Pinto C, Mani SA, et al. of a breast cancer cell line resistant to the antiestrogen LY 117018. Epithelial mesenchymal transition traits in human breast cancer cell Endocrinology 1985;117:1409–17. lines parallel the CD44(hi/)CD24 (lo/-) stem cell phenotype in human 16. Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL, Fevr T, et al. A breast cancer. J Mammary Gland Biol Neoplasia 2010;15: collection of breast cancer cell lines for the study of functionally distinct 235–52. cancer subtypes. Cancer Cell 2006;6:515–27. 30. Bieberich E, Silva J, Wang G, Krishnamurthy K, Condie BG. Selective 17. Redmond AM, Bane FT, Stafford AT, McIlroy M, Dillon MF, Crotty TB, apoptosis of pluripotent mouse and human stem cells by novel et al. Coassociation of estrogen receptor and p160 proteins predicts ceramide analogues prevents teratoma formation and enriches for resistance to endocrine treatment; SRC-1 is an independent predictor neural precursors in ES cell–derived neural transplants. J Cell Biol of breast cancer recurrence. Clin Cancer Res 2009;15:2098–106. 2004;167:723–34. 18. Dillon MF, Stafford AT, Kelly G, Redmond AM, McIlroy M, Crotty TB, 31. Rogatsky I, Luecke HF, Leitman DC, Yamamoto KR. Alternate surfaces et al. Cyclooxygenase-2 predicts adverse effects of tamoxifen: a of transcriptional coregulator GRIP1 function in different glucocorti- possible mechanism of role for nuclear HER2 in breast cancer patients. coid receptor activation and repression contexts. Proc Natl Acad Sci Endocr Relat Cancer 2008;15:745–53. U S A 2002;99:16701–6. 19. Berry L, Janknecht R. KDM4/JMJD2C histone demethylases: Epige- 32. Rogatsky I, Zarember KA, Yamamoto KR. Factor recruitment and TIF2/ netic regulators in cancer cells. Cancer Res 2013;73:2936–42. GRIP1 corepressor activity at a collagenase-3 response element that 20. Lizcano F, Romero C, Vargas D. Regulation of adipogenesis by nuclear mediates regulation by phorbol esters and hormones. EMBO J receptor PPARg is modulated by the histone demethylase JMJD2C. 2001;20:6071–83. Genet Mol Biol 2011;34:19–24. 33. Berdel B, Nieminen K, Soini Y, Tengstrom€ M, Malinen M, Kosma 21. Mittelstadt ML, Patel RC. AP-1 mediated transcriptional repression of VM, et al. Histone demethylase GASC1–a potential prognostic and matrix metalloproteinase-9 by recruitment of histone deacetylase 1 in predictive marker in invasive breast cancer. BMC Cancer response to interferon b. PLoS One 2012;7:e42152 2012;12:516. 22. Xu L, Zhao Z, Dong A, Soubigou-Taconnat L, Renou JP, Steinmetz A, 34. Luo W, Chang R, Zhong J, Pandey A, Semenza GL. Histone demethy- et al. Di- and tri- but not monomethylation on histone H3 lysine 36 lase JMJD2C is a coactivator for hypoxia-inducible factor 1 that is marks active transcription of genes involved in flowering time regula- required for breast cancer progression. Proc Natl Acad Sci U S A tion and other processes in Arabidopsis thaliana. Mol Cell Biol 2012;109:E3367–76. 2008;4:1348–60. 35. Kashyap V, Ahmad S, Nilsson EM, Helczynski L, Kenna S, Persson 23. Black JC, Van Rechem C, Whetstine JR. Histone lysine methylation JL, et al. The lysine specific demethylase-1 (LSD1/KDM1A) regu- dynamics: establishment, regulation, and biological impact. Mol Cell lates VEGF-A expression in prostate cancer. Mol Oncol 2013;7: 2012;4:491–507. 555–66. 24. Whetstine J, Nottke A, Lan F, Huarte M, Smolikov S, Chen Z, et al. 36. Loh YH, Zhang W, Chen X, George J, Ng HH. Jmjd1a and Jmjd2c Reversal of Histone Lysine Trimethylation by the JMJD2 Family of histone H3 Lys 9 demethylases regulate self-renewal in embryonic Histone Demethylases. Cell 2006;125:467–81. stem cells. Genes Dev 2007;21:2545–57. 25. Thomas S, Harding MA, Smith SC, Overdevest JB, Nitz MD, Frierson 37. Wissmann M, Yin N, Muller€ JM, Greschik H, Fodor BD, Jenuwein T, HF, et al. CD24 is an effector of HIF-1-driven primary tumor growth and et al. Cooperative demethylation by JMJD2C and LSD1 promotes metastasis. Cancer Res 2012;21:5600–12 andogen receptor-dependent gene expression. Nat Cell Biol 2007; 26. Cook J, Krishnan S, Ananth S, Sells SF, Shi Y, Walther MM, et al. 9:347–53. Decreased expression of the pro-apoptotic protein Par-4 in renal cell 38. Shi Y, Whetstine JR. Dynamic regulation of histone lysine methylation carcinoma. Oncogene 1999;18:1205–8. by demethylases. Mol Cell 2007;25:1–14.

2544 Cancer Res; 74(9) May 1, 2014 Cancer Research

Global Gene Repression by the Steroid Receptor Coactivator SRC-1 Promotes Oncogenesis

Claire A. Walsh, Jarlath C. Bolger, Christopher Byrne, et al.

Cancer Res 2014;74:2533-2544. Published OnlineFirst March 19, 2014.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-13-2133

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2014/03/20/0008-5472.CAN-13-2133.DC1

Cited articles This article cites 38 articles, 18 of which you can access for free at: http://cancerres.aacrjournals.org/content/74/9/2533.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/74/9/2533.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/74/9/2533. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.