Gamma-Glutamyltransferase 1 Promotes Clear Cell Renal Cell Carcinoma Initiation and Progression
Total Page：16
File Type：pdf, Size：1020Kb
Author Manuscript Published OnlineFirst on May 31, 2019; DOI: 10.1158/1541-7786.MCR-18-1204 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Gamma-glutamyltransferase 1 promotes clear cell renal cell carcinoma initiation and progression Ankita Bansal1, Danielle J. Sanchez1,2, Vivek Nimgaonkar1, David Sanchez1, Romain Riscal1, Nicolas Skuli1, M. Celeste Simon1,2* 1Abramson Family Cancer Research Institute, 456 BRB II/III, 421 Curie Boulevard, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104-6160, USA 2Department of Cell and Developmental Biology, 456 BRB II/III, 421 Curie Boulevard, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104-6160, USA Running Title: GGT1 in clear cell renal cell carcinoma * Corresponding Author: Dr. M. Celeste Simon, Ph.D. Abramson Family Cancer Research Institute, 456 BRB II/III, 421 Curie Boulevard, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104-6160, USA, Email: [email protected] Phone: 215-746-5532 Keywords: cancer metabolism, kidney cancer, glutathione, GGT1, chemotherapy Financial Support: This work was supported by NIH grant P01CA104838 to M.C.S. Conflicts of Interest Statement: The authors declare that no conflict of interest exists. Word Count: 4872 (excluding references and figure legends) Figures: 6 primary figures, 6 supplemental figures 1 Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 31, 2019; DOI: 10.1158/1541-7786.MCR-18-1204 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Clear cell renal cell carcinoma (ccRCC) is the most common subtype of kidney cancer. While the localized form of this disease can be treated surgically, advanced and metastatic stages are resistant to chemotherapies. Although more innovative treatments, such as targeted or immune-based therapies, exist, the need for new therapeutic options remains. ccRCC present unique metabolic signatures and multiple studies have reported a significant increase in levels of reduced glutathione (GSH) and its precursors in ccRCC tumor samples compared to normal kidney tissues. These observations led us to investigate the effects of blocking the GSH pathway, particularly the gamma-glutamyltransferase 1 (GGT1) enzyme, in multiple ccRCC cell lines. In the present study, we provide in vitro and in vivo evidence that GGT1/GSH pathway inhibition impacts ccRCC cell growth, through increased cell cycle arrest. Of note, GGT1 inhibition also impairs ccRCC cell migration. Finally, pharmacological GSH pathway inhibition decreases ccRCC cell proliferation and increases sensitivity to standard chemotherapy. Our results suggest that GGT1/GSH pathway inhibition represents a new strategy to overcome ccRCC chemoresistance. Implications GGT1/GSH pathway inhibition represents a promising therapeutic strategy to overcome chemoresistance and inhibit progression of ccRCC tumors. 2 Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 31, 2019; DOI: 10.1158/1541-7786.MCR-18-1204 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Introduction Kidney cancer is among the ten most common malignancies in both men and women in the United States, and its incidence has increased rapidly in recent years (1). More than 75% of renal cancer diagnoses present as clear cell renal cell carcinoma (ccRCC), a subtype which carries a poor prognosis due to intrinsic resistance to conventional chemotherapy and radiation (2). Interestingly, ccRCC lacks common genetic abnormalities observed in many other human cancers, including those in the PTEN, TP53 and KRAS signaling pathways (3, 4). More than 90% of ccRCC tumors show constitutive activation of the hypoxia inducible factor (HIF) proteins due to biallelic inactivation of the tumor suppressor von Hippel-Lindau (VHL) gene (4). Histologically, ccRCC is characterized by the “clear-cell” phenotype resulting from lipid and glycogen accumulation, suggesting that altered fatty acid and glucose metabolism play a crucial role in the development of this cancer (5-8). Different treatment options available for ccRCC patients include anti-angiogenic agents, receptor tyrosine kinase inhibitors, mTOR inhibitors, HIF2α antagonists and immunotherapy (9). However, only a subset of patients respond to each of these approaches (~20%) (9-14). Moreover, while localized tumors can be treated by surgical resection, approximately 23% are diagnosed as metastatic disease with a 5-year survival rate of only 10% (2, 7, 14). Therefore, a significant clinical need exists for therapies that will exploit unique vulnerabilities present in all tumors to effectively improve prognosis of more ccRCC patients. Deregulated metabolism to produce sufficient energy and synthetic building blocks for cellular proliferation of tumor cells is a hallmark of cancer (15). Interestingly, ccRCC has often been labelled as a metabolic disease due to reprogramming of several metabolic pathways in this cancer. The Cancer Genome Atlas (TCGA) studies of ccRCC tumors show substantial alterations of metabolic pathways relative to healthy kidney to promote biosynthesis and growth (16). Additionally, worse patient survival correlates with upregulation of the pentose phosphate pathway and fatty acid synthesis, and downregulation of the tricarboxylic acid (TCA) cycle and 3 Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 31, 2019; DOI: 10.1158/1541-7786.MCR-18-1204 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. urea cycle genes (16, 17). However, since this was only based on transcriptomic data, we and others performed comprehensive metabolomic studies comparing tumor tissues and matched normal samples using LC/MS (3, 18). A striking feature of these findings is the 140-fold increase in the levels of reduced glutathione (GSH) in patient tumor samples (3, 18). GSH is a tripeptide generated from glutamic acid, cysteine, and glycine in two successive ATP-dependent enzymatic steps (Figure 1A). In cells, GSH can be found in both reduced (GSH) and oxidized (GSSG) forms, and GSH/GSSG ratios are commonly used as an indicator of oxidative stress (19, 20). Interestingly, elevated GSH levels have also been reported to be a major contributing factor to chemoresistance, a significant therapeutic limitation in ccRCC (21, 22). We report here that ccRCC tumors have significantly increased levels of gamma- glutamyltransferase 1 (GGT1) according to TCGA data. GGT1 is a component of the GSH salvage pathway, catalyzing the cleavage of extracellular GSH into its components to provide cysteine for the production of intracellular GSH (Figure 1A) (23). First, γ-glutamylcysteine is synthesized by a reaction between glutamic acid and cysteine by the enzyme glutamate- cysteine ligase (GCL), forming a γ-peptide bond. The second step is catalyzed by GSH synthetase (GSS), adding glycine to the C-terminus of γ-glutamylcysteine, resulting in the final GSH product. Increased circulating GGT activity is usually an indication of hepatobiliary toxicity, especially cholestasis, and also commonly used to detect liver disease (23-25). Additionally, higher serum GGT levels are associated with poor patient prognosis and survival in ccRCC (26), and recent studies report that GGT1 expression is deregulated in ccRCC patients, leading to a more aggressive phenotype (27, 28). We demonstrate that ccRCC cells are dependent upon the presence of GGT1 for proliferation, migration, and tumor growth. Therefore, modulation of the GSH-based antioxidant system, particularly through GGT1 activity, represents a promising therapeutic strategy to overcome chemoresistance and inhibit progression of ccRCC tumors. 4 Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 31, 2019; DOI: 10.1158/1541-7786.MCR-18-1204 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Materials and Methods Cell Culture Human ccRCC cell lines (786O, UMRC2, RCC10, A498) and control kidney proximal tubular cells (HK2 and RPTEC – renal cortex proximal tubular epithelial cells) were obtained from ATCC. ccRCC cell lines were cultured in DMEM containing 10% FBS. HK2 cells were grown in keratinocyte free media (Fisher Scientific, cat. 17005042) and RPTEC cells were grown in DMEM/F12 media with recommended additives from ATCC. These cells were cultured for a maximum of four weeks after which fresh early passage cells were thawed and used for experiments. Mycoplasma testing is routinely performed on these cell lines (every 6 months) and confirmed to be negative for its presence (MycoAlert). Lentivirus and making GGT1 KD cells lines MCG Human GGT1 Sequence-Verified cDNA (clone ID: 4548861) was purchased from Dharmacon. Forward (gatactctcgagatgaagaagaagttagtggtgc) and reverse (gatactgttaactcagtagccggcaggc) primers containing XhoI and HpaI restriction sites, respectively, were designed to clone the GGT1 open reading frame into retroviral expression plasmid MSCV. A second round