Gamma-Glutamyltransferase 1 Promotes Clear Cell Renal Cell Carcinoma Initiation and Progression

Home , Glutathione synthetase, Potassium in biology

Author Manuscript Published OnlineFirst on May 31, 2019; DOI: 10.1158/1541-7786.MCR-18-1204 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Gamma-glutamyltransferase 1 promotes clear cell renal cell carcinoma initiation and progression

Ankita Bansal1, Danielle J. Sanchez1,2, Vivek Nimgaonkar1, David Sanchez1, Romain Riscal1,

Nicolas Skuli1, M. Celeste Simon1,2*

1Abramson Family Cancer Research Institute, 456 BRB II/III, 421 Curie Boulevard, Perelman

School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104-6160, USA

2Department of Cell and Developmental Biology, 456 BRB II/III, 421 Curie Boulevard, Perelman

School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104-6160, USA

Running Title: GGT1 in clear cell renal cell carcinoma

* Corresponding Author: Dr. M. Celeste Simon, Ph.D.

Abramson Family Cancer Research Institute, 456 BRB II/III, 421 Curie Boulevard, Perelman

School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104-6160, USA,

Email: [email protected]

Phone: 215-746-5532

Keywords: cancer metabolism, kidney cancer, glutathione, GGT1, chemotherapy

Financial Support: This work was supported by NIH grant P01CA104838 to M.C.S.

Conflicts of Interest Statement: The authors declare that no conflict of interest exists.

Word Count: 4872 (excluding references and figure legends)

Figures: 6 primary figures, 6 supplemental figures

Downloaded from mcr.aacrjournals.org on September 25, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 31, 2019; DOI: 10.1158/1541-7786.MCR-18-1204 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract

Clear cell renal cell carcinoma (ccRCC) is the most common subtype of kidney cancer.

While the localized form of this disease can be treated surgically, advanced and metastatic stages are resistant to chemotherapies. Although more innovative treatments, such as targeted or immune-based therapies, exist, the need for new therapeutic options remains. ccRCC present unique metabolic signatures and multiple studies have reported a significant increase in levels of reduced glutathione (GSH) and its precursors in ccRCC tumor samples compared to normal kidney tissues. These observations led us to investigate the effects of blocking the GSH pathway, particularly the gamma-glutamyltransferase 1 (GGT1) enzyme, in multiple ccRCC cell lines. In the present study, we provide in vitro and in vivo evidence that GGT1/GSH pathway inhibition impacts ccRCC cell growth, through increased cell cycle arrest. Of note, GGT1 inhibition also impairs ccRCC cell migration. Finally, pharmacological GSH pathway inhibition decreases ccRCC cell proliferation and increases sensitivity to standard chemotherapy. Our results suggest that GGT1/GSH pathway inhibition represents a new strategy to overcome ccRCC chemoresistance.

Implications

GGT1/GSH pathway inhibition represents a promising therapeutic strategy to overcome chemoresistance and inhibit progression of ccRCC tumors.

Introduction

Kidney cancer is among the ten most common malignancies in both men and women in the United States, and its incidence has increased rapidly in recent years (1). More than 75% of renal cancer diagnoses present as clear cell renal cell carcinoma (ccRCC), a subtype which carries a poor prognosis due to intrinsic resistance to conventional chemotherapy and radiation

(2). Interestingly, ccRCC lacks common genetic abnormalities observed in many other human cancers, including those in the PTEN, TP53 and KRAS signaling pathways (3, 4). More than

90% of ccRCC tumors show constitutive activation of the hypoxia inducible factor (HIF) proteins due to biallelic inactivation of the tumor suppressor von Hippel-Lindau (VHL) gene (4).

Histologically, ccRCC is characterized by the “clear-cell” phenotype resulting from lipid and glycogen accumulation, suggesting that altered fatty acid and glucose metabolism play a crucial role in the development of this cancer (5-8).

Different treatment options available for ccRCC patients include anti-angiogenic agents, receptor tyrosine kinase inhibitors, mTOR inhibitors, HIF2α antagonists and immunotherapy (9).

However, only a subset of patients respond to each of these approaches (~20%) (9-14).

Moreover, while localized tumors can be treated by surgical resection, approximately 23% are diagnosed as metastatic disease with a 5-year survival rate of only 10% (2, 7, 14). Therefore, a significant clinical need exists for therapies that will exploit unique vulnerabilities present in all tumors to effectively improve prognosis of more ccRCC patients.

Deregulated metabolism to produce sufficient energy and synthetic building blocks for cellular proliferation of tumor cells is a hallmark of cancer (15). Interestingly, ccRCC has often been labelled as a metabolic disease due to reprogramming of several metabolic pathways in this cancer. The Cancer Genome Atlas (TCGA) studies of ccRCC tumors show substantial alterations of metabolic pathways relative to healthy kidney to promote biosynthesis and growth

(16). Additionally, worse patient survival correlates with upregulation of the pentose phosphate pathway and fatty acid synthesis, and downregulation of the tricarboxylic acid (TCA) cycle and

urea cycle genes (16, 17). However, since this was only based on transcriptomic data, we and others performed comprehensive metabolomic studies comparing tumor tissues and matched normal samples using LC/MS (3, 18). A striking feature of these findings is the 140-fold increase in the levels of reduced glutathione (GSH) in patient tumor samples (3, 18). GSH is a tripeptide generated from glutamic acid, cysteine, and glycine in two successive ATP-dependent enzymatic steps (Figure 1A). In cells, GSH can be found in both reduced (GSH) and oxidized

(GSSG) forms, and GSH/GSSG ratios are commonly used as an indicator of oxidative stress

(19, 20). Interestingly, elevated GSH levels have also been reported to be a major contributing factor to chemoresistance, a significant therapeutic limitation in ccRCC (21, 22).

We report here that ccRCC tumors have significantly increased levels of gamma- glutamyltransferase 1 (GGT1) according to TCGA data. GGT1 is a component of the GSH salvage pathway, catalyzing the cleavage of extracellular GSH into its components to provide cysteine for the production of intracellular GSH (Figure 1A) (23). First, γ-glutamylcysteine is synthesized by a reaction between glutamic acid and cysteine by the enzyme glutamate- cysteine ligase (GCL), forming a γ-peptide bond. The second step is catalyzed by GSH synthetase (GSS), adding glycine to the C-terminus of γ-glutamylcysteine, resulting in the final

GSH product. Increased circulating GGT activity is usually an indication of hepatobiliary toxicity, especially cholestasis, and also commonly used to detect liver disease (23-25). Additionally, higher serum GGT levels are associated with poor patient prognosis and survival in ccRCC

(26), and recent studies report that GGT1 expression is deregulated in ccRCC patients, leading to a more aggressive phenotype (27, 28). We demonstrate that ccRCC cells are dependent upon the presence of GGT1 for proliferation, migration, and tumor growth. Therefore, modulation of the GSH-based antioxidant system, particularly through GGT1 activity, represents a promising therapeutic strategy to overcome chemoresistance and inhibit progression of ccRCC tumors.

Materials and Methods

Cell Culture

Human ccRCC cell lines (786O, UMRC2, RCC10, A498) and control kidney proximal tubular cells (HK2 and RPTEC – renal cortex proximal tubular epithelial cells) were obtained from ATCC. ccRCC cell lines were cultured in DMEM containing 10% FBS. HK2 cells were grown in keratinocyte free media (Fisher Scientific, cat. 17005042) and RPTEC cells were grown in DMEM/F12 media with recommended additives from ATCC. These cells were cultured for a maximum of four weeks after which fresh early passage cells were thawed and used for experiments. Mycoplasma testing is routinely performed on these cell lines (every 6 months) and confirmed to be negative for its presence (MycoAlert).

Lentivirus and making GGT1 KD cells lines

MCG Human GGT1 Sequence-Verified cDNA (clone ID: 4548861) was purchased from

Dharmacon. Forward (gatactctcgagatgaagaagaagttagtggtgc) and reverse

(gatactgttaactcagtagccggcaggc) primers containing XhoI and HpaI restriction sites, respectively, were designed to clone the GGT1 open reading frame into retroviral expression plasmid MSCV.

A second round of PCR was performed to introduce silent mutations over the shRNA binding region, using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, cat. E0554S).

The knockdown cells lines were made using lentiviruses, generated by transfecting

HEK293RT cells with 3rd generation lentivirus system pRSV-Rev, pMDL, and pCMV-VSV-G plasmids using Fugene6 transfection reagent (Promega). The virus was collected 48 hrs after transfection. For viral transduction, cells were incubated with medium containing virus for 24 hrs and then selected with antibiotics for 3-4 days. The surviving cells were then pooled for downstream analyses. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against shGGT1_1 (clone ID:

TRCN0000036289, sequence TTTCGTGTGGTGCTGTTGTAG) and shGGT1_2

(TRCN0000036293, sequence TTGTAGATGGTGAGGAAGAGG) were obtained from The TRC

(The RNAi Consortium) at the Broad Institute and GE Dharmacon. Fresh knockdown cell lines were made for the different characterization assays.

Metabolomics Analysis

Metabolomics experiments, including mass spectrometry and analysis of primary ccRCC, were performed with Metabolon (Metabolon, Inc.), and as previously described (18).

Western Blot Analysis

Cells were lysed using 40 mM HEPES pH = 7.4, 2 mM EDTA, 10 mM pyrophosphate, 10 mM glycerophosphate, 1% Triton X-100 and Roche complete ultra protease/phosphatase inhibitor (cat. 05892791001). Lysates were then resolved by Tris-Glycine SDS-PAGE and transferred to nitrocellulose membranes (Biorad #162-0115, 0.45 um pore size for all experiments). Membranes were blocked and incubated overnight in a cold room at 4°C with the indicated primary antibodies diluted in TBS-Tween (20 mM Tris, 135 mM NaCl, and 0.02%

Tween 20) supplemented with 5% BSA (Bovine Serum Albumin). Signal was detected using secondary antibodies conjugated with horseradish peroxidase. Membranes were then exposed to ECL reagents. Antibodies used: B-Actin (Santa Cruz sc 4778), GGT1 (Abcam, ab109427). All the western blots were repeated at least twice for each figure.

Quantitative Real-Time PCR (qRT-PCR)

Total RNA was processed and extracted with TRIzol reagent (ThermoFisher Scientific, cat. 15596026) and RNeasy mini kit (Qiagen, cat. 74104). RT (reverse transcription) reaction was performed using HighCapacity RNA-to-cDNA (Applied Biosystems, cat. 4387406). qRT-

PCR were then performed using TaqMan master mix (Life Technologies) and a ViiA7 Real-Time

PCR instrument (Applied Biosystems). TaqMan probes were used to quantitate expression of

GGT1 (cat. hs00980756_m1). Normalization was performed using the housekeeping genes

ACTB (cat. hs01060665_G1) and TBP (hs00427620_m1). The mRNA was measured in triplicates with each experiment repeated twice.

Cell Proliferation Assay

Cell proliferation assays were performed using WST-1 reagent (Sigma Aldrich, cat.

11644807001). ccRCC cells were plated in 96-well plates at 500 cells/well (786O) and 750 cells/well (RCC10), respectively, and allowed to attach overnight (one 96-well plate for each day of the assay). The following day, media was exchanged with 100 uL of complete DMEM or specific media supplemented with drugs used according to each experiment (see figures for exact concentrations used in each experiment). Plated cells were exposed to WST-1 reagent following the manufacturer’s protocols; this was considered Day 0. The assay was repeated every other day till day 7 and data in each experiment were normalized to the starting cell number at day 0 of the assay. Eight different wells were plated for each condition per experiment and each experiment was repeated at least three times.

Cell Survival Assay

Cell death was determined using the FITC–Annexin V, PI Kit (cat. 556547) from BD

Biosciences according to the manufacturer’s instructions. Briefly, 2x105 RCC10 or 786O cells were plated in triplicates in 6 well plates. Twenty four hours after plating, cells were treated for

48hrs with either cisplatin (3 uM for 786O cells, 20 uM for RCC10 cells), OU749 (1 mM) or their combination. Flow cytometry was performed using a BD Accuri C6 or a FACS Calibur flow cytometer, and double-negative cells were considered viable. The concentration of cisplatin was decided based on kill curves for 786O and RCC10 cells. Briefly, 5x104 cells were plated in duplicate in 6-well plates and exposed to increasing concentrations of cisplatin. Concentrations

where less than 50% of the cells were dead (3 uM for 786O cells and 20 uM for RCC10 cells) was chosen to perform the additive experiments.

Matrigel-Based Spheroid Growth Assay

Matrigel was used to generate 3D spheroids as previously described (29). Three thousand cells per well were plated in 96-well “low-adherence” plates along with DMEM supplemented with 10% fetal bovine serum (FBS) and 2.5% Matrigel. Plates were then centrifuged at 1800 rpm to promote spheroid formation. Images were taken using the EVOS FL

Auto Imaging System every two days for two weeks. 24 wells were plated for each condition per experiment and two biological repeats were performed. Spheroid volume was determined via previously published ImageJ macros (30).

Anchorage-Independent Growth Assay

ccRCC cells (Scr and GGT1 KD) were plated in triplicate 6-well plates (6000 cells/well) in complete DMEM containing 0.3% agarose (low-melt 2-hydroxyethylagarose, Sigma Aldrich

A4018), onto underlays composed of DMEM containing 0.6% agarose. Additional media was added to the cultures once per week, and colonies counted after three weeks. This experiment was repeated twice.

Cell Cycle Analysis

Scr and GGT1 KD cells were plated in 6 cm plates in duplicates and harvested at 80% confluency. Cells were then resuspended in 1X PBS and fixed with 70% ethanol, and incubated overnight at 4⁰C. The following day, cells were washed with ice-cold PBS and resuspended in

1ml PBS. They were treated with RNAse (100 ug/ml), stained with PI (20 ug/ml), and then analyzed by flow cytometry using the BD FACSCalibur instrument. For Ki67/PI analysis the cells

were treated with Ki67 (0.25 ug/sample) before staining with PI. This experiment was performed in triplicates and repeated twice.

Migration Assay

Cells were grown to confluency in triplicate in 6-well plates. A scratch was made with a

200 ul tip across each well and pictures taken at the starting timepoint, as well as 24 hrs post- scratch for RCC10 cells and 6 hrs post-scratch for 786O cells. The percentage of area that was

“repaired” was measured using ImageJ software and plotted as the average of the triplicates with standard error. This experiment was repeated three times.

Transwell Assay

Cells were plated on 10 cm dishes and serum starved for 24 hrs. These were then plated on transwells (8 um pore size, 24 well format) at a density of 1x105 cells per well (total of

5 wells were plated for each condition). The upper well was filled with serum-free media and the lower well with complete media (DMEM containing 10% serum). Plates were incubated for 12-

16 hrs and fixed with paraformaldehyde followed by methanol. Cells were then stained with diluted Giemsa stain and mounted on a slide to observe the number of cells migrated through the pores. These were then quantified by eye in 5 different images. The average of these numbers and standard error between the samples was calculated and plotted using Graphpad prism software. The experiment was repeated two times.

Subcutaneous Xenografts

All animal experiments and subcutaneous xenografts were approved by the Institutional

Animal Care and Use Committee (IACUC) at the University of Pennsylvania. Twelve female

NIH-III nude mice between 4 and 6 weeks old (Charles River Laboratories) were implanted in each flank with 2x106 786O cells or 5x106 786O control (Scr) or GGT1 KD cells (shGGT1_2).

Prior to injection, cells were grown in complete media (DMEM containing 10% FBS) in 15 cm dishes. Cells were then collected, and resuspended in ice-cold PBS mixed with Matrigel (BD

Biosciences, cat. 356234) at a ratio 1:1. The final volume per injection was 200 uL. Tumor volumes were assessed recorded at the indicated time points using caliper measurements. The formula, V=(π/6)(L)(W2), was used to calculate the tumor volume. L being the longer measurement and W being the shorter measurement. Twenty-six days post-injection, mice were sacrificed by CO2 inhalation. Tumors were then harvested for further analyses. For the mice bearing 786O xenografts, tumor growth was closely monitored and when tumor volume reached

100 mm3, mice were randomized and divided into four groups showing similar tumor volumes, control, BSO (Sigma, cat. B2515), cisplatin (Tocris, cat. 2251) and BSO + cisplatin (n=5 per group). BSO (20 mM) was administered by oral delivery in drinking water and cisplatin (3 mg/kg/week) administered intraperitoneally. For the BSO + cisplatin group, mice were pre- treated with BSO for 3 days before cisplatin treatment.

Immunohistochemistry

Xenograft tumors were dehydrated using ethanol and embedded in paraffin. Tumors were sectioned for staining and immunohistochemistry (IHC) was performed as previously described (6). The antibodies and dilutions used during the IHC process were: 1:100 Ki67

(Abcam, cat. Ab15580), and 1:400 Cleaved Caspase 3 (Cell Signaling Technology, cat. 9661).

Glutathione measurement assay

For Figure S2, glutathione ratios were measured using a Promega Kit (V611). Briefly, cells were plated at an equal density in a 96-well plate in duplicates. Total Glutathione Lysis

Reagent was added to one set for the total glutathione measurement, or Oxidized Glutathione

Lysis Reagent for the GSSG measurement. Luciferin Generation Reagent was then added to all the wells and incubated for 30 minutes. Luminescence was measured after adding Luciferin

Detection Reagent and a 15-minute incubation. GSH/GSSG ratios are calculated directly from luminescence measurements. For measuring GSH levels in the tumors, cells were lysed in PBS lysis buffer containing trichloroacetic acid (TCA). After neutralizing TCA, samples were processed according to manufacturer’s instructions (Biovision K264). Each sample was treated with OPA (O-phthaldehye) probe and fluorescence measured at an Ex/Em = 340/420 nm. GSH concentrations were measured according to GSH standards. Each of these assays was repeated twice.

For Figure S5, a different Biovision Kit (K264) was used. Briefly, tissue was homogenized on ice with 100 ul of ice cold Glutathione Assay Buffer. These samples were treated with perchloric acid (PCA) to precipitate proteins. PCA was then neutralized by potassium hydroxide (KOH) and GSH or GSSG levels measured according to the manufacturer’s instructions, using an OPA Probe. Samples were read on a fluorescence plate reader equipped with Ex/Em = 340/420 nm, and values plotted and calculated based on normalization to tumor weights priot to homogenization.

Statistics

Statistical analyses were performed using GraphPad Prism version 7 software, using unpaired Student’s two-tailed t-test. Data are presented as mean ± SEM of at least three independent experiments. Statistical significance was defined as *** (p < 0.001), ** (p < 0.01), *

(p < 0.05), n.s. = not significant.

Results

Glutathione and its intermediates are significantly enriched in ccRCC tumors relative to healthy kidney tissue

Metabolomic analysis of ccRCC tumors vs normal patient samples from two independently published datasets revealed that reduced glutathione (GSH) is among the most

overrepresented metabolites (Figure 1B, 1C) in ccRCC, along with increased precursors like cysteine, γ-glutamylcysteine, and γ-glutamylglutamate (Figure 1D). Moreover, GSH is further elevated in patients with advanced stages of the disease (Figure 1E, 1F), suggesting that GSH is important for tumor progression in ccRCC patients. RNA-seq data from nearly 500 primary ccRCC tumors in TCGA demonstrated that amongst all the enzymes required for the synthesis and utilization of GSH, GGT1 is significantly upregulated in tumor samples as compared to normal kidney controls (Figure 2A). mRNA levels of other biosynthetic enzymes, such as glutamyl cysteine ligase catalytic subunit (GCLC), glutathione synthetase (GSS), and glutathione disulfide reductase (GSR) are either downregulated or not significantly altered between ccRCC and healthy kidney tissue (Figure S1A, S1B). Additionally, data from the

Cancer Cell Line Encyclopedia indicate that GGT1 expression is highest in human cell lines originating from kidney tumors (Figure S1C).

GGT1 inhibition reduces proliferation and induces cell cycle arrest of ccRCC cells in vitro

GGT1 is an enzyme localized and bound to the plasma membrane, which catalyzes the degradation of extracellular GSH. This favors the production of constituent amino acids for the synthesis of intracellular GSH. GGT1 also has the ability to catalyze the transfer of the glutamyl moiety of GSH, linked through the glutamate γ- carboxylic acid to acceptor molecules including amino acids and peptides (Figure 1A). Moreover, GGT1 inhibition results in reduced intracellular cysteine, making GGT1 enzymatic action important for the maintenance of intracellular GSH (31, 32). To determine the functions of GGT1 in ccRCC, we used two different shRNAs with varied efficacy (shGGT1_1 and shGGT1_2) to knockdown (KD) GGT1 in 786O and RCC10 ccRCC cells and confirmed decreased protein abundance by Western blot (Figure

2B). These lines had the highest GGT1 levels among the ccRCC cell lines examined relative to

HK2 immortalized renal epithelial cells (Figure S2A, S2B), and were subsequently used for most experiments in this paper. Other ccRCC cell lines (i.e. UMRC2 and A498) showed weak or

no expression of GGT1, which does not reflect the status of GGT1 expression in kidney tumors.

Glutathione levels also correlated with efficacy of GGT1 knockdown in 786O and RCC10 cells

(Figure S2C). Reduced GGT1 levels inhibited proliferation rates in a dose-dependent manner of both cell lines in vitro, dependent upon the efficiency of knockdown (Figure 2C, 2D). This phenotype was partially rescued by adding extracellular GSH to the media (Figure S3A), and by overexpression of shRNA resistant GGT1 protein in both 786O and RCC10 cells harboring shGGT1-2 (Figure S3B, S3C), confirming that proliferation defects are indeed due to reduced

GGT1 enzymatic activity. We then embedded the control (Scr) and GGT1 KD cell lines in

Matrigel, to form 3D spheroids in vitro and monitored proliferation over time. Spheroid (Figure

2E, 2F, S2D) and anchorage independent growth (Figure 2G) were significantly decreased in cells with reduced GGT1 expression compared to controls.

To better characterize proliferation defects observed following GGT1 depletion, we performed flow cytometry-based cell cycle analysis of 786O and RCC10 cells. A significant increase was observed in the mean percentage of cells arrested in the G1 phase of the cell cycle following GGT1 loss compared to controls (Figure 2H, Figure S4A-C). Furthermore, when stained for Ki67 and propidium iodide (PI), ~15% of the shGGT1_2 cell population was

Ki67 negative, indicating that they were non-proliferative and arrested in the G0 phase (Figure

2I, Figure S4C). Collectively, these data indicate that reduced GGT1 expression has an anti- proliferative effect by imposing cell cycle arrest of ccRCC cells.

GGT1 loss affects migration capacity of ccRCC cells in vitro

Since it has also been reported that GSH levels correlate with tumor stage and recurrence of the disease (3), we determined if GGT1 ablation affected the migration capacity of ccRCC cells in vitro. We plated 786O and RCC10 cells at a confluent level and then performed scratch assays to assess migration capacities over the course of 6 and 24 hrs, respectively. We observed a significant difference in the percentage of wound healing between control and GGT1

deficient cells for both ccRCC lines (Figure 3A, 3B). Consistent with the wound healing results, a transwell assay also showed that GGT1 depletion significantly reduces cell motility (Figure

3C). We concluded that ccRCC cells are dependent on the presence of GGT1 for both proliferation and migration.

GGT1 is required to maintain ccRCC xenograft growth

To assess GGT1 function in ccRCC tumor growth in vivo, we implanted 786O control and GGT1 KD cells subcutaneously into opposing flanks of NIH-III nude mice. Tumor volumes were recorded (Figure 4A) over the course of the experiment. Tumor weights were also determined at day 26 post-injection (Figure 4B). We noticed a marked difference in the growth of GGT1 KD tumors relative to controls. Quantitation revealed a significant difference in Ki67 staining between control and GGT1 KD tumors, suggesting that GGT1 is required for ccRCC proliferation in vivo (Figure 4C, 4D). Cleaved Caspase 3 staining also showed increased rates of cell death, but did not achieve statistical significance (Figure 4E). As expected, GSH/GSSG ratios were reduced in GGT1 KD tumors compared to controls (Figure S5A). We concluded that

GGT1 inhibition results in significant reduction in ccRCC cell proliferation in vivo.

Pharmacological GSH pathway inhibition decreases ccRCC cell proliferation and increases sensitivity to chemotherapy

Recent studies showed that pharmacological inhibition of GSH synthesis, using the irreversible GCL inhibitor L-buthionine—S,R- sulfoximine (BSO), delays tumor growth in vivo in ccRCC (27, 28). Treating four different ccRCC cell lines with BSO in vitro, we confirmed that GSH pathway inhibition decreases ccRCC proliferation in a dose-dependent manner

(Figure 5A). BSO treatment and decreased proliferation were also accompanied by a reduction of total intracellular GSH levels (Figure S6A, S6B).

Apart from its role in aiding cell proliferation and migration, GGT1-overexpressing cells

have been reported to be more resistant to chemotherapeutics, correlating with worse survival rates in several other cancer types (25, 33). Interestingly, cisplatin forms adducts with cysteinyl glycine, a biproduct of GGT1 activity, more rapidly than with GSH (23, 24). This suggests that increased GGT1 activity is responsible for chemotherapeutic resistance along with increased metastatic capacity and proliferation of ccRCC. We therefore tested the combination of GGT1 inhibition and cisplatin treatment in 786O and RCC10 cells, and determined that cells with reduced GSH due to GGT1 depletion exhibit enhanced sensitivity to cisplatin, particularly those with more efficient GGT1 knockdown (shGGT1_2). This could be attributed to the levels of GSH reduction achieved by each knockdown and indicates that only cells with very low GSH levels respond to chemotherapeutics (Figure 5B). Furthermore, a pharmacological GGT1 inhibitor

(OU749) combined with cisplatin further induced additional cell death relative to either drug used independently (Figure 5C).

Finally, and most importantly, we compared the efficacy of BSO (20 uM) and cisplatin

(CIS – 3 mg/kg/week) combination versus cisplatin or BSO used as single agents in vivo using

786O subcutaneous xenografts (Figure 6). As predicted, BSO and cisplatin alone significantly decreased tumor growth compared to vehicle-treated animals (Figure 6A). For the BSO - CIS combination, we noticed a trend to slower tumor growth compared to BSO as a single agent.

However, tumor weights measured at the experimental endpoint demonstrated that BSO and cisplatin when combined was more potent than either agent alone (Figure 6B). Although not statistically significant, mice treated with the BSO - CIS combination exhibited a trend to inferior tumor weight compared to each on its own. Of note, cisplatin and BSO - CIS treatments showed significant toxicity and mice experienced weight loss (Figure 6C), necessitating the experiment to be terminated 3 weeks after treatments began. Taken together, these experiments show that ccRCC cells are dependent upon GGT1 for their proliferation, migration and drug resistance.

We therefore propose that pharmacological inhibition of the GGT1/GSH pathway could synergize with chemotherapeutics for the treatment of all stages of ccRCC tumors.

Discussion

Delineating tumor metabolism for specific cancers is important to establish their unique signatures of biosynthetic and energy demands. These studies can specifically aid the development of interventions targeted towards a particular malignancy. Moreover, understanding metabolic reprogramming can also provide functional imaging opportunities based on the altered pathways (34). Most forms of kidney cancer show changes in oxygen sensing, the tricarboxylic acid cycle, urea cycle, and metabolism of fatty acids, glucose and glutamine (3, 7, 8, 17). ccRCC can be a particularly aggressive form of cancer that arises from the proximal tubular epithelium (35) and is associated with high mortality rates in its metastatic form. In the present study, we analyzed different metabolic changes and found a significant increase in the levels of reduced glutathione (GSH), and its precursors like cysteine, glutamine and dipeptides in tumor samples as compared to respective normal adjacent tissues. Moreover, both high-GSH and high-dipeptide levels were identified as aggressive metabolic signatures in ccRCC (3). These observations led us to hypothesize that the GSH pathway is essential for ccRCC progression. Interestingly, chromophobe renal cell carcinoma (ChRCC), which accounts for 5% of all renal tumors, exhibits significantly lower GGT1 levels than normal kidney (28).

Nevertheless, GGT1 inhibition also enhances ChRCC cell sensitivity to oxidative stress, as well as in normal kidney cells (28). Differences between ChRCC and ccRCC tumors, where ccRCCs instead express increased GGT1 levels relative to healthy tissue, are likely due to their genetic, transcriptional, and metabolic disparities. In contrast to ccRCCs, ChRCCs have little or no changes in glycolysis and pentose phosphate intermediates relative to normal kidney (28).

Therefore, ChRCC dependence on GSH salvage pathways might be somewhat different mechanistically from that demonstrated for other human malignancies. In aggregate, increasing evidence indicates that targeting GGT1-dependent GSH conservation represents an appealing

area of future investigation.

GGT1 is a transpeptidase whose activity increases the availability of amino acids, primarily cysteine, for intracellular GSH synthesis. GGT1 also plays a critical role in maintaining

GSH homeostasis and defense against oxidative stress (23, 25). In liver and obstructive biliary diseases, circulating GGT1 activity has widely been used for diagnosis purposes, as well as an indicator of alcohol consumption (23). In ccRCC, circulating GGT1 has been associated with poor patient prognosis (26). Epidemiological studies also suggest an association of increased GGT1 activity with a plethora of cardio-metabolic risk factors, including traditional cardiovascular risk factors, metabolic syndrome, systemic inflammation, oxidative stress and associated mortality in patients (25). Furthermore, high GGT1 levels correlate with poor patient survival in those suffering from lung, prostate, and ovarian cancers (24, 26, 33).

Taking advantage of both The Cancer Genome Atlas (TCGA) and the Cancer Cell Line

Encyclopedia (CCLE) datasets, we highlight the role of GGT1 and the GSH pathway in regulating proliferation, migration and therapeutic sensitivity of ccRCC cells. More specifically,

GGT1 mRNA is overexpressed in ccRCC tumors and cell lines compared to normal kidney tissue and other cancer cell lines. Indeed, GGT1 depletion induces a significant decrease in ccRCC cell growth and colony forming properties. To further characterize these effects on ccRCC, we assessed apoptotic cell death via Annexin V-PI staining, yet did not observe any significant difference between control and GGT1 KD cells in vitro (data not shown) or in vivo

(Figure 4). However, we cannot exclude other forms of cell death, as inhibition of cystine uptake and GSH depletion have already been described to result in ccRCC cell death through ferroptotic processes (27, 36). Interestingly, Miess, et al. recently suggested that ccRCC cells are highly dependent upon GSH synthesis to prevent lipid peroxidation and ferroptotic cell death

(27). We found that all cells tested are sensitive to reduced GSH levels irrespective of their

GGT1 levels. Therefore, besides GGT1, other factors regulate the production and utilization of

GSH in ccRCC cells. Moreover, GGT1 inhibition only slightly impacts GSH/GSSG ratios, an

indicator of oxidative stress in cells, especially for cells treated with shGGT1. We conclude that

GGT1 likely exhibits additional functions, other than those involved in redox balance. GGT1 promotes the use of extracellular GSH and γ-glutamyl peptides as a source of cysteine, which can then be incorporated into proteins (37, 38). Cysteine and GSH metabolism crosstalk are also essential to control amino acid and mTORC1 signaling pathways and ferroptosis in mouse embryonic fibroblasts and HepG2 cells (39, 40). Although more work is required to determine how cysteine and GSH metabolism are interconnected, we hypothesize that GGT1 provides a proliferative advantage to ccRCC cells through the regulation of cysteine metabolism, independent of GSH antioxidant functions.

In addition to the known effects on cell death induced by GSH depletion, we investigated the cell cycle as another potential explanation for decreased growth following GGT1 loss, and demonstrated that GGT1 inhibition results in increased numbers of Ki67-negative ccRCC cells.

These in vitro observations correlate with our findings in vivo, where GGT1 deficiency significantly decreases the number of Ki67-positive cells, resulting in impaired tumor growth.

Metastatic ccRCC are aggressive tumors, and patient survival rates are extremely low.

Hence, inhibiting the invasive capacities of this tumor type is particularly important. Here, we report that GGT1 inhibition significantly decreases ccRCC cell migration, suggesting that GGT1 could be of therapeutic interest for advanced-stage patients. Most importantly, GGT1/GSH pathway inhibition enhances the efficacy of standard chemotherapeutic agents such as cisplatin. Inhibition of GSH production through BSO treatment has already been reported to improve the cytotoxicity of mTORC1 inhibitors (41). Additionally, ovarian cancer cells overexpressing GGT1 are more resistant to chemotherapies, particularly cisplatin (42), and 5- fluorouracil (43). In line with these data, we show that GGT1 depletion or pharmacological inhibition can improve the sensitivity of ccRCC cells to chemotherapeutics, and the development of a potent inhibitor of GGT1 represents a new therapeutic strategy. Overall, our findings support the potential of altering the levels of GSH, specifically by GGT1 inhibition, as a

promising new treatment for ccRCC.

Acknowledgements

We thank the Simon laboratory for helpful comments and suggestions. This work was supported by NIH grants F31CA206381 (to D.J.S.) and P01CA104838 (to M.C.S.).

Authors’ Contributions

A.B. and M.C.S. designed the study. A.B., D.J.S., V.N., D.S., R.R. and N.S. performed experiments and analyzed data. A.B., D.J.S., N.S. and M.C.S. wrote the manuscript.

References

1. King SC, Pollack LA, Li J, King JB, Master VA. Continued increase in incidence of renal cell carcinoma, especially in young patients and high grade disease: United States 2001 to 2010. The Journal of urology. 2014;191(6):1665-70. 2. Cheville JC, Lohse CM, Zincke H, Weaver AL, Blute ML. Comparisons of outcome and prognostic features among histologic subtypes of renal cell carcinoma. The American journal of surgical pathology. 2003;27(5):612-24. 3. Hakimi AA, Reznik E, Lee C-H, Creighton CJ, Brannon AR, Luna A, et al. An integrated metabolic atlas of clear cell renal cell carcinoma. Cancer cell. 2016;29(1):104-16. 4. Ricketts CJ, Crooks DR, Linehan WM. Targeting HIF2α in Clear-Cell Renal Cell Carcinoma. Cancer cell. 2016;30(4):515-7. 5. Sanchez DJ, Steger DJ, Skuli N, Bansal A, Simon MC. PPARγ is dispensable for clear cell renal cell carcinoma progression. Molecular metabolism. 2018. 6. Qiu B, Ackerman D, Sanchez DJ, Li B, Ochocki JD, Grazioli A, et al. HIF2α-dependent lipid storage promotes endoplasmic reticulum homeostasis in clear-cell renal cell carcinoma. Cancer discovery. 2015;5(6):652-67. 7. Sanchez DJ, Simon MC. Genetic and metabolic hallmarks of clear cell renal cell carcinoma. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer. 2018. 8. Ackerman D, Tumanov S, Qiu B, Michalopoulou E, Spata M, Azzam A, et al. Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation. Cell reports. 2018;24(10):2596-605. e5. 9. Makhov P, Joshi S, Ghatalia P, Kutikov A, Uzzo RG, Kolenko VM. Resistance to Systemic Therapies in Clear Cell Renal Cell Carcinoma: Mechanisms and Management Strategies. Molecular cancer therapeutics. 2018;17(7):1355-64. 10. Ricketts CJ, Linehan WM. Insights into Epigenetic Remodeling in VHL-Deficient Clear Cell Renal Cell Carcinoma. Cancer discovery. 2017;7(11):1221-3. 11. Buvall L, Hedman H, Khramova A, Najar D, Bergwall L, Ebefors K, et al. Orellanine specifically targets renal clear cell carcinoma. Oncotarget. 2017;8(53):91085. 12. Weiss RH, editor Metabolomics and Metabolic Reprogramming in Kidney Cancer. Seminars in nephrology; 2018: Elsevier. 13. Piva F, Santoni M, Matrana MR, Satti S, Giulietti M, Occhipinti G, et al. BAP1, PBRM1 and SETD2 in clear-cell renal cell carcinoma: molecular diagnostics and possible targets for personalized therapies. Expert review of molecular diagnostics. 2015;15(9):1201-10. 14. Rini BI, Campbell SC, Escudier B. Renal cell carcinoma. The Lancet. 2009;373(9669):1119-32. 15. Pavlova NN, Thompson CB. The emerging hallmarks of cancer metabolism. Cell metabolism. 2016;23(1):27-47. 16. Network CGAR. Comprehensive molecular characterization of clear cell renal cell carcinoma. Nature. 2013;499(7456):43. 17. Ochocki JD, Khare S, Hess M, Ackerman D, Qiu B, Daisak JI, et al. Arginase 2 Suppresses Renal Carcinoma Progression via Biosynthetic Cofactor Pyridoxal Phosphate Depletion and Increased Polyamine Toxicity. Cell metabolism. 2018;27(6):1263-80. e6.

18. Li B, Qiu B, Lee DS, Walton ZE, Ochocki JD, Mathew LK, et al. Fructose-1, 6- bisphosphatase opposes renal carcinoma progression. Nature. 2014;513(7517):251. 19. Giustarini D, Galvagni F, Tesei A, Farolfi A, Zanoni M, Pignatta S, et al. Glutathione, glutathione disulfide, and S-glutathionylated proteins in cell cultures. Free Radical Biology and Medicine. 2015;89:972-81. 20. Aboud OA, Habib SL, Trott J, Stewart B, Liang S, Chaudhari AJ, et al. Glutamine addiction in kidney cancer suppresses oxidative stress and can be exploited for real-time imaging. Cancer research. 2017;77(23):6746-58. 21. Harris IS, Treloar AE, Inoue S, Sasaki M, Gorrini C, Lee KC, et al. Glutathione and thioredoxin antioxidant pathways synergize to drive cancer initiation and progression. Cancer cell. 2015;27(2):211-22. 22. Forman HJ, Zhang H, Rinna A. Glutathione: overview of its protective roles, measurement, and biosynthesis. Molecular aspects of medicine. 2009;30(1-2):1-12. 23. Grimm C, Hofstetter G, Aust S, Mutz-Dehbalaie I, Bruch M, Heinze G, et al. Association of gamma-glutamyltransferase with severity of disease at diagnosis and prognosis of ovarian cancer. British journal of cancer. 2013;109(3):610. 24. Pompella A, Corti A, Paolicchi A, Giommarelli C, Zunino F. γ-Glutamyltransferase, redox regulation and cancer drug resistance. Current opinion in pharmacology. 2007;7(4):360-6. 25. Zhang H, Forman HJ, Choi J. γ‐Glutamyl transpeptidase in glutathione biosynthesis. Methods in enzymology. 2005;401:468-83. 26. Hofbauer S, Stangl K, De Martino M, Lucca I, Haitel A, Shariat S, et al. Pretherapeutic gamma-glutamyltransferase is an independent prognostic factor for patients with renal cell carcinoma. British journal of cancer. 2014;111(8):1526. 27. Miess H, Dankworth B, Gouw AM, Rosenfeldt M, Schmitz W, Jiang M, et al. The glutathione redox system is essential to prevent ferroptosis caused by impaired lipid metabolism in clear cell renal cell carcinoma. Oncogene. 2018:1. 28. Priolo C, Khabibullin D, Reznik E, Filippakis H, Ogórek B, Kavanagh TR, et al. Impairment of gamma-glutamyl transferase 1 activity in the metabolic pathogenesis of chromophobe renal cell carcinoma. Proceedings of the National Academy of Sciences. 2018:201710849. 29. Vinci M, Gowan S, Boxall F, Patterson L, Zimmermann M, Lomas C, et al. Advances in establishment and analysis of three-dimensional tumor spheroid-based functional assays for target validation and drug evaluation. BMC biology. 2012;10(1):29. 30. Ivanov DP, Parker TL, Walker DA, Alexander C, Ashford MB, Gellert PR, et al. Multiplexing spheroid volume, resazurin and acid phosphatase viability assays for high- throughput screening of tumour spheroids and stem cell neurospheres. PloS one. 2014;9(8):e103817. 31. Ruoso P, Hedley D. Inhibition of γ-glutamyl transpeptidase activity decreases intracellular cysteine levels in cervical carcinoma. Cancer chemotherapy and pharmacology. 2004;54(1):49-56. 32. Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, et al. Regulation of ferroptotic cancer cell death by GPX4. Cell. 2014;156(1-2):317-31. 33. Kawakami K, Fujita Y, Matsuda Y, Arai T, Horie K, Kameyama K, et al. Gamma- glutamyltransferase activity in exosomes as a potential marker for prostate cancer. BMC cancer. 2017;17(1):316. 34. Ganji SK, An Z, Tiwari V, McNeil S, Pinho MC, Pan E, et al. In vivo detection of 2‐ hydroxyglutarate in brain tumors by optimized point‐resolved spectroscopy (PRESS) at 7T. Magnetic resonance in medicine. 2017;77(3):936-44. 35. Young MD, Mitchell TJ, Braga FAV, Tran MG, Stewart BJ, Ferdinand JR, et al. Single- cell transcriptomes from human kidneys reveal the cellular identity of renal tumors. Science. 2018;361(6402):594-9.

36. Tang X, Wu J, Ding C-K, Lu M, Keenan MM, Lin C-C, et al. Cystine deprivation triggers programmed necrosis in VHL-deficient renal cell carcinomas. Cancer research. 2016:canres. 2328.015. 37. Hanigan MH, Ricketts WA. Extracellular glutathione is a source of cysteine for cells that express. gamma.-glutamyl transpeptidase. Biochemistry. 1993;32(24):6302-6. 38. Alkhuder K, Meibom KL, Dubail I, Dupuis M, Charbit A. Glutathione provides a source of cysteine essential for intracellular multiplication of Francisella tularensis. PLoS pathogens. 2009;5(1):e1000284. 39. Yu X, Long YC. Crosstalk between cystine and glutathione is critical for the regulation of amino acid signaling pathways and ferroptosis. Scientific reports. 2016;6:30033. 40. Gao M, Monian P, Quadri N, Ramasamy R, Jiang X. Glutaminolysis and transferrin regulate ferroptosis. Molecular cell. 2015;59(2):298-308. 41. Li J, Shin S, Sun Y, Yoon S-O, Li C, Zhang E, et al. mTORC1-driven tumor cells are highly sensitive to therapeutic targeting by antagonists of oxidative stress. Cancer research. 2016:canres. 2629.015. 42. Godwin AK, Meister A, O'Dwyer PJ, Huang CS, Hamilton TC, Anderson ME. High resistance to cisplatin in human ovarian cancer cell lines is associated with marked increase of glutathione synthesis. Proceedings of the National Academy of Sciences. 1992;89(7):3070-4. 43. Lewis AD, Hayes JD, Wolf CR. Glutathione and glutathione-dependent enzymes in ovarian adenocarcinoma cell lines derived from a patient before and after the onset of drug resistance: intrinsic differences and cell cycle effects. Carcinogenesis. 1988;9(7):1283-7.

Figure Legends

Figure 1: Glutathione and its intermediates are significantly increased in ccRCC tumors relative to healthy kidney tissue

A. Schematic depicting the enzymes involved in de novo biosynthesis of GSH. GGT:

gamma-glutamyltransferase 1; GCL: glutamate-cysteine ligase; GSS: glutathione

synthetase; GPx: glutathione peroxidase; xCT: cysteine transporter; BSO: buthionine

sulfoximine; OU749: GGT1 inhibitor.

B. Metabolite data (tumor vs. normal) from Hakimi, et al. (3) were analyzed and plotted.

Glutathione is among the most overrepresented metabolites.

C. Metabolite data (tumor vs. normal) from Li, et al. (18) were analyzed and plotted.

Glutathione is among the most overrepresented metabolites.

D. Fold change of intermediate metabolites in GSH synthesis in ccRCC relative to

adjacent normal kidney tissue samples, indicating that most of the intermediate

metabolites are increased relative to normal tissue.

E. GSH abundance in patients stratified according to cancer stage from Hakimi, et al.

(3) dataset.

F. GSH abundance in patients stratified according to cancer stage from Li, et al. (18)

dataset.

Figure 2: GGT1 inhibition reduces proliferation and induces cell cycle arrest of ccRCC cells in vitro

A. GGT1 mRNA expression in normal kidney tissue and ccRCC tumors, based on The

Cancer Genome Atlas (TCGA) dataset. GGT1 is significantly upregulated in the

tumor samples.

B. GGT1 protein abundance in 786O and RCC10 ccRCC cell lines following knockdown

using two independent shRNAs (shGGT1_1 and shGGT1_2).

C. Growth curve of 786O cells, measuring proliferation rates of control (Scr) and GGT1

KD populations. Proliferation was measured by WST-1 assay as described in the

methods section.

D. Growth curve of RCC10 cells, measuring proliferation rate of control (Scr) and GGT1

KD populations. Proliferation was measured by WST-1 assay as described in the

methods section.

E. In vitro Matrigel spheroid growth of control (Scr) and GGT1 KD 786O cells. Pictures

were taken using EVOS FL microscope at the indicated timepoints and volume was

calculated using ImageJ software and plotted. All volumes were normalized to the

day 1 spheroid size, then plotted as arbitrary units (A.U).

F. In vitro Matrigel spheroid growth of control (Scr) and GGT1 KD RCC10 cells.

Pictures were taken using EVOS FL microscope at the indicated timepoints and

volume was calculated using ImageJ software and plotted. All volumes were

normalized to the day 1 spheroid size, then plotted as arbitrary units (A.U).

G. Anchorage independent growth capacity of the ccRCC cells was measured by soft

agar colony formation assay.

H. Cell cycle analysis using propidium iodide (PI) staining of control (Scr) and GGT1 KD

786O cells was measured by flow cytometry. Data are represented as percentage of

cells in G1/G0 phase.

I. Percentage of control (Scr) and GGT1 KD 786O cells Ki67-negative and PI-positive

measured by flow cytometry.

Figure 3: GGT1 knockdown reduces migration capacity of ccRCC cells in vitro

A. Representative images of wound healing 24 hrs following scratch of control (Scr) and

GGT1 KD RCC10 cells.

B. Quantification of the percentage of wound recovery of control (Scr) and GGT1 KD

RCC10 and 786O cells (n=3 wells repeated twice).

C. Quantification of the number of control (Scr) and GGT1 KD RCC10 and 786O cells

migrated through barriers in transwell migration assays 14 hrs following response to

attractant. Two independent experiments were carried out in five different wells. Data

depicted here are representative of one experiment plotted as mean ± SE per group.

Figure 4: GGT1 is required to maintain ccRCC xenograft growth in vivo

A. Tumor volume measurements for 786O control (Scr) and GGT1 KD subcutaneous

xenografts at indicated timepoints.

B. Tumor weights of 786O control (Scr) and GGT1 KD subcutaneous xenografts at day

26 post-injection.

C. Representative images of hematoxylin and eosin (H&E), Ki67, and cleaved Caspase

3 immunohistochemistry from 786O control (Scr) and GGT1 KD xenograft tumors.

Arrows indicate positive staining. Scale bar = 100 um.

D. Quantification of Ki67-positive cells per high-power field (HPF) in control (Scr) and

GGT1 KD tumors.

E. Quantification of cleaved Caspase 3-positive cells per high-power field (HPF) in

control (Scr) and GGT1 KD tumors.

Figure 5: Pharmacological GSH pathway inhibition decreases ccRCC cell proliferation and increases sensitivity to chemotherapy

A. Growth curves of ccRCC cell lines (786O, RCC10, A498, and UMRC2) following

increasing doses of BSO treatment in vitro.

B. Percent of viable cells in 786O and RCC10 control (Scr) and GGT1 KD cells alone,

or in combination with cisplatin treatment, measured by Annexin V/PI staining.

C. Percent of viable cells in 786O and RCC10 cells after treatment with OU749 alone,

or in combination with cisplatin, measured by Annexin V/PI staining.

Figure 6: Pharmacological GSH pathway inhibition impairs ccRCC cell growth in vivo

A. Tumor volume measurements for 786O cell subcutaneous xenografts at indicated

time points. When tumor volume reached 100 mm3, mice were treated with BSO

(BSO – 20 mM in drinking water), cisplatin (CIS – 3 mg/kg/week) or a combination of

BSO (20 mM in drinking water) and cisplatin (3 mg/kg/week).

B. Tumor weights of 786O cell subcutaneous xenografts at day 41 post-injection.

C. Average mouse body weight throughout the time course of the experiment.

Gamma-glutamyltransferase 1 promotes clear cell renal cell carcinoma initiation and progression

Ankita Bansal, Danielle J. Sanchez, Vivek Nimgaonkar, et al.

Mol Cancer Res Published OnlineFirst May 31, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-18-1204

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2019/05/31/1541-7786.MCR-18-1204.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/early/2019/05/31/1541-7786.MCR-18-1204. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.