DOCSLIB.ORG

PCR Detection of Bacillus and Staphylococcus in Various Foods

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PCR Detection of Bacillus and Staphylococcus in Various Foods 1271 Journalof Food Protection, Vol. 67, No. 6, 2004, Pages 1271– 1277 Copyright q,International Association forFood Protection Research Note PCR Detection of Bacillus and Staphylococcus inV ariousFoods SHIGERU NAKANO, * TORU KOBAYASHI, KENICHI FUNABIKI, ATSUSHI MATSUMURA, YASUHIRO NAGAO, AND TOSHIHIRO YAMADA FoodSafety Research Institute,Nissin Food Products Co. Ltd., 2247, Noji-cho, Kusatsu, Shiga 525-0055, Japan MS03-403: Received 10September 2003/ Accepted 25January 2004 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/6/1271/1677289/0362-028x-67_6_1271.pdf by guest on 01 October 2021 ABSTRACT Abroad-rangePCR assayfor the detection of bacteria belonging to Bacillus and Staphylococcus generawas developed. Primerstargeting the bacterial 16S rRNA genewere newly designed and used in a PCR assay.T odeterminethe speci city ofthe assay, 81 different bacterial strains (of 50 genera), 2 fungi,3 animals,and 4 plantswere tested. Results were positive forevery tested Bacillus,Staphylococcus, or Aerococcus strain.In addition, the result for Listeriagrayi waspositive with lowerPCR product.For all other bacterial strains and eukaryotes tested, results were negative. Bacterial DNA wasprepared withthe use of achromopeptidase and Chelex 100 resin from culture after growth in brain heart infusion medium. T otestthe sensitivityof this PCR assayfor Bacillus or Staphylococcus genus,either Bacilluscereus or Staphylococcusaureus was inoculatedinto various foods with undetectable levels of endogenous microbial contamination as an indicator .Inoculationof bacteriaat 10 to 30 CFU/ goffood was followed by a 5-henrichment culture step after which the PCR assayallowed the detectionof bacterial cells. When the inoculation ( B. cereus or S. aureus)of10 to 90 CFU/ gintonoodle foods containing endogenousmicro ora (10 3 to 105 CFU/g)wasfollowed by a6-henrichment culture step, the PCR assaydetected the bacteria. Includingthe enrichment culture step, the entire PCR detectionprocess can be completed within 8.5 h. Inthe food industry, bacteria of the Bacillus or Staph- positiveand gram-negative bacterial species on thebasis of ylococcus genushave been notable because many strains of thebacterial 16S rRNA gene (5, 11, 12) havebeen reported thosebacteria can cause food spoilage or because several inrecent years. T oinspectfoods comprehensively and rap- strainsof those bacteria can produce toxins that are haz- idly,a universalor broad-range PCR assay would be help- ardousto the health of the consumer (1,14, 17, 19, 20). fulin detecting targeted bacterial groups. Althoughsteps to detect the foodborne pathogens Bacillus Weattemptedto develop a rapidand speci c PCRas- cereus and Staphylococcusaureus infoodshave been taken sayfor thedetection of bacteriaof the Bacillus and Staph- insome food industries, several approved traditional meth- ylococcus generain foods. W edesigneda setof broad- odsfor thedetection of these bacteria in foods usually re- rangePCR primers that is based on thebacterial 16S rRNA quire1 or2 daysto complete (1, 14). For processedfood- gene;these primers are speci c for thedetection of bacteria stuffs,such as whole milk, ham, and boiled Chinese noodle, of the Bacillus and Staphylococcus genera.In this report, therapid detection of contaminationnot only by foodborne we describehow the analysis of PCR-amplied DNA frag- pathogenicbacteria but also by putrefactive bacteria is im- mentscould be used for thesensitive and rapid detection portant;therefore, a rapidprimary screening assay for the ofbacteria of the Bacillus and Staphylococcus genera in detectionof these bacterium groups has been sought by severalfood products after a shortenrichment period in manufacturersof foods. brainheart infusion (BHI) mediumbefore the PCR assay. PCRtechnology has proved to besensitiveand speci c tothe rapid detection of pathogenic bacteria contaminating MATERIALS AND METHODS variousfoods (3,6– 8, 20, 22). Theuse of conventional, Preparationof DNA frombacterial strains and eukary- single-targetampli cation methods are relatively costly be- oticorganisms. Thebacterial strains used in this study are sum- causeseveral sets of PCRprimers are usually necessary for marizedin T able1. Each strain was cultured in either BHI me- thedetection or identication of eachpathogenic bacterium; dium(Nacalai T esqueInc., Kyoto, Japan), BHI mediumsupple- however,targetingmultiple microbial organisms simulta- mentedwith 3% NaCl,buffered charcoal yeast extract agar (Bec- neouslyon asinglePCR reaction is moretime-ef cient and tonDickinson, Franklin, N.J.), chocolate agar (Nissui Pharmaceutical cost-effective.For clinicaldiagnosis, universal PCR prim- Co.Ltd., T okyo,Japan), blood agar (Nissui), mannitol salt agar ers thatare capable of detecting various eubacteria by the withegg yolk (Nissui), or lactobacilli deMan Rogosa Sharpe agar conservedregions of the bacterial 16S rRNA gene (15, 18) (Difco,Becton Dickinson, Sparks, Md.). Bacterial DNA wasex- orthatcan use broad-range PCR for theseparation of gram- tractedand puri ed with the use of a PuregeneY eastand Gram- PositiveDNA Isolationkit (Gentra Systems Inc., Minneapolis, *Authorfor correspondence. T el: 81-77-561-9114;Fax: 81-77-561-9140; Minn.)or DNA ExtractionIsoplant II kit(Nippon Gene Co. Ltd., E-mail: [email protected]. Tokyo,Japan). The DNA offungi( Saccharomycescerevisiae IFO 1272 NAKANO ETAL. J.FoodProt., Vol. 67, No. 6 TABLE 1. Summaryof amplication results obtained with prbac TABLE 1. Continued primersand BS primersfor puri ed DNA fromvarious bacteria a PCR result PCR result with primer with primer Bacterium Strain prbac BS Bacterium Strain prbac BS L.monocytogenes ATCC 7644 1 2 Agrobacteriumradiobacter ATCC 19358T 1 2 L. innocua NCIMB 13450 1 2 Alcaligenesfaecalis JCM 1474T 1 2 Lactobacilluscasei JCM 1134T 1 2 Chromobacteriumviolaceum JCM 1249T 1 2 L. gasseri JCM 1131T 1 2 Neisseriameningitidis ATCC 13077T 1 2 L.bulgaricus JCM 1002T 1 2 Xanthomonasmaltophilia JCM 1975T 1 2 Enterococcusfaecalis JCM 5803T 1 2 Legionellapneumophila JCM 7571T 1 2 Streptococcusmutans JCM 5705T 1 2 Pseudomonasaeruginosa ATCC 27843T 1 2 S.salivarius JCM 5707T 1 2 Moraxellaantipestifer JCM 9532T 1 2 S.agalactiae JCM 5671T 1 2 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/6/1271/1677289/0362-028x-67_6_1271.pdf by guest on 01 October 2021 Acinetobacterbaumannii JCM 6841T 1 2 Collinsellaaerofaciens JCM 10188T 1 2 Vibriovulni cus JCM 3725T 1 2 Actinomycesnaeslundii JCM 8349T 1 2 Photobacteriumleiognathi ATCC 25521T 1 2 Micrococcusluteus JCM 1464T 1 2 Aeromonashydrophila ATCC 7966T 1 2 Microbacteriumlacticum JCM 1379 1 2 Enterobacteragglomerans JCM 1236T 1 2 Corynebacteriumkutscheri JCM 9385T 1 2 Citrobacterfreundii JCM 1657T 1 2 C. xerosis JCM 1971T 1 2 Escherichiacoli JCM 1649T 1 2 Propionibacteriumacnes JCM 6425T 1 2 Hafniaalvei JCM 1666T 1 2 Bidobacterium longum JCM 1217T 1 2 Klebsiellapneumoniae JCM 1662T 1 2 B.adolescentis JCM 1275T 1 2 Plesiomonasshigelloides ATCC 14029T 1 2 Bacteroidesvulgatus JCM 5826T 1 2 Proteusmirabilis JCM 1669T 1 2 Porphyromonasgingivalis ATCC 33277T 1 2 Salmonella Typhimurium IFO 13245 1 2 Prevotellaintermedia ATCC 25611T 1 2 Serratia caria JCM 1241T 1 2 Flavobacteriumjohnsoniae JCM 8514T 1 2 Shigella exneri ATCC 29903T 1 2 Cytophagaarvensicola JCM 2836T 1 2 Yersiniaenterocolitica ATCC 9610T 1 2 Fusobacteriumnucleatum ATCC 25586T 1 2 Haemophilusin uenzae ATCC 33391T 1 2 a Campylobactercoli ATCC 33559T 1 2 Fiftypicograms of puried DNA fromeach bacterium was used Helicobacterpylori ATCC 43504T 1 2 asthe template. 1, positive; 2, negative; 1L,positive(the Clostridiumperfringens JCM 1290T 1 2 amountof amplicon with size targeted was lower). b Eubacteriumalactolyticum b JCM 6480T 1 2 Thisstrain was reclassi ed in Pseudoramibacteralactolyticym Veillonellaalcalescens ATCC 27215 1 2 (10). Brevibacillusbrevis IFO 15304 1 2 Bacilluscereus IFO 15305T 1 1 0282 and Aspergillusoryzae IFO 4206),plant (wheat, maize, po- B. cereus ATCC 10876 1 1 tato,and canola), and animal (cow, chicken, and salmon) was B. cereus ATCC 11950 1 1 preparedor purchased as described previously (16). DNA was B. cereus ATCC 10987 1 1 quantied by measuring the absorbance at 260nm, and the DNA B. cereus DSM 4312 1 1 samples,diluted at the indicated concentration, were prepared. B. cereus DSM 4313 1 1 B.thuringiensis ATCC 10792T 1 1 PCR primers. Asetof broad-range PCR primers(BS primers) B.thuringiensis ATCC 13366 1 1 wasconstructed from the conserved regions of the 16S rRNA gene B.thuringiensis ATCC 33679 1 1 ofmembers of the Bacillus and Staphylococcus generabut was B. mycoides NCIMB 13305T 1 1 designednot to react with chloroplast 16S rRNA genes (21). The B.weihenstephanensis DSM 11821 1 1 sequenceof the forward primer (positions 83 through 107 in the B.licheniformis JCM 2505T 1 1L Escherichiacoli 16SrDNA) was5 9-CTTGCTCCTCTGAAGT - B.megaterium JCM 2506T 1 1 TAGCGGCG-39,andthe sequence of the reverse primer (positions B. pumilus JCM 2508T 1 1 422through 454 in the E. coli 16SrDNA) was5 9-TGTTCTTCCC- B.circulans IFO 13626 1 1 TAATAACAGAGTTTTACGACCCG -3 9.BS primersare expected B. subtilis IFO 13719T 1 1 toamplify a PCR productof 380to 382 bp (in the case of B. cereus, B.sphaericus IFO 15095 1 1 381bp; in the case of S. aureus, 380bp). Primers prbac1 and B. lentus IFO 15655 1 1 prbac2(prbac primers), reported to be eubacteria-speci c universal Staphylococcusaureus IFO 3060 1 1 PCR primers,were used to con rm the presence of bacterial DNA S. aureus JCM 2874 1 1 (18), andthe PCR conditionswere as described in the
Load more

Recommended publications
  • Family Practice
    THE JOURNAL OF FAMILY ONLINE EXCLUSIVE PRACTICE Paul K. Carlton, Jr, MD, Brown recluse spider bite? FACS The Texas A&M University Consider this uniquely Health Science Center College Station, Tex conservative treatment [email protected] An antihistamine and observation work as well— and often better—than more intensive therapies. Practice recommendations oped it in 4 phases, which I describe in • Be concerned about brown recluse this article. Not only does this conser- envenomation when a patient vative approach consistently heal con- reports intensifying localized firmed brown recluse bite wounds, but pain disproportionate to physical should a bite be mistakenly attributed findings after a “bite” (C). to the brown recluse (or one of its rela- tives in the Loxosceles genus of spider), • Prescribe an oral antihistamine there is no harm to the patient, nor any alone to control symptoms, even big expense. with a necrotic wound, and mark the IN THIS ARTICLE patient’s progress over 24 hours (C). z Spider bite z Is a brown recluse • If the patient improves dramatically, to blame? or MRSA? continue the antihistamine; with little Due to limited experience among the Page E6 or no improvement, consider giving an wider medical community in identifying antibiotic with the antihistamine (C). spider envenomation,1-4 bite recognition and selection of appropriate therapy can Strength of recommendation (SOR) be difficult. A Good-quality patient-oriented evidence Early findings can be confusing. B Inconsistent or limited-quality patient-oriented evidence C Consensus, usual practice, opinion, disease-oriented Brown recluse bites typically feel like a evidence, case series pin prick.
    [Show full text]
  • What Is Staphylococcus Aureus (Staph)?
    What is Staphylococcus aureus (staph)? Staphylococcus aureus, often referred to simply as "staph," are bacteria commonly carried on the skin or in the nose of healthy people. Approximately 25% to 30% of the population is colonized (when bacteria are present, but not causing an infection) in the nose with staph bacteria. Sometimes, staph can cause an infection. Staph bacteria are one of the most common causes of skin infections in the United States. Most of these skin infections are minor (such as pimples and boils) and can be treated without antibiotics (also known as antimicrobials or antibacterials). However, staph bacteria also can cause serious infections (such as surgical wound infections, bloodstream infections, and pneumonia). What is MRSA (methicillin-resistant Staphylococcus aureus)? Some staph bacteria are resistant to antibiotics. MRSA is a type of staph that is resistant to antibiotics called beta-lactams. Beta-lactam antibiotics include methicillin and other more common antibiotics such as oxacillin, penicillin and amoxicillin. While 25% to 30% of the population is colonized with staph, approximately 1% is colonized with MRSA. Who gets staph or MRSA infections? Staph infections, including MRSA, occur most frequently among persons in hospitals and healthcare facilities (such as nursing homes and dialysis centers) who have weakened immune systems. These healthcare-associated staph infections include surgical wound infections, urinary tract infections, bloodstream infections, and pneumonia. Are people who are positive for the human immune deficiency virus (HIV) at increased risk for MRSA? Should they be taking special precautions? People with weakened immune systems, which include some patients with HIV infection, may be at risk for more severe illness if they get infected with MRSA.
    [Show full text]
  • Staphylococcus Aureus (Staph Infection)
    Staphylococcus aureus (Staph Infection) This sheet talks about exposure to Staphylococcus aureus and Staph infections in a pregnancy and while breastfeeding. This information should not take the place of medical care and advice from your healthcare provider. What is Staphylococcus aureus / a Staph infection? Staphylococcus aureus (Staph) are a type of bacteria (germ). Staph bacteria are commonly found on the skin or in the nose. Most of the time, people will not have problems with these bacteria. However, if Staph gets inside the body through a cut or sore, this could lead to a Staph infection. Staph infection can cause boils or blisters on the skin; or infections in the lungs (pneumonia), bloodstream (sepsis), or in a wound. People with a higher chance of getting a Staph infection include sick people in hospitals, people recovering from surgeries or other medical procedures, people living in over-crowded conditions (shelters or prisons), children in daycare, intravenous (IV) drug users, people with weakened immune systems, people with chronic health conditions (like diabetes or cancer), athletes, and military personnel. Eating food that has been contaminated with Staph bacteria can also cause food poisoning. Symptoms can be severe vomiting and diarrhea with stomach pain that will start within a few hours after exposure. This type of infection with Staph bacteria usually is not serious and generally does not last for more than a day. I am pregnant. If my partner, other family member, or friend has a confirmed Staph skin infection, what can I do to reduce my chances of getting the infection? Do not touch the person’s sores, cuts, or bandages.
    [Show full text]
  • Activation of the Bile Acid Pathway and No Observed Antimicrobial Peptide Sequences in the Skin of a Poison Frog
    INVESTIGATION Activation of the Bile Acid Pathway and No Observed Antimicrobial Peptide Sequences in the Skin of a Poison Frog Megan L. Civitello,* Robert Denton,* Michael A. Zasloff,† and John H. Malone*,1 *Institute of Systems Genomics, Department of Molecular and Cell Biology, University of Connecticut, Storrs, Connecticut 06269 and †Georgetown University School of Medicine, MedStar Georgetown Transplant Institute, Washington D.C. 20057 ORCID IDs: 0000-0002-8629-1376 (R.D.); 0000-0003-1369-3769 (J.H.M.) ABSTRACT The skin secretions of many frogs have genetically-encoded, endogenous antimicrobial KEYWORDS peptides (AMPs). Other species, especially aposematic poison frogs, secrete exogenously derived alkaloids Anti-microbial that serve as potent defense molecules. The origins of these defense systems are not clear, but a novel bile- peptides acid derived metabolite, tauromantellic acid, was recently discovered and shown to be endogenous in defensive poison frogs (Mantella, Dendrobates, and Epipedobates). These observations raise questions about the secretions evolutionary history of AMP genetic elements, the mechanism and function of tauromatellic acid produc- phylogenetic tion, and links between these systems. To understand the diversity and expression of AMPs among frogs, history we assembled skin transcriptomes of 13 species across the anuran phylogeny. Our analyses revealed a bile acid pathway diversity of AMPs and AMP expression levels across the phylogenetic history of frogs, but no observations of AMPs in Mantella. We examined genes expressed in the bile-acid metabolic pathway and found that CYP7A1 (Cytochrome P450), BAAT (bile acid-CoA: amino acid N-acyltransferase), and AMACR (alpha- methylacyl-CoA racemase) were highly expressed in the skin of M.
    [Show full text]
  • Note on Suspected Brown Recluse Spiders (Araneae: Sicariidae) in South Carolina
    Faculty Research Note Note on Suspected Brown Recluse Spiders (Araneae: Sicariidae) in South Carolina Robert J. Wolff* South University, 9 Science Court, Columbia, SC 29203 The general public believes that brown recluse spiders (Loxosceles Filistatidae (Kukulcania hibernalis) 22 specimens reclusa) are widespread where they live and that these spiders are Lycosidae 21 (3 in one package, 5 in another) frequent causes of bites resulting in dermonecrosis. Research over the Pholcidae 17 past twenty years shows these reports to be unfounded. Vetter (2005) Miturgidae 8 examined 1,773 specimens sent in from across the U.S. as brown recluse Theridiidae 8 spiders and no specimens were found from areas outside the species Agelenidae 7 range, with the exception of a specimen from California. Araneidae 6 Clubionidae 6 The reported range of the brown recluse spider includes all or major Thomisidae 6 portions of Arkansas, Oklahoma, Texas, Louisiana, Alabama, Tennessee, Gnaphosidae 4 Kentucky, Illinois, Missouri and Kansas. Minor portions of the brown Corinnidae 3 recluse range were previously reported in Iowa, Indiana, Ohio, New Philodromidae 3 Mexico, North Carolina, Georgia, and South Carolina. The most recent Amaurobiidae 1 map (Vetter, 2015) does not include South Carolina, and only the far Pisauridae 1 western tip of North Carolina and northwestern corner of Georgia. Scytodidae (Scytodes thoracica) 1 Unidentifiable 4 Schuman and Caldwell (1991) found that South Carolina physicians reported treating 478 cases of brown recluse spider envenomations in 1990 alone. This seems like a very high number, unfortunately all or No brown recluses were identified from the specimens obtained in this almost all of these are probably not brown recluse spider bites.
    [Show full text]
  • Staphylococcus Aureus Bloodstream Infection Treatment Guideline
    Staphylococcus aureus Bloodstream Infection Treatment Guideline Purpose: To provide a framework for the evaluation and management patients with Methicillin- Susceptible (MSSA) and Methicillin-Resistant Staphylococcus aureus (MRSA) bloodstream infections (BSI). The recommendations below are guidelines for care and are not meant to replace clinical judgment. The initial page includes a brief version of the guidance followed by a more detailed discussion of the recommendations with supporting evidence. Also included is an algorithm describing management of patients with blood cultures positive for gram-positive cocci. Brief Key Points: 1. Don’t ignore it – Staphylococcus aureus isolated from a blood culture is never a contaminant. All patients with S. aureus in their blood should be treated with appropriate antibiotics and evaluated for a source of infection. 2. Control the source a. Removing infected catheters and prosthetic devices – Retention of infected central venous catheters and prosthetic devices in the setting of S. aureus bacteremia (SAB) has been associated with prolonged bacteremia, treatment failure and death. These should be removed if medically possible. i. Retention of prosthetic material is associated with an increased likelihood of SAB relapse and removal should be considered even if not clearly infected b. Evaluate for metastatic infections (endocarditis, osteomyelitis, abscesses, etc.) – Metastatic infections and endocarditis are quite common in SAB (11-31% patients with SAB have endocarditis). i. All patients should have a thorough history taken and exam performed with any new complaint evaluated for possible metastatic infection. ii. Echocardiograms should be strongly considered for all patients with SAB iii. All patients with a prosthetic valve, pacemaker/ICD present, or persistent bacteremia (follow up blood cultures positive) should undergo a transesophageal echocardiogram 3.
    [Show full text]
  • Levels of Firmicutes, Actinobacteria Phyla and Lactobacillaceae
    agriculture Article Levels of Firmicutes, Actinobacteria Phyla and Lactobacillaceae Family on the Skin Surface of Broiler Chickens (Ross 308) Depending on the Nutritional Supplement and the Housing Conditions Paulina Cholewi ´nska 1,* , Marta Michalak 2, Konrad Wojnarowski 1 , Szymon Skowera 1, Jakub Smoli ´nski 1 and Katarzyna Czyz˙ 1 1 Institute of Animal Breeding, Wroclaw University of Environmental and Life Sciences, 51-630 Wroclaw, Poland; [email protected] (K.W.); [email protected] (S.S.); [email protected] (J.S.); [email protected] (K.C.) 2 Department of Animal Nutrition and Feed Management, Wroclaw University of Environmental and Life Sciences, 51-630 Wroclaw, Poland; [email protected] * Correspondence: [email protected] Abstract: The microbiome of animals, both in the digestive tract and in the skin, plays an important role in protecting the host. The skin is one of the largest surface organs for animals; therefore, the destabilization of the microbiota on its surface can increase the risk of diseases that may adversely af- fect animals’ health and production rates, including poultry. The aim of this study was to evaluate the Citation: Cholewi´nska,P.; Michalak, effect of nutritional supplementation in the form of fermented rapeseed meal and housing conditions M.; Wojnarowski, K.; Skowera, S.; on the level of selected bacteria phyla (Firmicutes, Actinobacteria, and family Lactobacillaceae). The Smoli´nski,J.; Czyz,˙ K. Levels of study was performed on 30 specimens of broiler chickens (Ross 308), individually kept in metabolic Firmicutes, Actinobacteria Phyla and cages for 36 days. They were divided into 5 groups depending on the feed received.
    [Show full text]
  • The Genera Staphylococcus and Macrococcus
    Prokaryotes (2006) 4:5–75 DOI: 10.1007/0-387-30744-3_1 CHAPTER 1.2.1 ehT areneG succocolyhpatS dna succocorcMa The Genera Staphylococcus and Macrococcus FRIEDRICH GÖTZ, TAMMY BANNERMAN AND KARL-HEINZ SCHLEIFER Introduction zolidone (Baker, 1984). Comparative immu- nochemical studies of catalases (Schleifer, 1986), The name Staphylococcus (staphyle, bunch of DNA-DNA hybridization studies, DNA-rRNA grapes) was introduced by Ogston (1883) for the hybridization studies (Schleifer et al., 1979; Kilp- group micrococci causing inflammation and per et al., 1980), and comparative oligonucle- suppuration. He was the first to differentiate otide cataloguing of 16S rRNA (Ludwig et al., two kinds of pyogenic cocci: one arranged in 1981) clearly demonstrated the epigenetic and groups or masses was called “Staphylococcus” genetic difference of staphylococci and micro- and another arranged in chains was named cocci. Members of the genus Staphylococcus “Billroth’s Streptococcus.” A formal description form a coherent and well-defined group of of the genus Staphylococcus was provided by related species that is widely divergent from Rosenbach (1884). He divided the genus into the those of the genus Micrococcus. Until the early two species Staphylococcus aureus and S. albus. 1970s, the genus Staphylococcus consisted of Zopf (1885) placed the mass-forming staphylo- three species: the coagulase-positive species S. cocci and tetrad-forming micrococci in the genus aureus and the coagulase-negative species S. epi- Micrococcus. In 1886, the genus Staphylococcus dermidis and S. saprophyticus, but a deeper look was separated from Micrococcus by Flügge into the chemotaxonomic and genotypic proper- (1886). He differentiated the two genera mainly ties of staphylococci led to the description of on the basis of their action on gelatin and on many new staphylococcal species.
    [Show full text]
  • Staphylococcus Aureus Biofilm Formation on an Abiotic Surface
    International Journal of Environmental Research and Public Health Review Staphylococcus aureus Biofilm: Morphology, Genetics, Pathogenesis and Treatment Strategies Muhammad Idrees, Sheeba Sawant, Nazira Karodia and Ayesha Rahman * Faculty of Science and Engineering, University of Wolverhampton, Wolverhampton WV1 1LY, UK; [email protected] (M.I.); [email protected] (S.S.); [email protected] (N.K.) * Correspondence: [email protected] Abstract: Staphylococcus aureus is a nosocomial bacterium causing different infectious diseases, ranging from skin and soft tissue infections to more serious and life-threatening infections such as septicaemia. S. aureus forms a complex structure of extracellular polymeric biofilm that provides a fully secured and functional environment for the formation of microcolonies, their sustenance and recolonization of sessile cells after its dispersal. Staphylococcus aureus biofilm protects the cells against hostile conditions, i.e., changes in temperature, limitations or deprivation of nutrients and dehydration, and, more importantly, protects the cells against antibacterial drugs. Drugs are increasingly becoming partially or fully inactive against S. aureus as they are either less penetrable or totally impenetrable due to the presence of biofilms surrounding the bacterial cells. Other factors, such as evasion of innate host immune system, genome plasticity and adaptability through gene evolution and exchange of genetic material, also contribute to the ineffectiveness of antibacterial drugs. This increasing tolerance to antibiotics has contributed to the emergence and rise of antimicrobial resistance (AMR), a serious problem that has resulted in increased morbidity and mortality of human and animal populations globally, in addition to causing huge financial losses to the global economy.
    [Show full text]
  • Antibiotic Resistance and Biofilm Production in Catalase-Positive Gram-Positive Cocci Isolated from Brazilian Pasteurized Milk M.A.A
    Journal of Food Quality and Hazards Control 7 (2020) 67-74 Antibiotic Resistance and Biofilm Production in Catalase-Positive Gram-Positive Cocci Isolated from Brazilian Pasteurized Milk M.A.A. Machado 1, W.A. Ribeiro 1, V.S. Toledo 1, G.L.P.A. Ramos 2, H.C. Vigoder 1, J.S. Nascimento 1* 1. Laboratório de Microbiologia, Instituto Federal de Educação, Ciência e Tecnologia do Rio de Janeiro (IFRJ), Rio de Janeiro, RJ, Brazil 2. Laboratório de Higiene e Microbiologia de Alimentos, Faculdade de Farmácia, Universidade Federal Fluminense (UFF), Niterói, RJ, Brazil HIGHLIGHTS Kocuria varians, Macrococcus caseolyticus, and Staphylococcus epidermidis were detected in pasteurized milk samples. Four isolates of K. varians exhibited multidrug resistant phenotype. Five isolates of K. varians and one isolate of S. epidermidis were biofilm producers. Antibiotic-resistance of the isolates highlights the possible role of milk as a reservoir of resistance genes. Article type ABSTRACT Original article Background: Milk is a reservoir for several groups of microorganisms, which may pose Keywords health risks. The aim of this work was to assess the antibiotic resistance and biofilm pro- Gram-Positive Cocci duction in catalase-positive Gram-positive cocci isolated from Brazilian pasteurized milk. Drug Resistance, Microbial Biofilms Methods: The bacteria were isolated using Baird-Parker agar and identified by Matrix- Milk Assisted Laser Desorption/Ionization-Time-Of-Flight (MALDI-TOF) mass spectrometer. Brazil Disk diffusion technique was used to evaluate antimicrobial susceptibility. For qualitative evaluation of biofilm production, the growth technique was used on Congo Red Agar. Article history Received: 16 Apr 2020 Results: Totally, 33 out of 64 isolates were identified, including Staphylococcus Revised: 18 May 2020 epidermidis (n=3; 4.7%), Macrococcus caseolyticus (n=14; 21.9%), and Kocuria varians Accepted: 22 May 2020 (n=16; 25%).
    [Show full text]
  • Staphylococcus Aureus
    Minnesota Department of Health Fact Sheet 2/2010 Staphylococcus aureus Staphylococcus aureus (S. aureus or “staph”) has Most skin infections will heal within a few weeks. long been recognized as one of the most important o More serious skin infections can take longer to bacteria that cause disease in humans. It is the heal if treatment is delayed or if ineffective leading cause of skin and soft tissue infections such treatment is given. as abscesses (boils), furuncles, and cellulitis. Some serious S. aureus infections (such as Although most staph infections are not serious, S. pneumonia or bloodstream infections) typically aureus can cause serious infections such as require hospitalization and treatment with bloodstream infections, pneumonia, or bone and intravenous antibiotics. joint infections. Transmission Signs and symptoms of infection S. aureus is most often spread to others by Most infections caused by S. aureus are skin contaminated hands. and soft tissue infections such as abscesses or The skin and mucous membranes are usually an cellulitis. effective barrier against infection. However, if Abscess these barriers are breached (e.g., skin damage Pocket of infection that forms at the site of due to trauma or mucosal damage due to viral injury. infection) S. aureus may gain access to underlying Usually filled with pus. tissues or the bloodstream and cause infection. Area surrounding the abscess is usually red, Persons who are immunocompromised or who painful and swollen and the skin have invasive medical devices are particularly surrounding the abscess can feel warm to the vulnerable to infection. touch. MRSA transmission: Cellulitis Traditionally, Methicillin-resistant Staphylococcus An infection of the underlying layers of the skin.
    [Show full text]
  • Staphylococcus Aureus (Staph)
    Staphylococcus aureus (Staph) What is Staphylococcus aureus (Staph)? Staph is a type of bacteria commonly carried on the skin or nose of healthy people. Staph is a common cause of minor skin infections, and occasionally causes serious infections like surgical wound infections and pneumonia. How do I get staph? Staph can be present in the body without causing illness; this is called “colonization.” At any given time, 25% to 30% of the general population are colonized with staph bacteria. Staph bacteria are spread by contact with the hands, skin drainage or secretions from the nose of a person who is infected or colonized. Persons who have draining infections are shedding more bacteria and are more infectious than persons who are colonized only. Direct skin-to- skin contact is the most common mode of transmission. Symptoms Symptoms of staph vary, depending on the part of the body that is infected. Symptoms may include: ¾ Skin infections (the most common site of staph infections) that typically result in local redness and warmth of the infected area with or without pus. Hand washing steps: ¾ Boils or small, white-headed pimples around hair follicles. 1. Use soap and warm running ¾ Blistering and peeling skin in infants and young children. water. ¾ Swollen lymph nodes in the neck, armpits or groin. 2. Scrub hands for at least 20 seconds; use a nail brush. Prevention 3. Wash all surfaces: • Between fingers ¾ Hand washing is the most effective way to prevent the spread of staph. Persons should • Under fingernails wash their hands thoroughly with soap and warm running water after having contact Back of hands with secretions from the nose, mouth or skin drainage of an infected or colonized • person.
    [Show full text]