1271 Journalof Food Protection, Vol. 67, No. 6, 2004, Pages 1271– 1277 Copyright q,International Association forFood Protection Research Note PCR Detection of Bacillus and Staphylococcus inV ariousFoods SHIGERU NAKANO, * TORU KOBAYASHI, KENICHI FUNABIKI, ATSUSHI MATSUMURA, YASUHIRO NAGAO, AND TOSHIHIRO YAMADA FoodSafety Research Institute,Nissin Food Products Co. Ltd., 2247, Noji-cho, Kusatsu, Shiga 525-0055, Japan MS03-403: Received 10September 2003/ Accepted 25January 2004 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/6/1271/1677289/0362-028x-67_6_1271.pdf by guest on 01 October 2021 ABSTRACT Abroad-rangePCR assayfor the detection of bacteria belonging to Bacillus and Staphylococcus generawas developed. Primerstargeting the bacterial 16S rRNA genewere newly designed and used in a PCR assay.T odeterminethe speci city ofthe assay, 81 different bacterial strains (of 50 genera), 2 fungi,3 animals,and 4 plantswere tested. Results were positive forevery tested Bacillus,Staphylococcus, or Aerococcus strain.In addition, the result for Listeriagrayi waspositive with lowerPCR product.For all other bacterial strains and eukaryotes tested, results were negative. Bacterial DNA wasprepared withthe use of achromopeptidase and Chelex 100 resin from culture after growth in brain heart infusion medium. T otestthe sensitivityof this PCR assayfor Bacillus or Staphylococcus genus,either Bacilluscereus or Staphylococcusaureus was inoculatedinto various foods with undetectable levels of endogenous microbial contamination as an indicator .Inoculationof bacteriaat 10 to 30 CFU/ goffood was followed by a 5-henrichment culture step after which the PCR assayallowed the detectionof bacterial cells. When the inoculation ( B. cereus or S. aureus)of10 to 90 CFU/ gintonoodle foods containing endogenousmicro ora (10 3 to 105 CFU/g)wasfollowed by a6-henrichment culture step, the PCR assaydetected the bacteria. Includingthe enrichment culture step, the entire PCR detectionprocess can be completed within 8.5 h. Inthe food industry, bacteria of the Bacillus or Staph- positiveand gram-negative bacterial species on thebasis of ylococcus genushave been notable because many strains of thebacterial 16S rRNA gene (5, 11, 12) havebeen reported thosebacteria can cause food spoilage or because several inrecent years. T oinspectfoods comprehensively and rap- strainsof those bacteria can produce toxins that are haz- idly,a universalor broad-range PCR assay would be help- ardousto the health of the consumer (1,14, 17, 19, 20). fulin detecting targeted bacterial groups. Althoughsteps to detect the foodborne pathogens Bacillus Weattemptedto develop a rapidand speci c PCRas- cereus and Staphylococcusaureus infoodshave been taken sayfor thedetection of bacteriaof the Bacillus and Staph- insome food industries, several approved traditional meth- ylococcus generain foods. W edesigneda setof broad- odsfor thedetection of these bacteria in foods usually re- rangePCR primers that is based on thebacterial 16S rRNA quire1 or2 daysto complete (1, 14). For processedfood- gene;these primers are speci c for thedetection of bacteria stuffs,such as whole milk, ham, and boiled Chinese noodle, of the Bacillus and Staphylococcus genera.In this report, therapid detection of contaminationnot only by foodborne we describehow the analysis of PCR-amplied DNA frag- pathogenicbacteria but also by putrefactive bacteria is im- mentscould be used for thesensitive and rapid detection portant;therefore, a rapidprimary screening assay for the ofbacteria of the Bacillus and Staphylococcus genera in detectionof these bacterium groups has been sought by severalfood products after a shortenrichment period in manufacturersof foods. brainheart infusion (BHI) mediumbefore the PCR assay. PCRtechnology has proved to besensitiveand speci c tothe rapid detection of pathogenic bacteria contaminating MATERIALS AND METHODS variousfoods (3,6– 8, 20, 22). Theuse of conventional, Preparationof DNA frombacterial strains and eukary- single-targetampli cation methods are relatively costly be- oticorganisms. Thebacterial strains used in this study are sum- causeseveral sets of PCRprimers are usually necessary for marizedin T able1. Each strain was cultured in either BHI me- thedetection or identication of eachpathogenic bacterium; dium(Nacalai T esqueInc., Kyoto, Japan), BHI mediumsupple- however,targetingmultiple microbial organisms simulta- mentedwith 3% NaCl,buffered charcoal yeast extract agar (Bec- neouslyon asinglePCR reaction is moretime-ef cient and tonDickinson, Franklin, N.J.), chocolate agar (Nissui Pharmaceutical cost-effective.For clinicaldiagnosis, universal PCR prim- Co.Ltd., T okyo,Japan), blood agar (Nissui), mannitol salt agar ers thatare capable of detecting various eubacteria by the withegg yolk (Nissui), or lactobacilli deMan Rogosa Sharpe agar conservedregions of the bacterial 16S rRNA gene (15, 18) (Difco,Becton Dickinson, Sparks, Md.). Bacterial DNA wasex- orthatcan use broad-range PCR for theseparation of gram- tractedand puri ed with the use of a PuregeneY eastand Gram- PositiveDNA Isolationkit (Gentra Systems Inc., Minneapolis, *Authorfor correspondence. T el: 81-77-561-9114;Fax: 81-77-561-9140; Minn.)or DNA ExtractionIsoplant II kit(Nippon Gene Co. Ltd., E-mail: [email protected]. Tokyo,Japan). The DNA offungi( Saccharomycescerevisiae IFO 1272 NAKANO ETAL. J.FoodProt., Vol. 67, No. 6 TABLE 1. Summaryof amplication results obtained with prbac TABLE 1. Continued primersand BS primersfor puri ed DNA fromvarious bacteria a PCR result PCR result with primer with primer Bacterium Strain prbac BS Bacterium Strain prbac BS L.monocytogenes ATCC 7644 1 2 Agrobacteriumradiobacter ATCC 19358T 1 2 L. innocua NCIMB 13450 1 2 Alcaligenesfaecalis JCM 1474T 1 2 Lactobacilluscasei JCM 1134T 1 2 Chromobacteriumviolaceum JCM 1249T 1 2 L. gasseri JCM 1131T 1 2 Neisseriameningitidis ATCC 13077T 1 2 L.bulgaricus JCM 1002T 1 2 Xanthomonasmaltophilia JCM 1975T 1 2 Enterococcusfaecalis JCM 5803T 1 2 Legionellapneumophila JCM 7571T 1 2 Streptococcusmutans JCM 5705T 1 2 Pseudomonasaeruginosa ATCC 27843T 1 2 S.salivarius JCM 5707T 1 2 Moraxellaantipestifer JCM 9532T 1 2 S.agalactiae JCM 5671T 1 2 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/67/6/1271/1677289/0362-028x-67_6_1271.pdf by guest on 01 October 2021 Acinetobacterbaumannii JCM 6841T 1 2 Collinsellaaerofaciens JCM 10188T 1 2 Vibriovulni cus JCM 3725T 1 2 Actinomycesnaeslundii JCM 8349T 1 2 Photobacteriumleiognathi ATCC 25521T 1 2 Micrococcusluteus JCM 1464T 1 2 Aeromonashydrophila ATCC 7966T 1 2 Microbacteriumlacticum JCM 1379 1 2 Enterobacteragglomerans JCM 1236T 1 2 Corynebacteriumkutscheri JCM 9385T 1 2 Citrobacterfreundii JCM 1657T 1 2 C. xerosis JCM 1971T 1 2 Escherichiacoli JCM 1649T 1 2 Propionibacteriumacnes JCM 6425T 1 2 Hafniaalvei JCM 1666T 1 2 Bidobacterium longum JCM 1217T 1 2 Klebsiellapneumoniae JCM 1662T 1 2 B.adolescentis JCM 1275T 1 2 Plesiomonasshigelloides ATCC 14029T 1 2 Bacteroidesvulgatus JCM 5826T 1 2 Proteusmirabilis JCM 1669T 1 2 Porphyromonasgingivalis ATCC 33277T 1 2 Salmonella Typhimurium IFO 13245 1 2 Prevotellaintermedia ATCC 25611T 1 2 Serratia caria JCM 1241T 1 2 Flavobacteriumjohnsoniae JCM 8514T 1 2 Shigella exneri ATCC 29903T 1 2 Cytophagaarvensicola JCM 2836T 1 2 Yersiniaenterocolitica ATCC 9610T 1 2 Fusobacteriumnucleatum ATCC 25586T 1 2 Haemophilusin uenzae ATCC 33391T 1 2 a Campylobactercoli ATCC 33559T 1 2 Fiftypicograms of puried DNA fromeach bacterium was used Helicobacterpylori ATCC 43504T 1 2 asthe template. 1, positive; 2, negative; 1L,positive(the Clostridiumperfringens JCM 1290T 1 2 amountof amplicon with size targeted was lower). b Eubacteriumalactolyticum b JCM 6480T 1 2 Thisstrain was reclassi ed in Pseudoramibacteralactolyticym Veillonellaalcalescens ATCC 27215 1 2 (10). Brevibacillusbrevis IFO 15304 1 2 Bacilluscereus IFO 15305T 1 1 0282 and Aspergillusoryzae IFO 4206),plant (wheat, maize, po- B. cereus ATCC 10876 1 1 tato,and canola), and animal (cow, chicken, and salmon) was B. cereus ATCC 11950 1 1 preparedor purchased as described previously (16). DNA was B. cereus ATCC 10987 1 1 quantied by measuring the absorbance at 260nm, and the DNA B. cereus DSM 4312 1 1 samples,diluted at the indicated concentration, were prepared. B. cereus DSM 4313 1 1 B.thuringiensis ATCC 10792T 1 1 PCR primers. Asetof broad-range PCR primers(BS primers) B.thuringiensis ATCC 13366 1 1 wasconstructed from the conserved regions of the 16S rRNA gene B.thuringiensis ATCC 33679 1 1 ofmembers of the Bacillus and Staphylococcus generabut was B. mycoides NCIMB 13305T 1 1 designednot to react with chloroplast 16S rRNA genes (21). The B.weihenstephanensis DSM 11821 1 1 sequenceof the forward primer (positions 83 through 107 in the B.licheniformis JCM 2505T 1 1L Escherichiacoli 16SrDNA) was5 9-CTTGCTCCTCTGAAGT - B.megaterium JCM 2506T 1 1 TAGCGGCG-39,andthe sequence of the reverse primer (positions B. pumilus JCM 2508T 1 1 422through 454 in the E. coli 16SrDNA) was5 9-TGTTCTTCCC- B.circulans IFO 13626 1 1 TAATAACAGAGTTTTACGACCCG -3 9.BS primersare expected B. subtilis IFO 13719T 1 1 toamplify a PCR productof 380to 382 bp (in the case of B. cereus, B.sphaericus IFO 15095 1 1 381bp; in the case of S. aureus, 380bp). Primers prbac1 and B. lentus IFO 15655 1 1 prbac2(prbac primers), reported to be eubacteria-speci c universal Staphylococcusaureus IFO 3060 1 1 PCR primers,were used to con rm the presence of bacterial DNA S. aureus JCM 2874 1 1 (18), andthe PCR conditionswere as described in the