93 | P a g e International Standard Serial Number (ISSN): 2319-8141 International Journal of Universal Pharmacy and Bio Sciences 6(6): November-December 2017 INTERNATIONAL JOURNAL OF UNIVERSAL PHARMACY AND BIO SCIENCES IMPACT FACTOR 4.018*** ICV 6.16*** Pharmaceutical Sciences REVIEW ARTICLE …………!!!

“GENETICS OF MYCOBACTERIA AND ITS TRENDS IN TUBERCULOSIS: A SYSTEMATIC REVIEW” Mr. Shaikh Zuber Peermohammed*, Dr. Bhise Satish Balkrishna, Sinhgad Technical Education Society‘s (STES – SINHGAD INSTITUTE) Smt. Kashibai Navale College of Pharmacy, Kondhwa, Pune – 411048 (MS) Affiliated to Savitribai Phule Pune University (Formerly known as University of Pune.).

KEYWORDS: ABSTRACT Tuberculosis has reemerged as a serious threat to human health because M.tuberculosis, of the increasing prevalence of drugresistant strains and synergetic Lipoarabinomannan, infection with HIV, prompting an urgent need for new and more efficient Mycothiol (MSH), One- treatments. Mycobacterium tuberculosis (M.tb.), an intracellular Hybrid System Vector, pathogen, is exquisitely adapted for human parasitization. Mycobacterial Ubiquitination. infection has been a major cause of death throughout human history and For Correspondence: still results in the death of about two million people globally each year. Mr. Shaikh Zuber This enduring pathogenicity suggests that Mycobacterium may use Peermohammed* unique pathogenic mechanisms during its infection process. M.tb. Address: Department of confronts a more hostile environment during infection, including Pharmacology (Doctoral restricted access to nutrients and reduced oxygen tension. Therefore, Section), Sinhgad M.tb. must possess genetic mechanisms to facilitate integrated responses Technical Education to multiple stresses encountered within the phagosome, and also to Society‘s Smt. Kashibai trigger some yet-to-be-identified switches during infection process. There Navale College of is an inherent need to understand Mycobacterial infection patterns and Pharmacy, Pune mechanisms in order to develop efficient therapeutics. The review will Affiliated to Savitribai elaborate the current evidence for strain phenotypic and genotyping Phule Pune University. variation in M.tb. The purpose of this review is to gain knowledge w.r.t certain aspects of Metabolomics of M. tuberculosis in order to determine their role in the pathogenesis of Tuberculosis (TB).

Full Text Available On www.ijupbs.com

94 | P a g e International Standard Serial Number (ISSN): 2319-8141

1. INTRODUCTION: It has been estimated that one-third of world‘s population is infected with Mycobacterium tuberculosis, the causative agent of Tuberculosis. It has evolved a number of distinct strategies to survive in hostile environment of macrophages. The drugs for treatment of TB are available but the long and demanding regimens lead to erratic and incomplete treatment often resulting in development of drug resistance. Hence, the importance of identification and characterization of new drug targets cannot be overemphasized. M.tb has a unique and large repertoire of lipid associated genes and its cell wall, which is known to contain a distinct variety of lipids, plays a crucial role in its pathogenesis. The pathogen resides in the host macrophages, where it encounters various stressful conditions such as changes in pH, exposure to reactive oxygen, nitrogen intermediates, degradative enzymes and deprivation of essential nutrients. During these conditions, the lipid rich cell surface of M.tb. is often subjected to damage by host assault. In M.tb. complex (MTBC), a possible role for strain diversity in TB infection models and in clinical settings remain open questions. However, until the development of the first molecular strain- typing techniques in the early 1990s, there was a general belief that genetic diversity within MTBC was too limited to account for these differences in virulence. The highly variable outcomes in TB, which ranges from lifelong asymptomatic infection to severe extrapulmonary disease affecting multiple organs were primarily attributed to host and environmental factors. One additional difficulty in trying to link genomic diversity to phenotypic diversity in MTBC is a genetically monomorphic organism and has been the lack of appropriate tools to index genomic diversity and classify strains. [1-2] Quantitative proteomics based approaches and post-translational modification analysis can be efficiently applied to gain an insight into the molecular mechanisms involved.The measurement of the proteome and posttranslationally modified proteome dynamics using mass spectrometry, results in a widearray of information, such as significant changes in protein expression, protein abundance, the modification status, the site occupancy level, interactors, functional significance of key players, potential drug targets, etc. The potential of proteomics to investigate the involvement of post-translational modifications in bacterial pathogenesis and host–pathogen

Full Text Available On www.ijupbs.com

95 | P a g e International Standard Serial Number (ISSN): 2319-8141 interactions. Development of high-resolution instruments and improvements in experimental techniques has helped expand the scope of infection biology.[3] 2. A phylogenetic framework for strain classification: Although DNA sequence data allows inferring robust phylogenetic structures, delineating biologically meaningful groupings within a continuous spectrum of genotypic diversity is not easy, and to some extent arbitrary. Nevertheless, defining such boundaries within species is important for the purpose of strain classification. The difficulty of determining biologically meaningful groupings within related bacteria arises at multiple taxonomic levels. For example, there is still no widely accepted species concept for bacteria, and species demarcation has been based on measures of genome similarity, phenotypic or ecological clustering. MTBC is an example for which the concept of ―ecotype‖ has been proposed to define the various (sub)- species within MTBC. Related concepts at lower taxonomic levels include terms such as ―lineage‖, ―sub-lineage‖, ―family‖, ―clade‖, and ―cluster‖. Larger numbers of MTBC genomes will be necessary to properly define the various sub-lineages and strain families comprised within six main lineages. It has been earlier demonstrated that exposure to acidic pH results in the upregulation of the mymA operon of M.tb. (Rv3083-Rv3089). The functional loss of the mymA operon leads to alterations in colony morphology, cell wall structure, mycolic acid composition and drug sensitivity and results in markedly reduced intracellular survival of M.tb. in macrophages. Besides, mymA mutant of M.tb. shows a drastic reduction (800 fold) in its ability to survive as compared to the parental strain. To gain further insight into functioning of mymA operon, a potential target for developing antitubercular drugs, it is necessary to characterize its gene products. FadD13, last gene of mymA operon, encodes a Fatty Acyl- CoA Synthetase and are ubiquitously distributed from bacteria to mammalian systems and catalyze activation of various fatty acids by converting them into fattyacyl-CoA thioesters. Mechanistically, these proteins carry out the catalysis in two steps involving fatty acids, ATP and CoA. In the first step, the fatty acid and the ATP react to form the fatty acyl-AMP intermediate with the release of pyrophosphate. The fatty acyl group is then transferred to the thiol group of the CoA acceptor to form fatty acyl-CoA with the concomitant release of AMP. The cytosol of

Full Text Available On www.ijupbs.com

96 | P a g e International Standard Serial Number (ISSN): 2319-8141 mammalian cells contains a large multifunctional homodimeric protein (called FAS I) which contains all of enzymatic activities in the pathway whereas the mycobacteria have a different FAS I. The FAS I pathways are closely related in that high resolution structures can often be superimposed on that of the cognate domain of the FAS I proteins.[4-6] 3. Structural Components/ Composition of Mycobacteria: 3.1 Enoyl-acyl carrier protein (ACP) Reductases: Enoyl-ACP reductases catalyze the reduction of a trans-2-acyl-ACP (an enoyl-ACP) to the fully saturated acyl-ACP species (note that trans-2-butyryl-ACP is often called crotonyl-ACP). The reductant is either NADH or NADPH, although in one case a reduced flavin (FMNH2) is used as an intermediate in the reduction. The pyridine nucleotide reduction of double bond is thought to proceed by conjugate addition of a hydride ion from NADH or NADPH to carbon 3 of trans-2- acyl group with intermediate formation of an enzyme-stabilized enolate anion on the C1 carbonyl oxygen. Collapse of enolate via protonation at C2 would yield saturated product with the C2 proton being derived from hydroxyl group of an active site tyrosine side chain. The tyrosine proton is replenished from solvent via a proton wire involving Lys163 and ribose hydroxyl groups plus a chain of water molecules. The pyridine nucleotide cofactor hydride ion utilized by M.tb. enoyl-ACP reductases (FabI and InhA, respectively) is the 4S hydrogen whereas the mammalian type I synthase uses the 4R hydrogen. The trans-2 unsaturated acyl chain is linked to ACP via a thioester linkage that is required for enolization. ACP is a key feature of fatty acid synthetic pathway in that all of intermediates are covalently bound to this small, very acidic and extremely soluble protein. The carboxyl groups of the fatty acyl intermediates are in thioester linkage to thiol of 4'-phosphopanthetheine (4‘-PP) prosthetic group that in turn is linked to Ser- 36 of ACP through a phosphodiester bond. ACP thioesters are the substrates of enzyme pathway. The ACPs of type II systems are discrete proteins whereas those type I systems are a domain of these polyfunctional ―megasynthase‖ proteins. These ACP domains have a structure very similar to type II ACPs. Although the physiological substrate of ENRs is the cognate trans-2-acyl-ACP, these enzymes will often show activity with model substrates such as CoA or N-acetylcysteamine trans-2-acyl-thioesters.[7-8]

Full Text Available On www.ijupbs.com

97 | P a g e International Standard Serial Number (ISSN): 2319-8141

3.2 The Antigen 85 (Ag85) Complex: It is a family of fibronectin binding proteins that are considered to be potential virulence factors. These proteins (Ag85A, Ag85B, and Ag85C, encoded by genes fbpA, fbpB, and fbpC, respectively) garnered attention when M.tb. was found to bind selectively to fibronectin and not to other purified extracellular matrix proteins. Binding of these organisms to purified fibronectin is dose dependent and can be blocked by antibodies produced either to fibronectin or to members of Ag85 complex. It has been clearly demonstrated that ability to bind fibronectin and other extracellular matrix proteins enhances the virulence of pathogenic organisms. Specific binding to host extracellular matrix proteins may aid in adherence and dissemination of organisms in tissue. Quantitatively, the proteins are secreted at a ratio of 3:2:1, Ag85A to Ag85B to Ag85C. These proteins have recently been found to possess mycolyl transferase activity, adding to growing number of cell wall-synthetic enzymes identified in mycobacteria. Belisle et.al., identified members of the Ag85 complex as enzymes responsible for the transfer of mycolic acids to α-α-9-trehalose to form α-α-9-trehalose monomycolate (TMM) and α-α-9-trehalose dimycolate (TDM), also known as cord factor. Ag85A and Ag85C share a similar specific mycolyl transferase activity, while the specific activity of Ag85B is only about 20% of that of Ag85C. These mycolates represented not only TMM and TDM but also other molecules such as arabinogalactan, glycerol monomycolate, a-mycolates, methoxymycolates, and ketomycolates. PCR, Southern blot hybridization, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and immunoblot analyses confirmed the disruption and inactivation of fbpA and fbpB in individual strains of M. tuberculosis. Loss of FbpA expression was shown to inhibit the ability of H37Rv to grow in wholly synthetic media or to replicate in human or mouse macrophage-like cell lines, indicating that FbpA may play a role in the pathogenesis of M.tb.[9] 3.3 DNA–protein interactions: This is particularly true in case of disease-causing pathogens, where role of transcription factors and DNA–protein interactions in imparting pathogenicity remains poorly understood. When an intracellular pathogen such as M. tuberculosis enters

Full Text Available On www.ijupbs.com

98 | P a g e International Standard Serial Number (ISSN): 2319-8141

activated macrophages, it confronts a particularly stressful environment, so it must possess mean of conveying information to the transcriptional apparatus to promote its environmental adaptation. Isocitrate lyase (ICL), an enzyme essential for metabolism of fatty acids, also appears to be important for the survival of pathogen in lungs during persistent phase of infection. The induction of genes involved in β-oxidation of fatty acids during M.tb. persistent infections suggests that fatty acids might be a major source of carbon and energy in chronically infected lung tissue. M.tb. appears to have sophisticated genetic mechanisms

to recognize stressful environment signals, such as O2, NO, and fluctuations in intracellular redox state. The genes involved in fatty acid metabolism and stress responses have been suggested to comprise core of in vivo-regulated genes. However, little is known regarding molecular mechanisms behind sensing of extracellular signals and nutrient stress by M.tb. in course of metabolic adaptation. Sequence-specific DNA-binding transcription factors have widespread biological significance in regulating gene expression. Several reports have described the expression profiles of M.tb. genes during infection using DNA microarrays, quantitative real-time RT-PCR. The genome of M.tb. encodes 13 RNApolymerase s-factors, as well as more than 140 putative regulatory proteins, which suggest an important role of transcriptional regulation in life cycle of M.tb. Rv3133c is one of very few M.tb. transcription factors for which a role has been characterized. Rv3133c was shown to be required for the hypoxic induction of the alpha-crystallin encoded by Rv2031 (acr). The Acr is a dominant antigen; Park et.al. found that Rv3133c bound with motif sequences upstream of the Acr coding region, and this binding was necessary for hypoxic gene induction. Recently, Boon et.al. demonstrated that the long-term hypoxic survival of M. bovis BCG required Rv3133c (named DosR for dormancy survival regulator). Although recent studies have confirmed the importance of gene regulatory networks in MTB, the target genes and the cellular processes controlled by these transcription factors are largely unknown.[10] 3.4 Mycobacterial One-Hybrid System: Some studies shown developed a new bacterial one- hybrid system in which the reporter vector has been integrated with a rapid and simple cloning strategy for polymerase chain reaction (PCR) products. In addition, it is compatible

Full Text Available On www.ijupbs.com

99 | P a g e International Standard Serial Number (ISSN): 2319-8141 with many commercially available pTRG cDNA libraries. Using this new system, some researchers have successfully isolated a number of new transcriptional factors involved in the induction of in vivo-regulated genes in the pathogen M. tuberculosis H37Rv. A WhiB- like transcriptional factor, WhiB3 (Rv3416), that extensively regulates fatty acid metabolism and stress responses by binding with the promoter sequences of many of the genes involved is likewise detected. In the bacterial one-hybrid system expressed the DNA-binding domain of a given DNA-binding protein, such as a transcription factor, or a cDNA library as a fusion to the alpha subunit of the RNA polymerase in the pTRG vector. A PCR product of an interesting target DNA or a library of genomic DNA can be conveniently cloned into the reporter vector pBXcmT containing the selectable genes HIS3 and aadA. A mediator sequence factor integrated into the upstream of the reporter cassette significantly reduces the self-activation background. An obvious advantage of this new system is that an easy cloning strategy was integrated into the reporter vector, which is very convenient for the cloning of short target DNA PCR products. The reporter vector is compatible with commercial pTRG libraries such as humans and yeast, and can be partnered to identify specific DNA–protein interactions. The use of a rapid PCR product cloning strategy for the DNA target factor in a reporter vector and its compatibility with many commercial pTRG cDNA libraries represent two important advantages of method over existing bacterial one-hybrid selection systems. More importantly, the system works very well in detecting the specific DNA–protein interactions of the M. tuberculosis transcription factors. Either the transcription factor, or its DNA target sites, could be mutated and the specificities of the interactions were interrupted. These along with those from a previous study (Meng et al. 2005) in which the DNAbinding specificities of eukaryotic transcriptional factors were successfully examined, show that the bacterial one-hybrid system can be utilized to characterize DNA-binding specificity in bacteria and eukaryote. Furthermore, the bacterial system could also be used to successfully detect the DNA-binding specificity of eukaryote-like archaeal proteins. The bacterial one- hybrid system may be limited in its scalability and may also not be suitable for determining specificity under some conditions, such as when the DNA binding proteins are modified

Full Text Available On www.ijupbs.com

100 | P a g e International Standard Serial Number (ISSN): 2319-8141 post-translationally and only then bind to the target sequences. In addition, it is a probably common problem for bacterial one-hybrid systems to produce potential false positive/ negative results. Therefore, controls that test known transcription factor/promoter interactions should be run to determine the most suitable screening conditions. Validation of the data obtained from library screens using different methods such as SPR, EMSA, or whole genomic microarray analysis should also be carried out. It emphasizes the need to develop novel approaches to better understand gene function and thus virulence and is a key challenge in the postgenomic era. It has become increasingly clear that virulence pathways are mediated by networks of interacting proteins. Furthermore, the physical association between a protein of unknown function and a known protein indicates that the former often has a function related to that of the latter. Therefore, we believe that the development of an in vivo technology to study the protein–protein association of genetically intractable pathogens such as Mtb will enhance the dissection of virulence pathways and significantly advance our understanding of the mechanisms of disease. Importantly, an abundance of studies have shown that some protein associations do not occur in vitro or in unrelated surrogate hosts and require a more ‗‗natural‘‘ intracellular environment. Until now, an effective mycobacterial equivalent of the yeast two-hybrid (Y2H) method system has not existed. It is clear that bacterial protein interaction mapping has not attained the level of complexity as has the yeast counterpart. An exception is the protein network of Helicobacter pylori that yielded ≥1,000 Y2H interactions, connecting close to half of the proteome. Previous studies exploited the Y2H system to study Mtb virulence (6) and signal transduction. Nevertheless, yeast does have certain limitations: (i) interactions occur in the nucleus, (ii) membrane proteins represent a problem, (iii) bacterial proteins do not undergo appropriate posttranslational modification, (iv) self activation can be a significant problem, and finally (v) high G/C DNA is sometimes not well tolerated. Some studies developed a simple and rapid method termed mycobacterial protein fragment complementation (MPFC) to study Mtb protein–protein association in mycobacteria. When two mycobacterial interacting proteins are independently fused with domains of murine dihydrofolate reductase

Full Text Available On www.ijupbs.com

101 | P a g e International Standard Serial Number (ISSN): 2319-8141

(mDHFR), functional reconstitution of the two mDHFR domains can occur in mycobacteria, thereby allowing us to select for mycobacterial resistance against trimethoprim (TRIM). To establish M-PFC as an effective method to functionally dissect and connect virulence pathways, screened an Mtb H37Rv library for proteins that associate with the virulence determinant Cfp-10 and performed a series of validation experiments using the Y2H system and in vivo pull-down assays. Some data demonstrate that, have successfully developed a simple and robust system that enables the study of protein–protein association in mycobacteria. It is anticipated that M-PFC will significantly contribute toward the dissection and linking of Mtb virulence pathways, impact high-throughput screening approaches, and contribute to emerging disciplines such as systems biology. Until now, an experimental system for studying protein–protein association in mycobacteria has not existed. This study shows that we have developed such a system, M-PFC, which allows us to study Mtb virulence mechanisms and other functional pathways through the analysis of protein–protein interaction. InM-PFC, the independent genetic coupling of mDHFR complementary fragments ([F1,2] and [F3]) with two mycobacterialinteracting proteins leads to the reconstitution of the mDHFR activity in vivo, at a concentration where endogenous mycobacterial DHFR activity is inhibited. We thoroughly tested M-PFC using well documented protein–protein interactions such as eukaryotic GCN4, as well as the protein interactions of Mtb KdpD-KdpE, and DevR-DevS and the secretory antigens Esat-6 and Cfp- 10. Using a number of controls, including unrelated proteins and empty vectors, we were able to confirm that these proteins specifically associate in mycobacteria. The system proved to be sensitive and robust, because the association between membrane-located sensor kinases (KdpD and DevS) and their corresponding response regulators (KdpE and DevR), respectively. Moreover, it seems that the orientation of fusions has little to no effect on the refolding of F[1,2] and F[3] and is in agreement with a previously reported eukaryotic study. Nonetheless, that some proteins may require a free N or C terminus for interactions, a situation that would be apparent with testing. A major advantage of studying protein association in mycobacteria rather than in surrogate hosts such as yeast and E. coli is that

Full Text Available On www.ijupbs.com

102 | P a g e International Standard Serial Number (ISSN): 2319-8141 appropriate modifications, cofactors, and the exclusive intracellular environments such as the mycobacterial cytoplasm and membrane may dictate the outcome of interactions. Nonetheless, using the Y2H system and pull-down assays, we were able to confirm all of the tested interactions with the exception of the Cfp-10-Pks13- interacting pair that may represent an example of an interaction that requires the mycobacterial cytoplasmic environment. A second advantage is the simplicity and robustness of the system; a typical screen is completed within 2 weeks and requires minimum manipulation. Virulence pathways are mediated by complex networks of molecular interactions, which upon disruption alter protein– protein associations. Thus, protein–protein interactions typically suggest a direct link or role in a pathway. As a result, one of the central aims of this work was to thoroughly test the capacity of M-PFC to reveal undefined Mtb virulence mechanisms. Several studies have shown that proteins in and outside of the Mtb RD1 region are involved in the secretion of the immunogenic antigens, Esat-6 and Cfp-10. An important feature of this yet-undefined specialized secretion system is that these small effector proteins contain no signal peptide. It was characterized the Mtb specialized secretion system by performing a genome-wide screen for Cfp-10-interacting clones. We repeatedly identified Esat-6 as one of its interacting partners, which is consistent with previous studies and validates M-PFC as an effective tool for screening the Mtb genome for interacting proteins. More importantly that, identified several previously undescribed components of the Mtb secretory pathway. For example, Rv0686, a member of the signal-recognition pathway (SRP)-GTPase family, was found to specifically interact with Cfp-10. Members of this family include SRP and its receptor, SR, and are involved in cotranslational targeting of proteins in the bacterial plasma membrane and eukaryotic endoplasmic reticulum membrane for secretion or membrane insertion. In Bacillus subtilis, both SRP and SR are involved in targeting the majority of the secreted proteins to the Sec translocase. Many data suggest that the SRP-GTPase ortholog (Rv0686) may facilitate targeting of Cfp-10 to the membrane by the SRP. In support of the above results which identified a second substrate of the SRP, the cell division protein FtsQ, which has been widely used as a model protein to dissect SRP-

Full Text Available On www.ijupbs.com

103 | P a g e International Standard Serial Number (ISSN): 2319-8141

dependent translocation of integral membrane proteins. Because FtsQ has been shown to interact with components of SecYEG translocon, it is possible that FtsQ participates in the delivery of Cfp-10 to the SecYEG translocon. Furthermore, we detected a positive

interaction between Cfp-10 and the AAA-ATPase chaperone ClpC1 (a member of the Clp- Hsp100 family of proteins), which are involved in diverse functions, including secretion, gene regulation, protein refolding, and degradation and have been shown to associate with

the translocation machinery in the chloroplast membrane. It may well be that Mtb ClpC1 facilitates Cfp-10 secretion by associating with the translocation complex in the membrane. Because ClpC can also target misfolded proteins into the chamber of proteolytic subunit, ClpP, for degradation, it can be argued that association with Cfp-10 is spurious. However, that ClpC1 selectively associated with the ClpP2 protease subunit but not with other proteolytic subunits (e.g., ClpP1) or unrelated control proteins strongly suggests the association is specific. The interaction of Cfp-10 with Pks13 is unexpected. However, the association of Esat-6 also with Pks13 lends support to the idea that the interaction is physiologically relevant, especially because it was previously demonstrated that acetylation affects the interaction of Cfp-10 with Esat-6. It is hypothesize that the acyltransferase domain in the Pks13 may modify Cfp-10 through acylation. However, this assertion will require detailed experimental verification. Interestingly, N-terminal acylation of eukaryotic proteins occurs frequently and is required for proper translocation of proteins that lack a recognizable secretory signal sequence. Cfp-10 contains an Ala after the Met at the N terminus, whereas Esat-6, the known partner of Cfp-10, is acetylated at the N-terminal Thr residue. In eukaryotes, these amino acids account for ≥95% of the N-terminal acetylated residues.[11-12] 3.5 The mannosylated cell envelope components of M. tuberculosis: The M. tuberculosis cell envelope is characterized by the presence of a variety of unique complex lipids, constituting 60% of the bacillus total weight. This lipid-rich low permeability matrix contributes to the difficulty in combating mycobacterial diseases by endowing the organism with innate resistance to therapeutic agents and host defenses. The complex M. tuberculosis cell

Full Text Available On www.ijupbs.com

104 | P a g e International Standard Serial Number (ISSN): 2319-8141

envelope can be divided into two major structures, the cell wall and the capsule-like outermost structures. The outermost components are solvent-extractable non-covalently bound free lipids, carbohydrates and proteins associated with the mycolyl-arabinogalactan- peptidoglycan complex (cell wall core). These surface components may be prone to release, shedding, and/or cleavage upon contact with the host cell or within an appropriate intracellular environment of the cell. The surface of M. tuberculosis is particularly rich in mannose-containing biomolecules, including mannose-capped lipoarabinomannan (ManLAM), the related lipomannan (LM), phosphatidyl-myo-inositol mannosides (PIMs), arabinomannan, mannan and mannoglycoproteins. PIMs, LM and ManLAM are incorporated into the plasma membrane and also exposed on the M. tuberculosis cell surface. They act as ligands for host cell receptors and contribute to the pathogenesis of M. tuberculosis.[13] 3.6 Biological functions of M. tuberculosis mannosylated cell envelope components ManLAM: One of the most abundant mannose-containing macromolecules of the M. tuberculosis cell envelope is ManLAM, which is implicated as a key molecule in immunopathogenesis and virulence of the bacterium. ManLAM is expressed on the M. tuberculosis surface, and is in an ideal position to mediate interaction between M. tuberculosis and phagocytes. In the case of slow-growing mycobacteria like M. tuberculosis, M. leprae, M. bovis BCG and M. avium among others, ManLAM is an extremely heterogeneous lipoglycan with a defined tripartite structure: a carbohydrate core (i.e. D- mannan and D- arabinan), a mannosylphophatidyl- myo-inositol (MPI)-anchor and various mannose-capping motifs. These mannose-capping motifs are surface exposed mannooligosaccharides linked to the nonreducing end of the D-arabinan and define the characteristic ManLAM of M. tuberculosis. They are not found on LAM from fast-growing mycobacteria which have phospho-myoinositol caps (PILAM) or are uncapped (AraLAM). The mannose caps bind to the macrophage MR and mediate phagocytosis of bacteria by human macrophages. ManLAMs from different M. tuberculosis strains vary in the degree to which they bind to the MR pointing to a potential relationship between the length and/or

Full Text Available On www.ijupbs.com

105 | P a g e International Standard Serial Number (ISSN): 2319-8141 presentation of the mannose-caps and their affinity for the MR. The ManLAM caps also bind to DC-SIGN present on dendritic cells. Thus, terminal components of ManLAM are very important in host cell recognition. Apart from ManLAM, the outermost layer of M. tuberculosis also contains manno-proteins (i.e. 45KDa) and other major mannose-containing polysaccharides, arabinomannan and mannan, whose mannan structures appear to be identical to that of ManLAM and LM, respectively, except for absence of the lipid anchor. The macrophage immunomodulatory responses to ManLAM differ from those due to AraLAM and PILAM. ManLAM reduces macrophage microbicidal activities by negatively modulating the production of nitric oxide, oxygen radicals, inflammatory cytokines and inhibits M. tuberculosis induced-apoptosis through altering Ca2+-depending signaling. In contrast, PILAM generally induces pro-inflammatory responses. Using immunoelectron microscopy, ManLAM has been shown to traffic away from the mycobacterial phagosome in dense intracellular vesicles into the membrane-trafficking network of the macrophage; however, this study could not address if it was intact ManLAM or ManLAM metabolites derived from intracellular processing. ManLAM has been found in the MHC class II antigen loading compartment of macrophages where it is loaded onto CD1 molecules for presentation to T cells. It has been suggested that ManLAM undergoes intracellular processing to be accessible to the CD1 binding groove. Lending support to this idea is the recent discovery of a single smaller ManLAM variant with specific structural characteristics that is uniquely involved in the presentation to T cells via CD1. Following phagocytosis of most bacteria, bacterial phagosomes rapidly mature to phagolysosomes via a series of fusion steps with vesicles of the endolysosomal pathway. In contrast, M. tuberculosis modifies the phagosomal environment to support its survival inside macrophages by limiting phagosomal acidification and phagosome-lysosome fusion. Recently, It was demonstrated that engagement of the MR by ManLAM directs M. tuberculosis to its initial phagosomal niche enhancing its potential for survival in human macrophages. The biochemical mechanisms underlying phagosome-lysosome fusion inhibition and where ManLAM or its metabolite(s) appear to be directly involved are being elucidated. In this regard, ManLAM blocks the

Full Text Available On www.ijupbs.com

106 | P a g e International Standard Serial Number (ISSN): 2319-8141 increase of macrophage cytosolic Ca2+ and thereby inhibits interaction of the phosphatidylinositol 3-kinase (PI3K), hVPS34, with cytosolic calmodulin, a step necessary for the production of phosphatidylinositol 3-phosphate (PI3P) which, in turn, is required for the recruitment of the Rab5 effector Early Endosome Antigen 1 protein (EEA1) to phagosomes. EEA1, in combination with Syntaxin 6, is necessary for the delivery of lysosomal components from the trans-Golgi network to the phagosome and regulates fusion of phagosomes with vesicles of the endosomal-lysosomal pathway. However, recently, a study showed that ManLAM does not induce the phagosomal maturation block through activation of p38 MAP kinase, contradicting some previous suggestions. Although the effects of ManLAM on phagosome biogenesis are being defined biochemically from the host cell perspective, there is essentially nothing known about the biochemistry of ManLAM itself in this process. For example, is ManLAM or a metabolite(s) shed from M. tuberculosis in the phagosome and intercalated into the phagosomal wall via its MPIanchor? Questions regarding the nature of ManLAM within the host and how it directly participates in regulating vesicular fusion remain unanswered. Many studies using the bead model of ManLAM uptake by human macrophages via the MR show that over time the carbohydrates of ManLAM are increasingly exposed on the cytoplasmic face of the phagosomal compartment, suggesting that ManLAM (or a metabolite) is being physically intercalated within the phagosomal membrane and flipped outside of the phagosomal compartment. Some findings are supported by other reports using free ManLAM in human macrophage cultures, where it was incorporated into membrane rafts of the macrophage cell membrane via its MPI-anchor and this incorporation was critical in reducing phagosomal maturation. Similarly, studies on human lymphocytes showed that ManLAM localized to membrane rafts of the lymphocyte membrane interfering with signaling pathways and subsequently affecting cytokine production. Thus, further work is necessary to answer the role of intact ManLAM or a metabolite(s) influencing the fluidity of the phagosome membrane and trafficking. Intracellular processing of ManLAM may be a critical step in directing the outcome of M. tuberculosis infection. Does ManLAM intracellular processing really occur?

Full Text Available On www.ijupbs.com

107 | P a g e International Standard Serial Number (ISSN): 2319-8141

Our laboratoryhas begun to address this issue by incubating intact metabolically radiolabeled ManLAM with human macrophage lysates (cytosol + membranes). It indicates significant degradation of ManLAM by macrophage enzymatic activities, consistent with the notion that intracellular processing of mannosylated biomolecules present in the cell envelope of M. tuberculosis may occur during infection in vivo. Thus, an important question arises from these studies; does intact ManLAM or its metabolite(s) traffic to the cytosol and engage host cell molecules? These events are likely to influence not only phagosome biogenesis but also a number of immune and metabolic processes of the macrophage.[14-15] 3.7 Lipoarbinomanan (LM) and Phosphatidylinositol-Mannose (PIMs): Other important mannose-containing biomolecules present on the M. tuberculosis surface are LM and PIMs. LM is present in all mycobacterial species with structural differences among some pathogenic mycobacterial strains. Both LM and PIMs regulate cytokine, oxidant and T cell responses. LM induces apoptosis and a pro-inflammatory response through TLR2. PIMs are divided in two distinct groups depending on their number of mannoses. Lower- and higher- order PIMs contain 1 to 4 mannoses and 5 to 6 mannoses, respectively. Lower order PIMs [PIM2 to 4] have a terminal α(1→6)-mannose and participate in phagocytosis events through complement receptor (CR) 3 and also facilitate fusion with early endosomal compartments. Conversely, higher-order PIMs [PIM5 to 6] have the same α(1→2)-mono or dimannoside termini characteristic of the mannose-caps of ManLAM and participate in phagocytosis events through the Mannose Receptor (MR) limiting phagosome-lysosome fusion events. Importantly, for higher-order PIMs, the degree of acylation is critical for host recognition via the MR, where only triacylated forms of PIM6 [i.e. Ac1PIM6] efficiently bind to the MR. Additional studies have shown that processing for antigen presentation via CD1 to T cells. This intracellular sCD1e is involved in PIM6 is in line with previous studies showing that CD1 loading of biomolecules containing terminal α(1→2)-mannose occurs via the MR and thus highlights the critical importance of both the ManLAM/MR and higher-order PIMs/MR phagocytic pathways in limiting phagosome-lysosome fusion and antigen presentation.

Full Text Available On www.ijupbs.com

108 | P a g e International Standard Serial Number (ISSN): 2319-8141

Additional studies using different PIM sources and mammalian cell lines expressing DC- SIGN also showed differences in the degree of PIM recognition. 3.8 Mannan and arabinomannan: Daffe and colleagues showed that the mannose-containing biomolecules mannan and arabinomannan are exposed on the surface of M. tuberculosis forming part of the so called outer material or capsule. Although there is no direct evidence for it, capsular mannan and arabinomannan are thought to relate to LM and ManLAM, respectively, following loss of their MPI anchor due to their similar glycosidic structure. Based on antibody recognition assays, the surface expression of arabinomannan appears to change with culture age during bacterial growth in vitro but this phenotype seems to be strain dependent. In the same study arabinomannan was shown to be produced by bacteria grown in vivo, where the amount of in vivo-detected arabinomannan depended on the number of bacteria in the infected organ. In general, arabinomannans appear to be immunosupressive components that can affect macrophage-dependent antigen-induced TH1 cytokine production by human and murine lymphocytes. Interestingly, a recent study using purified arabinomannans from virulent and non-virulent M. avium strains showed that the degree of acylation of arabinomannan (additional acylation independent of the MGI-anchor) is a prerequisite for the effective stimulation of antigen presenting cells.[16] 3.9 Mannosylated proteins: M. tuberculosis is reported to produce both acylated and glycosylated proteins. Among the mannosylated proteins, the most intensely studied are the 19 KDa and 45 KDa proteins. The 19 KDa protein is an abundantly expressed cell wallassociated and secreted glycolipoprotein that has biological activity attributable to its interaction with mammalian Toll-like receptors, especially with TLR2. However, the importance of the glycosylation units on the 19 KDa protein in M. tuberculosis pathogenesis is still not clear, since recombinant 19 KDa lacking posttranslational modifications is still capable of generating the pro-inflammatory response described for the native protein. The 45 KDa glycoprotein was first identified as having three distinct glycoforms of 55, 50 and 38 KDa within the culture filtrate proteins of M. tuberculosis. Later it was demonstrated that these three bands represented the same 45 KDa protein. A clear structure-function

Full Text Available On www.ijupbs.com

109 | P a g e International Standard Serial Number (ISSN): 2319-8141

relationship for the glycosylation of M. tuberculosis proteins is still largely unknown. It is speculated that glycosylation may be involved in protein export through the mycobacterial membrane or that it increases the stability of glycosylated proteins in the intracellular environment in which M. tuberculosis normally resides due to the fact that Oglycosylated proteins are more resistant to intracellular proteolytic activities. The direct contribution of the glycosyl units to the immunoreactivity of M. tuberculosis glycoproteins and the role of these glycoproteins in pathogenesis was shown in one study where M. tuberculosis recombinant proteins with significant changes in their mannosylation types had little or no ability to elicit a DTH reaction in BCG pre-immunized guinea pigs. Thus, M. tuberculosis uses its mannosylated biomolecules to enter macrophages through defined receptor-mediated pathways, signals the cell during and potentially after entry, and regulates a number of immune processes. Interestingly, these mannosylated biomolecules are apparently not transported out of the cell like some mycobacterial lipids suggesting that the terminal fate of these mannosylated biomolecules is within the macrophage. However, a recent study using immunoblotting suggested that M. tuberculosis and/or M. bovis BCG infected macrophages or monocytic cell lines released the 19 KDa protein and ManLAM into the media via exosomes. Such blotting techniques cannot distinguish between intact molecules or those that are processed. A more recent study by the same group showed that the antigen 85 protein is the major protein antigen in the exosomes.[17] 3.10 Importance of mannose on the surface of the M. tuberculosis cell envelope:A concept: M. tuberculosis mannosylated biomolecules like ManLAM are key microbial virulence determinants in the M. tuberculosis-macrophage interaction. Great efforts are being made by several laboratories to resolve the complicated biosynthetic pathways that involve ManLAM, LM and PIMs production. Several studies, including that altering the presence of mannose on the surface of M. tuberculosis has relevant biological consequences. This is the case for PimB since disruption of this mannosyltransferase decreases surface exposed ManLAM and LM by ~60% and results in faster intracellular replication and increased macrophage death. Conversely, increasing surface mannosylation of M. smegmatis

Full Text Available On www.ijupbs.com

110 | P a g e International Standard Serial Number (ISSN): 2319-8141 by over-expressing ManB, a phosphomannomutase involved in the biosynthesis of GDP- mannose (a major mannose donor in ManLAM biosynthesis), results in a greater association of mycobacteria with human macrophages in a mannan-inhibitable fashion. The essentiality of mannose on the mycobacterial cell envelope is also supported by other studies where it is speculated that mannose-containing biomolecules have a critical role in regulating septation and cell division without perturbing other pathways of lipid biosynthesis 109. Although these studies support the importance of mannose on the surface of M. tuberculosis for host recognition, other studies have pointed out that this may not be the case for other mycobacterial species. For example, using in vitro and in vivo models, Dinadayala et al. reported that a mutation in Rv1635c, the gene responsible for the mannose capping of ManLAM in M. tuberculosis, did not attenuate M. bovis BCG 111. Similarly, another study showed that M. bovis BCG lacking surface exposed mannose did not influence the immune response. Thus, these studies indicate that the relative importance of surface mannose varies among mycobacterial species. In the case of M. tuberculosis there is evidence that surface mannosylated biomolecules play a critical role in the recognition, intracellular survival and nature of the immune response of the bacillus in the host. In this context, we recently showed that clinical isolates of M. tuberculosis deficient in surface mannosylation were defective in phagocytosis by primary human macrophages when compared to the heavily mannosylated standard laboratory strains (i.e. M. tuberculosis H37Rv and Erdman strains) although those bacteria that did enter macrophages had a short doubling time under some conditions. Recent studies have led to the conclusion that M. tuberculosis is adapting to the human host by cloaking its cell wall molecules with terminal Man-α [1→2]-Man oligosaccharides that resemble the glycoforms of mammalian mannoproteins. Continued efforts to define the molecular events in the early interaction between M. tuberculosis and the human macrophage are necessary to further our understanding of the immunopathogenesis of TB and disease outcome. To identify a relationship between a group of clinical isolates of a distinct genetic lineage of M. tuberculosis and their phenotype with regard to cellular interactions is a first step to understanding how M. tuberculosis is evolving

Full Text Available On www.ijupbs.com

111 | P a g e International Standard Serial Number (ISSN): 2319-8141 to adapt to the human host. Phylogenetic studies have grouped clinical isolates that were found associated with large cluster outbreaks in geographical areas of high TB incidence. Some of these clinical isolates are hypervirulent in animal models and better able to bypass the protection afforded by the BCG vaccine. They may represent ―ancestor strains‖ within distinct phylogenetic lineages that have evolved in genetic isolation with little effective horizontal gene transfer. We have studied a few strains from these phylogenetic groups and found that some within the principal genetic group (PPG)-1 120 have a marked reduction in macrophage phagocytosis. This reduction resulted from significant alterations in M. tuberculosis cell envelope components as determined at the molecular level (limited exposed mannose and the presence of phenolic glycolipid and triacylglycerols) that impacted recognition by macrophage receptors and bacterialintracellular survival. These have speculated that these clinical isolates may be less adapted to the human host (more prone to disease development following infection). Thus propose a new model for the phagocytosis and host response of M. tuberculosis strains, where the amount and nature of mannose exposed on the surface are major determinants. M. tuberculosis strains with less surface mannosylation do not use the MR during phagocytosis by the human macrophage. Such strains have reduced phagocytosis, relying primarily on C3 opsonization and the more primitive CR3 pathway for entry. These strains are ―hypervirulent‖ in part due to the presence of other surface exposed cell envelope components [i.e. phenolic glycolipid and triacylglycerols] which regulate the cytokine response, and demonstrate rapid intracellular growth and marked tissue damage. Conversely, M. tuberculosis strains with abundant mannose on their surface have become more host-adapted in part by increasing surface mannosylation with mannans that resemble the glycoforms of eukaryotic mannoproteins that are normally removed from circulation by the homeostatic macrophage MR to maintain a healthy state. In support of this concept, M. tuberculosis was recently found to contain a mammalian mannosyltransferase homologue. Thus, more host-adapted M. tuberculosis strains may expose a large and heavily mannosylated ManLAM and greater amounts of higher-order PIMs that bind to the MR and other C-type lectins. Such strains are optimized

Full Text Available On www.ijupbs.com

112 | P a g e International Standard Serial Number (ISSN): 2319-8141 in phagocytosis by cooperatively engaging the MR and complement receptors. Use of the mannose-containing biomolecule/MR pathway provides a safe portal for M. tuberculosis within the macrophage by regulating the trafficking of bacteria and cytokine response. These strains grow more slowly in the macrophage and cause less tissue damage during infection. It speculate that such host-adapted strains would be highly successful in establishing an infection in humans but would more likely lead to the latent state rather than to an active disease state following infection. The concept that M. tuberculosis has evolved by increasing surface mannosylation as an adaptation to the host has support, but will require additional investigation. However, using biochemical and immunologic approaches, it is now possible to categorize genetically defined groups of M. tuberculosis for the potential relationship between strain genotype and disease phenotype. A final intriguing concept is the potential importance of the content and location of mannose present in different mycobacterial species. GDP-mannose has been described as the universal donor for the biosynthesis of mannose-containing biomolecules in mycobacterial species. Interesting to us is the knowledge that fast-growing, non-pathogenic mycobacteria contain cytosolic methylated- mannose polysaccharides (MMPs). Conversely, to date, the production of these polysaccharides in slow-growing mycobacteria like M. tuberculosis has not been reported. Rather, pathogenic mycobacteria contain cytosolic methylated-glucose polysaccharides (MGPs). Thus, the relative amount of mannose retained and/or sequestered in the cytosol versus that available for building mannosylated biomolecules in the mycobacterial cell envelope may also be an important evolutionary attribute. How GDP-mannose is used is likely to be linked to the species-specific expression of carbohydrate biosynthetic enzymes in different environments. In this context, there are still many unanswered questions about the location and functionality of the mannosecontaining biomolecules produced during infection in vivo. Based on the ideas raised in this review, we propose a model whereby mycobacterial strains differentially mannosylate their surface with α (1→2)-Manp oligosaccharides mimicking eukaryotic glycosidic forms. This mannosylation depends on the amounts of cytosolic GDP-Man and polyprenol-phosphate-mannose (PPM) and the

Full Text Available On www.ijupbs.com

113 | P a g e International Standard Serial Number (ISSN): 2319-8141 presence of the required glycosyltransferases to construct the mannose-containing biomolecules located on the surface of pathogenic mycobacterial strains. Only nonpathogenic mycobacterial species produce cytosolic MMPs. However, the role of these biomolecules is still unclear. It is possible that GDP-mannose produced by non- pathogenicmycobacteria is used mainly by its mannosyltransferases to produce lower-order PIMs and MMPs, the latter serving to store/sequester cytosolic mannose. This storage may limit the amount of PPM produced which serves as the mannose donor for mannosyltransferases involved in the production of cell envelope mannosylated biomolecules (i.e. higher-order PIMs, LM and ManLAM). The accumulation of lower-order PIMs and MMPs in nonpathogenic mycobacteria may also be related to the efficiency of their ppm1/ppm2 complex to generate PPM. Heavily mannosylated strains are optimally phagocytosed by human macrophages using both the MR and complement receptors resulting in an intracellular bacterial survival program that favors latency. In contrast, other M. tuberculosis strains have a cell envelope characterized by poor surface mannosylation and the presence of other virulence determinants such as phenolic glycolipid and triacylglycerols. These strains do not associate with the MR, but instead with CR3 and other receptors that lead to the induction of progressive lung pathology and a poor protective TH1 response. These strains have a ―hypervirulent‖ phenotype which favors progression from latency to active TB disease. Despite numerous reports regarding the effects of mannose- containing biomolecules on the immune response of macrophages, the precise structural motifs that mediate these responses remain largely unclear. These molecules have been studied mostly with in vitro systems, particularly with rodent cells, which differ in many respects from human cells. Further biochemical characterization of these molecules, including their production and metabolism inside macrophages and tissues, will further our understanding of their interactions with macrophages and their role in immunopathogenesis. Further definition of carbohydrate production and processing pathways in vivo that impact the immune response will also aid in the development of new molecular targets for diagnosis, therapy and vaccine development.[18-22]

Full Text Available On www.ijupbs.com

114 | P a g e International Standard Serial Number (ISSN): 2319-8141

3.11 The PhoP−PhoR two-component system of Mycobacterium tuberculosis: It plays an important role in the virulence of the pathogen and thus represents a potential drug target. To study the mechanism of gene transcription regulation by response regulator PhoP, we identified a high-affinity DNA sequence for PhoP binding using systematic evolution of ligands by exponential enrichment. The sequence contains a direct repeat of two 7 bp motifs separated by a 4 bp spacer, TCACAGC(N4)TCACAGC. The specificity of the direct-repeat sequence for PhoP binding was confirmed by isothermal titration calorimetry and electrophoretic mobility shift assays. PhoP binds to the direct repeat as a dimer in a highly cooperative manner. We found many genes previously identified to be regulated by PhoP that contain the direct-repeat motif in their promoter sequences. Synthetic DNA fragments at the putative promoter-binding sites bind PhoP with variable affinity, which is related to the number of mismatches in the 7 bp motifs, the positions of the mismatches, and the spacer and flanking sequences. Phosphorylation of PhoP increases the affinity but does not change the specificity of DNA binding. Overall, our results confirm the direct-repeat sequence as the consensus motif for PhoP binding and thus pave the way for identification of PhoP directly regulated genes in different mycobacterial genomes. The success of MTB as a pathogen relies on its ability to adapt to changing environmental conditions within the host through signal transduction systems, including two-component systems (TCS). TCS are major signaling systems in bacteria; they typically consist of a histidine kinase (HK) that senses external environmental signals and a response regulator (RR) that triggers the cellular response after being activated by its cognate HK. The MTB genome encodes TCS, of which the PhoPR TCS plays a major role in virulence, although the signals it senses are still unknown. The phoPR knockout strains of MTB have a severe attenuation of virulence, and two studies comparing transcriptomes of phoP knockout strains to their corresponding wild- type parents have identified more 170 genes whose expression is affected by PhoP. The phoP mutant lacks complex mycobacterial lipids implicated in MTB virulence, including sulfolipids, polyacyltrehaloses, and diacyltrehaloses. Furthermore, a point mutation in phoP contributes to the avirulent phenotype of the MTB H37Ra strain, by preventing secretion of

Full Text Available On www.ijupbs.com

115 | P a g e International Standard Serial Number (ISSN): 2319-8141 the ESAT-6 antigen, an important virulence factor and antigenic component of MTB.8−10 The important role of PhoPR in virulence makes this TCS an attractive target for developing anti-TB drugs11 and the phoPRinactivated MTB strains ideal candidates for new TB vaccine development. The MTB PhoP protein belongs to the OmpR/PhoB subfamily, the largest of the response regulators.15 PhoP consists of two distinct domains: an N-terminal receiver domain with a conserved phosphorylation site that receives a phosphate group from the cognate HK PhoR and a C-terminal effector domain that harbors a winged helix−turn−helix DNA binding motif. The effector domain binds to specific DNA sequences of the target promoters and interacts with the cellular transcription machinery. Most studies of the members of the OmpR/PhoB subfamily indicate that these RRs bind gene promoter DNA as dimers on direct-repeat sequences. Phosphorylation of OmpR enhances its dimerization, and thisdimerization enhancement is the energetic driving force for phosphorylation-mediated regulation of OmpR−DNA binding. However, KdpE, a member of the OmpR/PhoB family, binds independently to the half-sites of the target DNA sequences with equal affinity and no discernible cooperativity. The mechanism for the cooperativity in dimeric binding to DNA, or the lack of cooperativity in the case of KdpE, is currently unknown. Despite an extensive number of publications about MTB PhoP and its DNA binding, the consensus DNA sequence and the mechanism of sequence recognition remained obscure, thus preventing identification of direct targets of PhoP. Sarkar and colleagues identified a direct repeat of two 9 bp motifs in the promoters of phoP (GGCAGACTGTTAGCAGACTACTGGCAA CGAGC), pks2 (AGAACTAAAGAGCCACCA AAGACACAGCTACAT), and msl3 (also known as pks3) (CTGGTAGCGGCATGGCAACGGCCTGTGA), which they named DR1 and DR2 (underlined bases). The two motifs, DR1 and DR2, of the same gene promoter are somewhat similar, but they bear little resemblance among different gene promoters. Moreover, the direct-repeat motifs cannot be recognized in most of other gene promoters that bind PhoP. Cimino et al. studied the promoters of msl3, pks2, lipF, and fadD, and they added a new DR3 located a variable distance from DR1 and DR2, which includes the same problem of inconsistency. Recently, two independent studies identified partial sequence

Full Text Available On www.ijupbs.com

116 | P a g e International Standard Serial Number (ISSN): 2319-8141

motifs for PhoP binding in vivo, using results from chromatin immunoprecipitation sequencing (ChIP-seq). Solans et al. identified the motif as (C/T)(A/T)CAG(C/ G)NNN(T/C)(T/A)CACAG, and Galagan et al. identified the motif as CTGNGNNNNNGCTG. Given the importance of PhoP and its target genes to MTB virulence, it is essential to confirm definitively the PhoP DNA-binding sequence. Some studies identified the PhoP-binding consensus sequence as a direct repeat of a 7 bp motif separated by a 4 bp spacer by using a method of systematic evolution of ligands by exponential enrichment (SELEX). We extended the search of the PhoP targets against the whole MTB genome with the consensus sequence. The direct interactions between PhoP and its identified target promoter sequences were confirmed by using isothermal titration calorimetry (ITC) and an electrophoretic mobility shift assay (EMSA). Furthermore, gel filtration chromatography, analytical ultracentrifugation (AUC), and ITC analyses showed that PhoP binds its target promoter sequences as a dimer in a cooperative manner.[23-29] 3.12 Measuring genetic diversity in MTBC - Review of past and current tools: In the early 1990s, IS6110 RFLP was established as the first gold standard for fine typing of MTBC. During the following years, molecular epidemiological studies generated important new insights into the dynamics of transmission, relapse, and re-infection in TB. At the same time, as large international collections of MTBC strains began to accumulate, IS6110 RFLP analysis of these strain collections identified the first genotype ―families‖ among MTBC. These studies also highlighted that some of these strains were more successful than others, both in terms of the number of associated TB cases and in their geographic distribution. IS6110 RFLP typing remains used today, but it has recently been replaced as the official gold standard for epidemiological genotyping of MTBC by the PCR-based methods known as spoligotyping and MIRU-VNTR. These techniques have the advantage of requiring less DNA than RFLP, and produce data which can easily be digitalized and compared across laboratories. They also can be performed using crude lysates or directly from patient sputum, eliminating the need for culture and formal DNA extraction. Even though IS6110 RFLP, spoligotyping and MIRU-VNTR genotyping of MTBC have been invaluable for molecular

Full Text Available On www.ijupbs.com

117 | P a g e International Standard Serial Number (ISSN): 2319-8141 epidemiological studies, these techniques suffer from several drawbacks, including the propensity for convergent evolution, which limits their use for phylogenetics and strain classification. Genomic deletion analysis is another PCR-based method which has been developed to partially address these limitations. This method relies on the fact that ongoing horizontal gene transfer is essentially absent in MTBC, and genetic regions deleted from any given strain cannot be reacquired. As a result, genomic deletions, or large sequence polymorphisms (LSPs) behave as unique event polymorphisms and are therefore robust phylogenetic markers for MTBC. LSP-based analyses of global strain collections have shown that MTBC adapted to humans can be separated into six main lineages associated with different geographic regions and human populations. Although LSPs have proven to be ideal markers for strain classification, phylogenetic trees based on LSPs do not represent the complete picture. This is because most LSPs were originally identified through a one-way comparison to the laboratory strain H37Rv. By contrast, de novo DNA sequencing generates unbiased data, which can be used to infer phylogenies which are more likely to represent the true evolutionary history of MTBC. In this respect, it is important to highlight the difference between de novo DNA sequencing (i.e. SNP discovery) and SNP typing which is based on previously known SNPs. Various studies have published SNP-based phylogenies of MTBC in the past, but all of these studies suffer from one or several limitations, including the representativeness of the strain sample, the number of genes analysed, or the selection of SNPs used for typing. By contrast, a more recent study by Hershberg and colleagues performed de novo DNA sequencing of 89 genes in 108 globally representative MTBC strains. This study reported the most complete MTBC phylogeny to date. This study also highlighted the fact that human-adapted MTBC was more genetically diverse than previously thought, and that this diversity could be linked to human migrations. Most recently, a study by Comas et al. used next-generation DNA sequencing to compare the genomes of 23 MTBC strains. In addition to containing robust phylogenetic information, DNA sequence data can also be exploited to study the nature and strength of the selective forces shaping the genetic diversity within populations. Using such population genetics

Full Text Available On www.ijupbs.com

118 | P a g e International Standard Serial Number (ISSN): 2319-8141

approaches, Comas et al. found that, as expected, essential genes in MTBC were more evolutionary conserved than non-essential genes. Surprisingly however, and in contrast to most other pathogens where antigenic genes are under diversifying selection to escape host immunity, human T cell epitopes in MTBC were under strong purifying selection and more conserved than essential genes. These findings suggest that the recognition of MTBC by the human immune system might contribute to the transmission of the pathogen. Several other comparative genome sequencing studies of MTBC are currently under way. As whole genome sequencing is the most comprehensive and most discriminative technique to measure genetic diversity in MTBC, this technique should be used for phylogenetic analysis and classification of MTBC. Indeed, with the continuing reduction in DNA sequencing costs, which believes genome sequencing will soon be adopted as the next gold standard for routine epidemiological ―genotyping‖ of MTBC.[30-31] 3.13 SULFUR AND MYCOBACTERIAL SURVIVAL: To complete its lifecycle, M. tuberculosis must survive within the hostile, nutrient-poor and oxidizing environment of the host macrophage. At the same time, M. tuberculosis must activate sufficient immune effector functions to induce granuloma formation in the lung. This complex interplay between mycobacteria and the host immune system likely requires several host-pathogen interaction mechanisms and, once the granuloma has been formed, induction of metabolic pathways that allow the organism to persist. At present time, the metabolic requirements of mycobacteria in the context of the granuloma are not fully understood. However, genes involved in the metabolism of sulfur have consistently been identified as up-regulated in response to oxidative stress, nutrient starvation and dormancy adaptation (culture conditions that model aspects of mycobacterial life in the granuloma) and during macrophage infection. Sulfur is an essential element for life and plays a central role in numerous microbial metabolic processes. In its reduced form, sulfur is used in the biosynthesis of the amino acids cysteine and methionine. Cysteine is incorporated into biomolecules such as proteins, coenzymes, and mycothiol (the mycobacterial equivalent of glutathione). Found in all actinomycetes, mycothiol regulates cellular redox status and is essential for M. tuberculosis survival.

Full Text Available On www.ijupbs.com

119 | P a g e International Standard Serial Number (ISSN): 2319-8141

Another reduced sulfur-containing metabolite, coenzyme A (CoA), is heavily utilized for lipid metabolism (a process that is central to mycobacterial cell wall maintenance and remodeling). In its oxidized form, sulfur is present as a sulfuryl moiety (−SO3−) that can modify hydroxyls and amines in proteins, polysaccharides and lipids. Extracellular presentation of sulfated metabolites plays important regulatory roles in cell-cell and host- pathogen communication. Hence, acquisition and metabolism of sulfur is essential for mycobacterial virulence and survival. The identification of new antibacterial targets is essential to address MDR- and latent-TB infection. Toward this end, mycobacterial sulfur metabolism represents a promising new area for anti-TB therapy. Numerous studies have validated amino acid biosynthetic pathways and downstream metabolites as antimicrobial targets and sulfur metabolic pathways are required for the expression of virulence in many pathogenic bacteria. In particular, mutants in mycobacterial sulfur metabolism genes are severely impaired in their ability to persist and cause disease. Furthermore, most microbial sulfur metabolic pathways are absent in humans and therefore, represent unique targets for therapeutic intervention. In this review, we focus on the enzymes associated with the production of sulfated and reduced sulfur-containing metabolites in Mycobacteria. Small molecule inhibitors of these catalysts represent valuable chemical tools that can be used to investigate the role of sulfur metabolism in M. tuberculosis survival and may also represent new leads for drug development. In this light, we also highlight major efforts toward inhibitor discovery of mycobacterial sulfur metabolic pathways.[32] 3.14 SULFATE ASSIMILATION IN MYCOBACTERIA: Sulfate assimilation begins with 2- the active transport of inorganic sulfate (SO4 ) across the mycobacterial cell membrane by the CysTWA SubI ABC transporter complex. Once sulfate is imported, it is activated by ATP sulfurylase (encoded by cysND) via adenylation to produce adenosine-5‘- phosphosulfate (APS). In mycobacteria, APS lies at a metabolic branch point. For sulfation of biomolecules such as proteins, lipids and polysaccharides, APS is phosphorylated at the 3‘-hydroxyl by APS kinase (encoded by cysC) to form 3‘-phosphoadenosine-5‘- phosphosulfate (PAPS), the universal sulfate donor for sulfotransferases (STs). Transfer of

Full Text Available On www.ijupbs.com

120 | P a g e International Standard Serial Number (ISSN): 2319-8141

−SO3− to hydroxyl or amino functionalities of biomolecules plays important roles in regulation of cell-cell communication and metabolism. Alternatively, for production of 2- reduced sulfurcontaining metabolites, the sulfate moiety in APS is reduced to sulfite (SO3 ) by APS reductase (gene product of cysH). Sulfite is further reduced to sulfide (S2-) by sulfite reductase (encoded by nirA) and is the form of sulfur that is used for the biosynthesis of sulfur-containing metabolites including cysteine, methionine, coenzymes, and mycothiol. Each branch of sulfate assimilation is discussed in terms of the available genetic and biochemical data below.[33] 3.15 Sulfate Import and Activation: Present at 300-500 μM, inorganic sulfate is the fourth most abundant anion in human plasma. Sulfate transporters have been identified in all major human tissues investigated to date, and of particular relevance to the intracellular lifestyle of M. tuberculosis, the existence of endosomal-associated transporters has also been demonstrated. The genes encoding the CysTWA SubI ABC transporter complex in mycobacteria have been identified by homology to Escherichia coli and Salmonella typhimurium, are essential, robustly up-regulated during oxidative stress, dormancy adaptation, and expressed in macrophages [44]. Consistent with this annotation, cysA or subI mutants (ΔcysA or ΔsubI, respectively) in M. bovis bacillus Calmette-Guérin (BCG) – an attenuated, vaccine strain of M. bovis – are compromised in their ability to transport sulfate. When grown in media supplemented with casamino acids, the rate of sulfate transport in ΔcysA is ~1.1% relative to wild-type M. bovis BCG. The minor amount of transport is not enough to meet bacterial sulfur requirements and hence, these sulfate transport mutants are auxotrophic for reduced sulfur. Interestingly, no significant difference in the number of viable bacilli was observed in the organs of mice infected with ΔcysA and wild-type M. bovis BCG up to 63 days postinfection. These data indicate that M. bovis BCG may scavenge sufficient amounts of reduced sulfur from the host for survival. However, an important question raised from the findings of some studies is whether the sulfur requirements for an attenuated M. bovis strain reflect those of M. tuberculosis known to elicit a more potent host immune response. It is also possible that the mycobacterial genome encodes for an

Full Text Available On www.ijupbs.com

121 | P a g e International Standard Serial Number (ISSN): 2319-8141 additional sulfate transporter which is not expressed under culture conditions, but is specifically upregulated during infection. In support of this hypothesis, mRNA array analysis shows significant up-regulation of hypothetical protein 1739c (annotated as a putative high affinity sulfate transporter) during M. tuberculosis infection of macrophages in response to nitric oxide or hypoxia. Additional studies will be required to confirm the function of the putative sulfate transporter and its relevance to sulfate acquisition in vivo. Once sulfate is transported to the cytosol, ATP sulfurylase (encoded by cysD) catalyzes the first committed step in sulfate assimilation. In this reaction, the adenylyl moiety of adenosine 5‘-triphosphate (ATP) is coupled to sulfate. The product that results, APS, contains a unique high-energy phosphoric-sulfuric acid anhydride bond – the biologically activated form of sulfate. Formation of APS is energetically unfavorable (Keq of 10-7 – 10-8 near physiological conditions) and in prokaryotes, the hydrolysis of guanosine 5‘-triphosphate (GTP) is coupled to sulfurylation of ATP to surmount this energetic hurdle. The GTPase (encoded by cysN) forms a heterodimer with ATP sulfurylase (CysD) and synthesis of APS synthesis is driven 1.1 × 106-fold further during GTP hydrolysis. Notably, eukaryotic ATP sulfurylases do not bear any sequence or structural similarity to their prokaryotic counterparts, nor do they employ a GTPase for PAPS biosynthesis. These mechanistic and structural differences, in particular the unique G protein subunit, could be exploited to develop small molecule inhibitors of bacterial sulfate activation. The final step in PAPS biosynthesis is catalyzed by APS kinase (encoded by cysC). In this reaction, ATP is utilized to phosphorylate the 3‘- hydroxyl of APS. Depending on the organism, APS kinase can be encoded as a separate protein or as a fusion with ATP sulfurylase, without significant variation in catalytic mechanism. Most eukaryotes (including humans) encode for ATP sulfurylase (CysD) and APS kinase (CysC) on a single polypeptide. In M. tuberculosis, however, APS kinase (Cys C) is genetically fused to the GTPase subunit (CysN) of ATP sulfurylase. The APS kinase domain of M. tuberculosis CysNC was identified through sequence homology and confirmed by genetic complementation. In a subsequent report, a mutant strain of M. tuberculosis that removes the APS kinase domain of the bifunctional cysNC gene was constructed. As

Full Text Available On www.ijupbs.com

122 | P a g e International Standard Serial Number (ISSN): 2319-8141

expected, the cysC knockout (ΔcysC) was able to grow on sulfate as a sole sulfur source (indicating a functional ATP sulfurylase), but was unable to synthesize PAPS. Fusion of APS kinase to the GTPase domain of ATP sulfurylase raised the interesting possibility of substrate channeling between subunits. In this scenario, the final product PAPS, and not the APS intermediate, would be released into solution. Leyh and colleagues have recently tested this hypothesis for M. tuberculosis ATP sulfurylase. Although PAPS synthesis is 5,800 times more efficient than APS synthesis, these studies demonstrate that APS is not channeled from the M. tuberculosis adenylyl-transferase to the APS kinase domain, consistent with the domain arrangement proposed from a recent crystal structure of the CysNC complex. Collectively, CysNC and D proteins form a multifunctional enzyme complex ~300 KDa (consistent with a trimer of CysNC•D heterodimers), referred to as the sulfate-activating complex (SAC). In M. tuberculosis, expression of the SAC operon is induced by conditions likely to be encountered by pathogenic mycobacteria within the macrophage, including sulfur limitation, oxidative stress, and is repressed by cysteine. The SAC operon is also up- regulated during stationary phase growth, an in vitro model of persistent M. tuberculosis infection. M. tuberculosis SAC gene expression is also augmented within the intracellular environment of the macrophage. Taken together, these data are consistent with increased activity of sulfate-activating enzymes and flux through the sulfate assimilation pathway during mycobacterial infection.[34-35] 3.16 Sulfotransferases and Sulfation: Sulfotransferases (STs), the enzymes that install sulfate esters, transfer sulfate from PAPS (produced by the SAC) to a hydroxyl or, less frequently, to an amide moiety on glycoproteins, glycolipids and metabolites. Sulfated metabolites are abundant in higher eukaryotes, particularly mammals, where they function primarily in cellcell communication. For example, sulfated glycoproteins mediate interactions of leukocytes with endothelial cells at sites of chronic inflammation, sulfated peptides such as hirudin and cholecystokinin act as hormones, and sulfated glycolipids are involved in neuronal development. In contrast, reports of sulfated metabolites in prokaryotes have been rare. In 1992, Long and colleagues reported the first functionally characterized

Full Text Available On www.ijupbs.com

123 | P a g e International Standard Serial Number (ISSN): 2319-8141 sulfated metabolite from the prokaryotic world – the nodulation factor NodRm-1 from Sinorhizobium meliloti. This sulfated glycolipid is secreted from the bacterium and acts on host plant cell receptors thereby initiating symbiotic infection. Among pathogenic bacteria, only one family has been reported to produce sulfated metabolites – the Mycobacteria. More than 40 years ago, Goren and coworkers isolated an abundant sulfated glycolipid from the M. tuberculosis cell wall and characterized the structure. Termed sulfolipid-1 or SL-1, this compound has only been observed in the tuberculosis complex; it is absent from non- pathogenic mycobacteria such as M. smegmatis. Comprising a trehalose-2-sulfate (T2S) core modified with four fatty acyl groups, SL-1 accounts for almost 1% of the dry weight of M. tuberculosis. Early studies found a correlation between the abundance of SL-1 and the virulence of different clinical M. tuberculosis isolates and its location in the outer envelope has prompted speculation that it may be involved in host-pathogen interactions. The exact function of SL-1, however, remains elusive. Nonetheless, the biosynthetic pathway for SL-1 has recently been elucidated and a comprehensive study of mutants in SL-1 biosynthesis should help clarify the role of this sulfated glycolipid in the mycobacterial lifecycle. In addition to SL-1, other novel sulfated metabolites have been identified in M. tuberculosis using an innovative metabolomic approach that combines genetic engineering, metabolic 2- labeling with a stable sulfur isotope (34SO4 ) together with mass spectrometry analysis. Structurally distinct sulfated metabolites have also been identified in several other mycobacterial species, including M. smegmatis, M. fortuitum, and the HIV-associated opportunistic pathogen M. avium. Interestingly, in M. avium a sulfated cell wall glycopeptidolipid was recently found to be up-regulated in HIV patients with acquired drug resistance. Significant work remains to fully characterize and elucidate the biological significance of sulfated metabolites found in mycobacteria. A major step toward this objective is to define the biosynthetic pathways of mycobacterial sulfated metabolites, including the STs responsible for installing the sulfuryl moiety. In 2002, an analysis of mycobacterial genomes reported by Mougous and colleagues revealed a large family of open reading frames with homology to human carbohydrate sulfotransferases. The predicted

Full Text Available On www.ijupbs.com

124 | P a g e International Standard Serial Number (ISSN): 2319-8141 proteins shared regions of sequence homology associated with binding to their common substrate, PAPS. Presently, four such genes have been identified in M. tuberculosis (annotated as stf0-3) and the M. avium genome encodes nine putative STs (stf0, 1, 4-10). To date, of the 11 predicted STs found in mycobacterial genomes, genetic and biochemical studies have only been reported for Stf0 and Stf3. Stf0 is present in a number of other pathogenic bacteria and initiates the biosynthesis of SL-1 by sulfating the disaccharide, trehalose, to form T2S. A knockout mutant of stf0 has been reported in M. tuberculosis [96]. This study demonstrates that Stf0 is not required for survival in liquid culture, hinting toward a specific role in host infection. The structure of stf0 in complex with trehalose has recently been reported and has revealed several interesting features. In the presence of trehalose, Stf0 forms a dimer both in solution and in the crystal structure. Moreover, Stf0-bound trehalose participates in the dimer interface, with hydroxyl groups from a glucose residue bound in one monomer forming interactions with the other monomer. Residues involved in substrate binding and dimerization have been identified, along with a possible general base (i.e., Glu36) that may facilitate nucleophilic attack of the 2‘-hydroxyl group on PAPS. A panel of synthetic glucose and trehalose analogs has also been tested for binding revealing that any modification to the parent disaccharide compromises substrate sulfation. Finally, a kinetic study of the enzyme using MS has also been reported. The results address the order of substrates binding and are consistent with a random sequential mechanism involving a ternary complex with both PAPS [or 3‘-phosphoadenosine-5‘-phosphate, (PAP)] and trehalose (or T2S) bound in the active site. Stf3 may play a regulatory role in M. tuberculosis virulence [98]. In a mouse model of TB infection, a mutant strain in which Stf3 was disrupted (Δstf3) was unable to produce a sulfated molecule termed, ―S881‖. Interestingly, when compared to wild-type M. tuberculosis, Δstf3 exhibited a hypervirulent phenotype. No relatives of the remaining stf family members are found in any other prokaryotic genomes, suggesting that they are unique to mycobacteria. Substrates for the majority of mycobacterial STs remain to be elucidated.[36-37]

Full Text Available On www.ijupbs.com

125 | P a g e International Standard Serial Number (ISSN): 2319-8141

3.17 Oxidative Antimicrobial Activity: In order to replicate and persist in its human host, M. tuberculosis must survive within the hostile environment of the macrophage, where ·− bactericidal oxidants - superoxide (O2 ) and nitric oxide (NO·) – are generated in response to infection. Two enzymes, nicotinamide adenine dinucleotide phosphate-oxidase (NADPH

oxidase) and inducible nitric oxide synthase (NOS2), are largely responsible for production of these reactive oxygen and nitrogen intermediates (termed ROI and RNI, respectively). ·− NADPH oxidase is a membrane protein that generates O2 by transferring electrons from NADPH inside the cell across the phagosomal membrane; the electrons are coupled to

molecular oxygen to produce O2·−. Subsequently, O2·− can accept an electron spontaneously or be reduced by superoxide dismutase (SOD) to form hydrogen peroxide (H2O2). In turn, H2O2 can oxidize cellular targets or be converted into the highly damaging hydroxyl radical (OH·) through the iron-catalyzed Fenton-Haber-Weiss reaction. In the NOS2 reaction, the guanidino nitrogen of arginine undergoes a five-electron oxidation via a N-ω-hydroxy-L- arginine (NOHLA) intermediate to yield ·NO. The combination of the two oxidant- generating systems can also exert a synergistic effect in bacterial killing as macrophages can − generate O2·− simultaneously with ·NO, yielding the more reactive peroxynitrite (ONOO ).

A consequence of NADPH and NOS2 enzymatic activities and the resulting ―oxidative burst‖ is that phagocytosed bacteria are killed by oxidative damage to a range of protein and DNA

targets. In mice, activation of macrophages induces production of NOS2 and phagosomal NADPH oxidase, via ligation of toll-like receptors (TLRs), or via stimulation by the cytokines IFN-γ or TNF-α. In mouse models of TB, numerous studies have demonstrated

that NOS2 plays an essential role in controlling persistent infection. Macrophages can inhibit

mycobacterial growth via NOS2-generated RNI, inhibition of NOS2 during persistent infection leads to reactivation of disease, and NOS2 gene-disrupted mice are extremely susceptible to TB infection. More recently, a proteomics study has identified proteins in M. tuberculosis that are targeted by RNI stress. Notably, many essential metabolic and antioxidant defense enzymes are among those proteins found modified for RNI. While good evidence exists for ROI-mediated bacterial killing of other bacterial, fungal and parasitic

Full Text Available On www.ijupbs.com

126 | P a g e International Standard Serial Number (ISSN): 2319-8141

pathogens, their bactericidal effect on mycobacteria has been less clear. Studies demonstrate that M. tuberculosis resists killing by ROI in vitro and that mice with defects in p47 or gp91 subunits of phagocyte NADPH oxidase (Phox) are also relatively resistant to TB infection. However, NADPH oxidase is highly active during the persistent phase of M. tuberculosis infection in mice. This observation suggests that M. tuberculosis must possess extremely effective detoxification pathways to counter ROI stress. Consistent with this hypothesis, mice deficient in the KatG catalase-peroxidase survived better in pg91phox-deficient mice. More recently, it was shown that macrophages deficient in early stages of Phox assembly exhibited reduced bacterial killing, correlating with decreased production of ROI. Taken together, these observations indicate that survival of M. tuberculosis within macrophages depends upon the ability of the bacterial to counter oxidative assault. Mycobacteria produce enzymes such as SOD, peroxidases, catalase, and nitrosothiol reductase to help counteract the effect of ROI/RNI and promote intracellular survival and persistence in the host. In addition to enzymatic detoxification of ROI and RNI, reduced sulfur-containing metabolites are an essential component of bacterial antioxidant defense systems. Specifically in mycobacteria, low molecular-weight thiols such as mycothiol, play a central role in maintaining a reducing cellular environment. Proper redox homeostasis is essential for normal cellular function and to mitigate the effects of oxidative stress. Hence, the metabolic route used for the production of reduced sulfur-containing metabolites is predicted to be important for mycobacterial survival. Consistent with this hypothesis, expression of mycobacterial genes involved in reductive sulfate assimilation are induced by oxidative stress and within the environment of the macrophage.[38-39] 3.18 Sulfate Reduction: APS reductase (encoded by cysH) catalyzes the first committed step 2- in the biosynthesis of reduced sulfur compounds. In this reaction, APS is reduced to SO3 and adenosine-5‘-phosphate (AMP). Thioredoxin (Trx), a 12.7 kDa protein with a redox active disulfide bond, supplies the reducing potential necessary for this two-electron 2- reduction. The SO3 product of this reaction is reduced further to S2-, which is used for the biosynthesis of reduced sulfur-containing metabolites, such as cysteine, methionine, CoA,

Full Text Available On www.ijupbs.com

127 | P a g e International Standard Serial Number (ISSN): 2319-8141 iron-sulfur clusters and mycothiol. Consistent with its important metabolic role, APS reductase was identified in a screen for essential genes in M. bovis BCG and cysH is actively expressed during the dormant phase of M. tuberculosis and in the environment of the macrophage. Humans do not reduce sulfate for de novo cysteine biosynthesis and therefore, do not have a CysH equivalent. Thus, APS reductase may be an attractive drug target if the enzyme is required for bacterial survival or virulence in vivo. To test this hypothesis, Senaratne and coworkers generated an M. tuberculosis mutant strain lacking CysH (ΔcysH). As predicted, the mutant strain was auxotrophic for cysteine and could only be grown in media supplemented with this amino acid, methionine or glutathione (from which cysteine can be generated catabolically). The cysH mutant exhibited attenuated virulence in BALB/c and C57BL/6 immunocompetent mice. Growth kinetics in the lungs, spleen and liver of mice infected with ΔcysH or wild-type M. tuberculosis were also quantified. Strikingly, the number of colony-forming units recovered from the ΔcysH mutant mirrored those of wild- type M. tuberculosis during the acute stage of infection [up to 16 days postinfection (pi). However, the number of viable bacteria in the mutant became significantly less (i.e., by 3 orders of magnitude) coincident with the emergence of adaptive TH1- mediated immunity and the induction of persistence in the mouse (between 16 and 42 days pi). In addition, ΔcysH was most compromised in the liver, where the host‘s oxidative antimicrobial response is thought to play an especially important role in antimicrobial defense. Since the replication of ΔcysH in mouse tissues during the first 16 days post infection was identical to that of wild-type, these data suggest that mouse tissues can provide M. tuberculosis with sufficient reduced sulfur-containing amino acids (e.g., cysteine and methionine), for initial growth. Hence, APS reductase activity appears to be dispensable during the acute phase of infection, but indispensable in the later, persistence phase where access to or supply of reduced sulfur- containing nutrients becomes limiting. As discussed above, NOS2 plays a vital role in controlling persistent M. tuberculosis infection in mice. In order to test the role of APS reductase in protecting the bacteria against the effects of NOS2, NOS2-/- mice were infected with wild-type and ΔcysH M. tuberculosis. In contrast to the observation made in wild-type

Full Text Available On www.ijupbs.com

128 | P a g e International Standard Serial Number (ISSN): 2319-8141 mice, ΔcysH did not lose viability after the first 21 days pi in NOS-/- mice; all mice succumbed to infection within 26 to 31 days. Thus, ΔcysH is significantly more virulent when NOS2 is absent. Taken together, these studies indicate that APS reductase plays a central role in protecting M. tuberculosis against the effects of reactive nitrogen species produced by NOS2 and is critical for bacterial survival in the persistence phase of infection in mice. Furthermore, a follow-up study demonstrates that immunization of mice with ΔcysH generates protection equivalent to that of the BCG vaccine in mice infected with M. tuberculosis. Attenuation of ΔcysH in a mouse model of M. tuberculosis infection and the importance of APS reductase in mycobacterial persistence further motivated investigation of the molecular details of the reaction catalyzed by APS reductase. Biochemical, spectroscopic, mass spectrometry and structural investigation of APS reductase support a two-step mechanism, in which APS undergoes nucleophilic attack by an absolutely − conserved cysteine to form an enzyme S-sulfocysteine intermediate, E-Cys-Sγ−SO3 . In a 2− subsequent step, SO3 is released in a Trx-dependent reaction. During the catalytic cycle, nucleophilic attack at Sγ atom of the S-sulfocysteine intermediate results in the transient formation of a mixed disulfide between Trx and APS reductase, with concomitant release of sulfite. The structure of this complex has recently been reported and reveals a unique protein-protein interface as a potential candidate for disruption for small molecule or peptide inhibitors. In addition to the conserved catalytic cysteine, the primary sequence of APS reductase is also distinguished by the presence of a conserved iron-sulfur cluster motif, -

CysCys-X~80- CysXXCys-. Biochemical studies demonstrate that the four cysteines in this motif coordinate a [4Fe-4S] cluster, and that this cofactor is essential for catalysis. The first structure of an assimilatory APS reductase was recently reported, with its [4Fe-4S] cluster intact and APS bound in the active site. Consistent with prior biochemical observations, the structure revealed that APS binds in close proximity to the iron-sulfur center. Hence, compounds that target the metal site may represent promising approaches toward rational inhibitor design. This approach is actively being explored, as well as inhibitors that target the Trx-APS reductase interface and will be reported in due course. The final step in sulfate

Full Text Available On www.ijupbs.com

129 | P a g e International Standard Serial Number (ISSN): 2319-8141

2- 2- reduction, the six electron reduction of SO3 to S , is catalyzed by sulfite reductase (encoded by nirA). Like cysH, nirA is an essential gene and is active during the dormant

phase of M. tuberculosis. The sulfite reductase in M. tuberculosis belongs to the family of ferredoxin-dependent sulfite/nitrite reductases. These enzymes contain a [4Fe-4S] center and

a siroheme. In this reaction, the external electron donor (likely ferredoxin) binds transiently

to sulfite reductase and transfers electrons to the [4Fe-4S] center, one at a time.

Subsequently, sulfite reduction is accomplished by transferring electrons from the cluster to

the siroheme, which coordinates the sulfite substrate. In 2005, Schnell and coworkers

reported the structure of M. tuberculosis NirA. Interestingly, the structure depicts a covalent

bond between the side chains of residues Tyr69 and Cys161 adjacent to the siroheme in the

active site of sulfite reductase. Site-directed mutagenesis of either residue impairs catalytic

activity, though their involvement in the mechanism of sulfite reduction is presently unknown.[40-41] 3.19 Cysteine Biosynthesis: De novo cysteine biosynthesis in mycobacterium occurs via condensation of S2- with Oacetyl- L-serine (synthesized by cysE, a serine acetyl transferase). The M. tuberculosis genome contains three O-acetylserine sulfhydrylase genes, cysM, cysK and cysM3 that can catalyze this reaction. Notably, cysE and cysM are essential for survival in a mouse model of M. tuberculosis infection or in primary macrophages, respectively; cysM is also up-regulated under oxidative stress conditions. In 2005, Burns and colleagues presented in vitro evidence for an additional pathway to make cysteine from sulfide. In this pathway, a sulfide carrier protein, CysO, is converted into a thiocarboxylate by MoeZ (Rv3206), and then alkylated by O-acetyl serine in a reaction catalyzed by CysM. Subsequently, an S–N acyl rearrangement takes places to afford CysO-cysteine which is hydrolyzed by Mec+ (Rv1334) to release cysteine and regenerate CysO. An appealing feature of this pathway is that a protein-bound thiocarboxylate would be much more stable to oxidative species in the macrophage, relative to free sulfide. Analysis of mRNA expression demonstrates that each of these genes is up-regulated during exposure to toxic oxidants. Like most organisms, mycobacteria do not have large pools of free cysteine. Once cysteine is

Full Text Available On www.ijupbs.com

130 | P a g e International Standard Serial Number (ISSN): 2319-8141

produced it is rapidly utilized in protein synthesis, or for the biosynthesis of methionine and reduced sulfur containing cofactors. The most abundant thiol metabolite in mycobacteria (present in millimolar concentrations) is mycothiol. Found in all actinomycetes, mycothiol is essential for M. tuberculosis survival and intracellular levels of this thiol are associated with changes in resistance to antibiotics and oxidative stress.[42] 3.20 Mycothiol: Mycothiol (MSH) or 1D-myo-inosityl 2-(N-acetyl-L-cysteinyl) amido-2- deoxy-α-Dglucopyranoside, is an unusual conjugate of N-acetylcysteine (AcCys) with 1D- myo-inosityl 2-acetamido-2-deoxy-α-D-glucopyranoside (GlcNAc-Ins), and is the major low-molecular mass thiol in most action-mycetes, including mycobacteria. MSH is the functional equivalent of glutathione (GSH) in mycobacteria and is associated with the protection of M. tuberculosis from toxic oxidants and antibiotics. Interestingly, the thiol in MSH undergoes copper-ion catalyzed autoxidation 30-fold more slowly than cysteine and 7- fold more slowly than glutathione. Thus, high concentrations of cellular MSH may increase the capacity of actinomycetes to mitigate the negative effects of oxidative stress. Apart from protection against toxic oxidants, M. tuberculosis relies upon MSH for growth in an oxygen- rich environment and for establishing the pattern of resistance to isoniazid and rifampin.[43] 3.21 Overview of Mycothiol Biosynthesis: Over a series of seminal papers, R. C. Fahey, G. L. Newton and Y. Av-Gay have elucidated the biosynthetic pathway of MSH. Production of MSH begins from the biosynthesis of 1L-myo-inositol 1-phosphate (1L-Ins-1-P), produced from glucose-6- phosphate in a reaction catalyzed by inositol-1-phosphate synthase (Ino1). From this precursor, five enzymes catalyze the conversion of 1L-Ins-1-P to MSH. In the first step, a glycosyl-transferase, MshA, catalyzes the reaction between a UDP-N- acetylglucosamine (UDP-GlcNAc) and 1L-Ins-1-P, generating UDP and 1-O-(2-acetamido- 2-deoxy-α-Dglucopyranosyl)- D-myo-inositol 3-phosphate (GlcNAc-Ins-P). A phosphatase, as yet uncharacterized, but designated MshA2, dephosphorylates GlcNAc-Ins-P to produce 1-O- (2-acetamido-2-deoxy-α-D-glucopyranosyl)-D-myo-inositol (GlcNAc-Ins), the substrate for MshB. In the next step, GlcNAc-Ins is deacetylated by MshB to yield 1-O-(2- amino-1-deoxy-α-D-glucopyranosyl)-D-myo-inositol (GlcN-Ins) [158]. Subsequently, MshC

Full Text Available On www.ijupbs.com

131 | P a g e International Standard Serial Number (ISSN): 2319-8141

catalyses the ATP-dependent ligation of L-cysteine to GlcN-Ins to produce 1-O-[[(2R)-2- amino-3-mercapto-1-oxopropyl]amino]-2-deoxy-α-D-glucopyranosyl)-D-myo-inositol (Cys- GlcN-Ins). In the final step, N-acetylation of Cys-GlcN-Ins with acetyl-CoA is catalyzed by MshD to afford MSH. The total chemical synthesis of MSH has also been reported. The genes encoding the enzymes responsible for MSH biosynthesis have been identified using a variety of methods including transposon and chemical mutagenesis. In turn, these mutants have been utilized to determine the indispensability of the respective genes in the biosynthesis of MSH and their consequence on the viability of mycobacteria. Significant progress in the biochemical characterization of these enzymes has also been made.[44] 3.22 Mycothiol Biosynthetic Enzymes: The gene encoding the glycosyltransferase, MshA was first identified as a transposon mutant in M. smegmatis that did not produce measurable amounts of GlcNAc-Ins and MSH. By virtue of homology, MshA belongs to the known CAZy family 4 glycosyltransferases, which includes a number of sucrose synthases, mannosyl transferases and GlcNAc transferases. This classification strongly suggested that MshA is the glucosyltransferase required for the biosynthesis of GlcNAc-Ins. M. smegmatis and M. tuberculosis mshA sequences were shown to be 75% identical over a 446-residue overlap. The M. tuberculosis mshA ortholog, Rv0486, complemented the mutant phenotype in M. smegmatis, thereby confirming its function. In M. smegmatis and M. tuberculosis, mshA is essential for production of GlcNAc-Ins and therefore, for MSH synthesis. Interestingly, however, transposon mutants in mshA are viable in M. smegmatis, whereas in M. tuberculosis mshA is essential for growth. The gene encoding the phosphatase, MshA2, remains to be identified. MshB was the first gene identified in the MSH biosynthetic pathway. The deacetylase is encoded by the M. tuberculosis open reading frame Rv1170 and was first discovered as a homolog of Rv1082, a mycothiol S-conjugate amidase (Mca). Although MshB does exhibit some amidase activity, deacetylation of GlcNAc-Ins is the preferred reaction. Characterization and crystallographic studies have revealed that MshB is a Zn2+ metalloprotein and that deacetylase activity is dependent on the presence of a divalent metal cation. Disruption of mshB results in decreased production of MSH (limited to about

Full Text Available On www.ijupbs.com

132 | P a g e International Standard Serial Number (ISSN): 2319-8141

5-10% of the parental M. smegmatis strain and 20% that of the parental M. tuberculosis strain during log-phase growth, increasing to 100% of the wild-type MSH levels during the stationery phase). Hence, MSH synthesis is not abolished in mshB mutants and, in the absence of MshB, MSH biosynthesis is accomplished via an alternative deacetylase activity that produces modest levels of GlcN-Ins. Under culture conditions, the amount of MSH produced in mshB mutants during log phase growth is sufficient to provide MSHdependent resistance to moderate oxidative stress. In addition, since normal quantities of MSH are produced in mshB mutants during stationary phase, it was not possible to examine the role of MSH during dormancy-like conditions in these studies. The role of MshC involving ATP- dependent ligation of L-cysteine with GlcN-Ins was first elucidated by Bornemann and coworkers. First identified in M. smegmatis, homologs of mshC have been identified in Streptomyces coelicolor A3, Corynebacterium striatum and orthologs of M. tuberculosis MshC (Rv2130c) were also found in M. leprae, M. bovis, and in M. avium. Interestingly, the enzyme encoded by mshC appears to have evolved by gene duplication of the cysteinyl- tRNA synthetase, cysS (Rv3580c) as evidenced by their similar mechanism of action. In the reaction catalyzed by MshC, the 2‘ amine of GlcN-Ins carries out nucleophilic attack of an activated cysteinyl-AMP intermediate to produce Cys-GlcN-Ins. Presumably, a general base removes a proton from the amino group leading to the formation of a tetrahedral intermediate, which decomposes to form the amide. In M. smegmatis, chemical and transposon mutants lacking MshC activity do not produce detectible amounts of MSH. In the chemical mutants, mshC was sequenced and a point mutation (Leu205Pro) was identified. This region in MshC is largely conserved among actinomycetes and hence, the Leu205Pro substitution was concluded to be responsible for the lack of MshC activity in the mutant. In contrast to M. smegmatis that does not require MSH for growth, a targeted disruption of mshC in M. tuberculosis Erdman produced no viable clones possessing either the disrupted mshC gene or reduced levels of MSH. Thus, the mshC gene is required for MSH production and is essential for M. tuberculosis Erdman survival. The differences in the responses of the mutants between the two strains of mycobacteria could be attributed to the fact that M.

Full Text Available On www.ijupbs.com

133 | P a g e International Standard Serial Number (ISSN): 2319-8141

smegmatis has a larger genome (7 vs. 4.4 Mb) relative to M. tuberculosis and therefore, includes genes that facilitate its growth in the absence of MSH. MshD catalyzes the final step in MSH biosynthesis. In this reaction, Cys-GlcN-Ins is acetylated using acetyl-CoA. mshD was identified during the characterization of a M. smegmatis transposon mutant lacking the transacetylase activity required for MSH biosynthesis. Sequencing from the site of insertion identified the gene that encodes for mycothiol synthase or MshD. A homology search revealed a mshD ortholog in M. tuberculosis as Rv0819 and exhibits MSH synthase activity when expressed in E. coli. A crystal structure of MshD from M. tuberculosis showed structural homology to the GNAT family of N-acetyl-transferases. MshD mutants in M. smegmatis produce high levels of Cys-GlcN-Ins along with two other thiols, N-formyl-Cys- GlcN-Ins (fCys-GlcN-Ins) and N-succinyl-Cys-GlcN-Ins (succ-Cys-GlcN-Ins) and ~1% the amount of MSH found in the wild-type strain. These data suggest that in the absence of mshD, mycobacteria can make use of closely related analogs of MSH such as fCys-GlcN-Ins to maintain a reducing environment in the cells. This hypothesis is further supported by the observation that mshD transposon mutants in M. smegmatis are as resistant to peroxide- induced oxidative stress as their parental strain. On the other hand, M. tuberculosis mshD mutants appear to grow poorly under other stress conditions such as low-pH media or in the absence of catalase and oleic acid.[45] 3.23 Mycothione Reductase: To maintain a large cellular pool of reduced MSH, mycothione reductase catalyzes the reduction of oxidized MSH also known as mycothione (MSSM). M. tuberculosis MSH disulfide reductase (Mtr, encoded by Rv2855) was identified by homology to glutathione reductases. Mtr is a member of the pyridine nucleotidedisulfide reductase superfamily. The reductase is a homodimeric flavoprotein disulfide isomerase and requires FAD as a cofactor. NADPH reduces FAD, which then transfers reducing equivalents to the redox-active disulfide in Mtr to generate a stable twoelectron reduced enzyme. Subsequently, Mtr reduces the disulfide in MSSM via dithiol-disulfide interchange, with concomitant oxidation of NADPH. Phenotypic characterization of an actinomycete mtr mutant has not been reported to date and genome-wide transposon mutagenesis has yielded

Full Text Available On www.ijupbs.com

134 | P a g e International Standard Serial Number (ISSN): 2319-8141

conflicting results. In one study, a transposon mutant in M. tuberculosis mtr was reported to be viable. In contrast, another study using high-density Himar-1 transposon mutagenesis reported that mtr is essential for M. tuberculosis survival. One possible explanation for these conflicting data could be the relative importance of (or requirement for) Mtr in MSH reduction during different stages of growth. Transcriptional analysis of M. bovis BCG reveals that mtr mRNA is actively transcribed during exponential bacterial growth. In the same study, mtr mRNA expression was absent in the stationery phase suggesting that Mtr might only be required to maintain the redox balance during intense periods of metabolic activity (e.g., during the growth phase). However, another study found high MSH levels throughout the growth cycle, including the stationery phase. These findings suggest that, in the absence of Mtr, another thiol reductase might reduce MSSM. Additional experiments will be required to clarify the importance of Mtr in MSH reduction throughout the mycobacterium lifecycle and to determine whether or not it is essential for bacterial viability.[46] 3.24 Mycothiol-S-conjugate Amidase: In mycobacteria, mycothiol-S-conjugate Amidase (Mca) plays a major role in electrophile detoxification. This enzyme was discovered in connection with its ability to detoxify a thiol-specific fluorescent alkylating agent, monobromobimane (mBBr), a compound commonly used for the quantitative determination of thiols. mBBr binds to MSH forming a MSH-mBBr adduct, MSmB and can be cleaved by Mca to produce glucosaminyl inositol and acetyl cysteinyl bimane, a mercapturic acid which is rapidly excreted from the cell. Mca was first purified from M. smegmatis and has an ortholog in the M. tuberculosis genome, Rv1082, identified by N-terminal amino acid sequencing. Studies probing the substrate specificity of Mca indicate that the enzyme specifically recognized the MSH moiety in the conjugate, but is relatively non-specific for the group attached to the sulfur in the MSH-toxin conjugate. Mca and mshB exhibit an overall sequence identity of 32%. Interestingly, in vitro studies indicate that MshB possesses amidase activity with MSH substrate. Moreover, Mca can function as a deacetylase and partially restored MSH production when introduced into an M. Smegmatis mshB mutant.

Full Text Available On www.ijupbs.com

135 | P a g e International Standard Serial Number (ISSN): 2319-8141

Based on the sequence identity between Mca and MshB and the crystal structure of MshB, a model for the active site of Mca has been proposed [171,172]. With the exception Lys19 in Mca replaced by Ser20 in MshB, other critical catalytic residues, including the zinc-binding site and an aspartate are perfectly conserved. The Lys to Ser alteration may play an important role in disaccharide binding; a crystal structure of Mca will be important to define the MSH binding site. Apart from the mBBr model substrate, the substrates for Mca include the MSH conjugate of cerulenin, an antibiotic that inhibits fatty acid synthetase and other antibiotic adducts. Mcahomologs have been found in several antibiotic biosynthesis operons such as those for avermectin (Streptomyces avermitilis) and eythromycin (Saccharopolyspora erythrae). In addition, it has been demonstrated that MSH forms a conjugate with Rifamycin SV and this complex is a substrate for M. tuberculosis Mca. Treatment of mca mutant and wild-type M. smegmatis strains with Rifamycin SV showed that the MSH-Rifamycin SV adduct is converted to mercapturic acid only in the wild-type. Taken together, these findings demonstrate that MSH and Mca in mycobacteria work together to detoxify antibiotics.[47] 3.25 Drug Targets in Mycothiol Metabolism: Mca plays a critical role in mycobacterial detoxification of antibiotics. Therefore, inhibitors of Mca could enhance the sensitivity of MSH-producing bacteria to antibiotics, establishing Mca as a promising new drug target. Toward this end, 1,500 natural product extracts and synthetic libraries were screened to identify lead compounds. Two classes of bromotyrosine-derived natural products were competitive inhibitors of Mca; non-competitive inhibitors were also identified in this screen. These results motivated the total synthesis of a competitive inhibitor that inhibits Mca with

an IC50 value of 30 μM. Recently, a series of compounds based on the structure of the natural product bromotyrosine inhibitor were synthesized and screened against mycobacteria and other gram-positive bacteria. One of the lead compounds identified from this study termed, EXEG1706, exhibited low minimum inhibitory concentrations (2.5 – 25 μg ml-1) for M. smegmatis, M. bovis and against methicillin-sensitive and -resistant Staphylococcus aureus, and S. aureus. However, this class of compounds was also active against

Full Text Available On www.ijupbs.com

136 | P a g e International Standard Serial Number (ISSN): 2319-8141

mycobacterial Mca mutant strains and against gram-positive bacteria that do not produce MSH. Thus, in addition to Mca, it appears that these compounds inhibit other protein targets in vivo. Another approach used to identify Mca inhibitors has been the synthesis of MSH analogs. Synthesis of a simplified thioglycosidic analog of MSH and a variety of amide- functionalized MSH analogs synthesized from quinic acid led to the identification of

inhibitors with modest inhibitory activities (IC50 values around 50 μM). In addition to Mca, other possible drug targets that could block MSH biosynthesis are the enzymes encoded by mshA and mshC (both essential genes in M. tuberculosis). The identification of inhibitors for MshC has been initiated and identification of inhibitors for another UDP-GlcNAc-dependent glycosyltransferase, MurG suggests that MshA is also likely to be a drug-able target. Also, although high-density transposon mutagenesis studies have identified mshD as nonessential for the growth of M. tuberculosis in minimal culture medium, the survival of M. tuberculosis MshD mutants is severely compromised in activated and non-activated macrophages. Thus, MshD could be a promising drug target and further analysis of this mutant in animal models of TB infection may be warranted.[48] 3.26 OTHER SOURCES OF REDUCED SULFUR: Consistent with the requirement for sulfur in mycobacterial survival, the ability of mycobacteria to scavenge reduced sulfur from its host has been confirmed in M. bovis BCG and in M. tuberculosis. Several potential sources of reduced sulfur in the human host are discussed below. 3.27 Cysteine and Cystine: Mutation of cysH in M. smegmatis and M. tuberculosis produces a cysteine auxotroph and this defect can be rescued by the addition of cysteine to the growth medium. The finding that growth of ΔcysH mutant can be restored by the addition of cysteine suggests that cysteine or cystine (the oxidized form of cysteine) can be transported into M. smegmatis and M. tuberculosis. In addition, when [35S] cysteine is added to a growing culture of M. tuberculosis, more than 70% of the radioactive sulfur taken up by the bacteria is found in methionine, also consistent with import of cysteine. While genes that encode the cysteine/cystine transporter in mycobacteria have not yet been identified, cysteine and cystine uptake systems have been characterized in other prokaryotes. In

Full Text Available On www.ijupbs.com

137 | P a g e International Standard Serial Number (ISSN): 2319-8141

humans, cystine is the preferred form of cysteine for the synthesis of glutathione in macrophages and is present in plasma at ~25 – 35 μM. Genetic screens for amino acid auxotrophs in M. bovis BCG (an attenuated version of bovine bacillus) have not isolated cysteine auxotrophs. In the first report, only three auxotrophs were identified, one for methionine and two for leucine. A subsequent study isolated two auxotrophs, both for methionine. Since isolation of mycobacterial auxotrophs depends on the growth medium composition, it is possible that the use of casamino acids to rescue the growth of transposon mutants in these studies selected only a small subset of amino-acid auxotrophs. Consistent with this hypothesis, the approximate concentration of sulfur-containing amino acids in 1% (w/v) casamino acids is expected to be ~900 μM methionine and ~60 μM cystine. The methionine auxotrophs identified by transposon mutagenesis in M. bovis BCG mapped to genes in the sulfate assimilation pathway, in particular to sulfate transport genes, subI and cysA. Since sulfate serves as the precursor for cysteine synthesis, defects in the sulfate assimilation pathway should result in cysteine auxotrophy. Surprisingly however, growth of M. bovis BCG subI or cysA mutants could not be rescued by supplementation with cysteine (in contrast to the cysH knockout in M. smegmatis and M. tuberculosis) and instead, required methionine supplementation. In addition to the inability of cysteine to rescue defects in sulfate transport, the same study also reported that wild-type M. bovis BCG grew slowly on growth media supplemented with 0.3 mM cysteine and not at all in the presence of 0.5 mM cysteine. In contrast, toxicity has not been observed in wild-type strains of M. smegmatis or M. tuberculosis grown in the presence 1 – 2 mM cysteine. Hence, it is possible that mutation of sulfate transport genes, subI or cysA, impact cysteine/cystine import directly or that M. bovis BCG does not transport cysteine/cystine efficiently. Further investigation into the differences between mycobacterial strains, growth media and other critical factors, such as inoculum densities, for the requirements for sulfur-containing compounds are warranted.[49] 3.28 Methionine and Reverse Transsulfuration: The interesting observation that defects in sulfate transport or its reduction could be rescued by methionine supplementation suggested

Full Text Available On www.ijupbs.com

138 | P a g e International Standard Serial Number (ISSN): 2319-8141

that a functional reverse transsulfuration pathway, used to produce cysteine from methionine, was present in mycobacteria. Indeed, the existence of this pathway has recently been confirmed. Although a methionine transporter has not yet been identified in mycobacteria, an apparent Km of 80 μM for the transporter has been estimated in M. bovis BCG and the estimated concentration of methionine in humans is ~25 μM. Once methionine is transported into the bacteria, three enzymatic steps are required for conversion into homocysteine. Subsequently, CysM2 (Rv1077) converts homocysteine to cystathionine. Interestingly, in M. tuberculosis, Rv1079 (annotated as metB) encodes a bifunctional cysteine γ-lyase (CGL)-cystathionine γ-synthase (CGS) enzyme. Hence, conversion of cystathionine to cysteine (the final step in reverse transsulfuration) can be catalyzed by the CGL activity encoded by Rv1079. Alternatively, the CGL activity of Rv1079 can also support transsulfuration (conversion of cysteine to methionine) in M. tuberculosis by converting cysteine to cystathione. Cystathione is then transformed into methionine by two subsequent reactions: MetC (Rv3340) converts cystathionine into homocysteine and MetE/MetH (Rv1133c/Rv2124c) catalyzes methylation of homocysteine to produce methionine. Interestingly, mutation of metB in M. tuberculosis results in a prototrophic methionine mutant. In other words, MetB is not absolutely required for methionine production. This finding can be explained by the action of MetZ (Rv0391), an O- succinylhomoserine sulfurylase which bypasses the requirement for MetB and MetC by condensing S2- with Osuccinylhomoserine to produce homocysteine directly. In mice, a ΔmetB strain was somewhat attenuated. However, no differences in bacterial load in the lungs, liver or spleen, were observed between the metB mutant and wild-type M. tuberculosis in immunocompetent mice up to 80 days post-infection. This growth phenotype contrasts that of cysH mutants in M. tuberculosis where viability decreases significantly, specifically during the persistence phase of infection.[50] 3.29 Glutathione: In mycobacteria, a large amount of the reduced sulfur in cells is used to make mycothiol, the dominant low molecular weight thiol used to maintain redox equilibrium and scavenge reactive oxygen species in the cell. Similarly, GSH – a tripeptide,

Full Text Available On www.ijupbs.com

139 | P a g e International Standard Serial Number (ISSN): 2319-8141

γ-glutamylcysteinylglycine found in many prokaryotes and eukaryotes – is also present at high intracellular levels and may provide a source of reduced sulfur for mycobacteria in the host. Estimates of GSH concentration in human cells and macrophages range from 1 – 7 mM. An analog of GSH, nitrosoglutathione (GSNO), is bactericidal in M. bovis and M. tuberculosis. Use of GSNO has facilitated identification and characterization of the ABC transporter dipeptide permease (Dpp, Rv3663 – Rv3666) responsible for GSH catabolism and utilization [201,202]. Interestingly, GSH is not transported into mycobacterial cells as the tripeptide, but rather as the dipeptide, Cys-Gly. Hence, import of GSH involves proteolysis by a γ-glutamyl transpeptidase (GgtA, Rv0773c) and subsequent transport via Dpp. Consistent with the proposed route of GSH catabolism and import, mutants in the transpeptidase or the permease are resistant to the toxic effects of GSNO. In culture, it has been reported that GSH exhibits bacteriostatic activity at a concentration of 5 mM. This effect appears to be mediated intracellularly since mutations in the dpp or ggtA relieve this phenomenon. It has been noted that M. smegmatis does not share a bacteriostatic effect of reduced glutathione at 5 mM. Further experiments are needed to elucidate the intracellular processing of the dipeptide and mechanism of its apparent toxicity.[51] 4. Metabolic Pathways/ Second Messenger Post-Translational Modifications (PTM): 4.1 Phosphorylation: Phosphorylation is a well-characterized and ubiquitous PTM that is crucial for most functions occurring in a bacterial cell. Apart from regulating metabolic pathways, phosphorylation has also been seen to be involved in various virulence mechanisms. The existence of Hanks-type Ser/Thr kinases in bacteria has generated a huge interest in the fieldofinfectionbiology.Pathogenic strainssuchas Streptococcus spp., Pseudomonas aeruginosa, Mycobacteria,,employ Ser/Thr kinase- mediated host–pathogen interactions to mediate diverse cellular networks required for adhesion to and invasion of the host.While the exact mechanism of infection is not yet well understood, the mode of infection has been speculated to follow three basic modes: (1)phosphorylation of host proteins,(2)disruption of host defense mechanisms due to kinase activity, and lastly(3) essential role of Ser/Thr kinases by unrealized processes. The global phosphoproteome of a

Full Text Available On www.ijupbs.com

140 | P a g e International Standard Serial Number (ISSN): 2319-8141 number of pathogenic bacteria such as Mycobacterium tuberculosis to name a few, have been analyzed.Changes that occur in the host phosphoproteome upon bacterial infection have also been investigated. Dynamics of the bacterial phosphoproteome at the time of infection and post infection would be an interesting a venue to embark upon. Secretion systems play a vital role during pathogenesis in a large number of bacteria. M.tb. and other species encode for a protein kinase A, YopO,which is secreted into the host via the type III secretion system. This kinase helps resist phagocytosis by macrophages via disruption of host cytoskeletal elements. This kinase was also reported to phosphorylate actin and otubain, resulting in inhibition of phagocytosis. Mutation of the kinase domain has been shown to reduce lethality during infection. Similarly, Stk1 from M.tb hasbeen shown to phosphorylate numerous host substrates involved in cell cycle signaling or apoptotic pathways. SteC of M.tb. likeYop O, induces reorganization of actin filaments in the host on infection. Host immune cell responses depend on the proper functioning of the NF-kB pathway. LegK acts as an inflammatory agent and interferes with the NF-kB pathway. Likewise, protein kinases NleH1 and NleH2 from M.tb. work by inhibiting the transcription factor, NF-kB. Phosphorylation of the central core of type II fatty acid synthase (FASH) in Mycobacterium tuberculosis, catalyzed by the kinase Kas B,governs the physiopathology of tuberculosis. Apart from phosphorylation by Ser/Thr Hanks-type kinases, bacterial two-component systems involving phosphorylation on histidine-aspartate residues (TCS) form a major adaptive mechanism in pathogenic strains.For example, CovRS(the control of virulence regulator/sensorkinase) in the human pathogen group is fundamental for virulence. Interestingly, cysteine protein phosphorylation event sarealsoreportedtomediatebacterial virulence.TheSarA/MarA part of the family of global transcriptional regulators(MgrA), is phosphorylated/dephosphorylated by the M.tb. kinase/phosphatase pair Stk1-Stp1 and speculated to play acrucial role in shifting the intracellular redox balance, contributing to virulence. Cognate to kinase activity is the activity of phosphatases, making phosphorylation a reversible and tightly regulated PTM.In many organisms, protein phosphatases act as essential virulence determinants, thus playing a central role in infection and dissemination.

Full Text Available On www.ijupbs.com

141 | P a g e International Standard Serial Number (ISSN): 2319-8141

Tyrosine phosphatase from Yersinia is involved in the dephosphorylation of the focal adhesion complexes and essential for antiphagocytosis. Spt Ptyrosine phosphatase of was observed to be required for virulence in murine models.[52] 4.2 Acylation: Acetylation can be used as a mechanism to modulate phosphorylation-based signaling. Yersinia species use a serine/threonine acetyl transferase, YopJ, to interfere with host MAPK kinase signaling by acetylating serine and threonine residues in the activation loop thereby preventing phosphorylation-dependent activation. YopJ homologs are widely distributed in both mammal and plant pathogens suggesting that inhibition of host kinases by serine/threonine acetylation could be a common strategy for bacterial pathogens. Lysine acetylation and succinylation have in recent years been shown to be abundant modifications in bacteria, and there are some indications that they could be important for bacterial pathogenesis. In M. tb., the transcription factor RcsB that controls colonic acid capsule synthesis, is acetylated only thereby reducing its DNA binding activity. A global study indicated that lysine acetylation is involved in regulation of cell wall fatty acids synthesis in M. tuberculosis, which in turn is implicated in pathogenicity. In addition, a lysine deacetylase mutant exhibits a defectin biofilm formation. KasA, a protein involved in biofilm formation, is modified by another type of acylation namely lysine succinylation. Further, a number of proteins involved in antibiotic resistance are succinylated. With only few functional studies, it is still unclear to what extently acetylation and succinylation contribute to bacterial virulence.[53] 4.3 Ubiquitination: Ubiquitination is an important PTM in Eukarya and regulates several processes including key cell defense systems. Ubiquitin is a small polypeptide (78aminoacids) that can be covalently linked to primarily lysine. Ubiquitination requires the activities of an E1 activating enzyme, an E2 conjugating enzyme and an E3 ligase. Ubiquitin contains seven lysines and can it self be ubiquitinated leading to formation of polyubiquitin chains with various linkages that inturn dictates biological function. Bacterial pathogens have developed several ways of targeting the host ubiquitin system including the use of Eukaryotic-like and novel E3 ligases as well as de-ubiquitinating enzymes. The E3 ligase

Full Text Available On www.ijupbs.com

142 | P a g e International Standard Serial Number (ISSN): 2319-8141

IpaH 9.8 reduces the NF-kB-mediated inflammatory response by polyubiquitination of NEMO, a protein involved in NF- kB activation, thereby targeting it for degradation. Additionally, IpaH 9.8 appears to modulate gene expression via ubiquitination of the splicing factor U2AF35. In infection,ubiquitinated protein aggregates are formed near the M.tb.-containing vacuole which target sit for autophagic degradation. This is countered by SseL, adeubiquitinase, that deubiquitinates the protein aggregates. The pathogens can also use the host ubiquitination system to modify their own proteins. To control the timing of effector protein- mediated functions, M.tb. SopE, that targets RHO-GTPases leading to membrane ruffling, is ubiquitinated and degraded earlier than the protein SptP that prevents membrane ruffling after invasion. Another M.tb. effector protein, the phosphatase SopB, canbemono-ubiquitinated at six positions and this inturn modulates its cellular location and enzyme activity.[54] 4.4 AMPylation: AMPylation is the covalent attachment of AMP to a threonine or tyrosine residue. ATP to covalently modify Rho-GTPases with AMP on threonine. This is turn affects its interaction with downstream signaling proteins leading to inhibition of actin assembly. To exploit host cell vesicle transport, activates the small GTPase Rab1 by AMPylation on a tyrosine, and when Rab1 is no longer needed, it is de-AMPylated by SidD, and subsequently targeted for degradation by polyubiquitination. Host GTPases are also targeted by another novel, reversible PTM, namely phosphocholination. 4.5 Alkylation: Protein alkylation is the addition of alkyl groups on specific amino acids,notably methyl on arginine and lysine (methylation) and the lipids farnesyl or geranyl geranyl isoprenyl on cysteine (prenylation).Histone proteins a reregulated by lysine methylation,and this is also a target for bacterial pathogens. The protein BaSET trimethylates histone H1 on lysine and thereby reduces activation of NF-kB response elements. Prenylation confers hydrophobicity to its substrate proteins and target them to membranes. This is employed by to assure correct cellular localization of its effector AnkB. Host-mediated farnesylation of AnkB, target sit to the cytosolic face of the Legionella- containing vacuole and this in turn is essential for its function.

Full Text Available On www.ijupbs.com

143 | P a g e International Standard Serial Number (ISSN): 2319-8141

4.6 Eliminylation: Effector protein OspF, a phosphothreonine lyase, interferes with host signaling by irreversibly dephosphorylating MAP kinases. In this PTM termed eliminylation, not only the phosphate but also the hydroxyl group of threonine is removed, thereby preventing any future phosphorylation. It irreversibly inactivates the kinase. 4.7 Glycosylation: Protein glycosylation is now a well-established modification in bacteria.O- linked glycosylation of flagellar proteins has been linked to virulence in pathogenic bacteria. In the opportunistic pathogen, glycosylation of the flagellar protein FliC reduces binding to the host TLR5 receptor, thereby weakening the immune response. Additionally, anon- glycosylated FliC mutant exhibits adefectin biofilm formation. Flagellar proteins are also glycosylated, and this is essential for virulence. In a systematic study of glycoproteins, 26 proteins with diverse roles in pathogenesis were identified,arguably indicating a broader array of mechanisms for glycosylation-based virulence.[55] 5. Methodology Involved in Determinations of Genetics of Mycobacteria: 5.1 Macrophage cell lines and media: The human monocyte-like cell line THP-1 (ATCC TIB- 202) and the murine monocyte-like cell line J774A1 (ATCC TIB-67) were maintained in nitrate-free RPMI 1640 medium (GIBCO BRL, Grand Island, N.Y.) supplemented with 50 mg of HEPES/liter, 200 mM glutamine, 2.2 g of sodium bicarbonate/liter, 50 mg of L- arginine/liter, 100 U of penicillin/ml, 50 mg of gentamicin/ml, and either 10% heat- inactivated human AB serum (for THP-1 cells) or 10% heat-inactivated fetal bovine serum (FBS) (for J774A1 cells). Cells for use in M. tuberculosis cocultures were expanded in media without antibiotics and harvested during log phase.[56] 5.2 Recombinant DNA techniques. To isolate chromosomal DNA, M. tuberculosis cells were

grown to confluence on Lo¨wenstein-Jensen slants at 37°C under 9.5% CO2. Cells were scraped from the surface of the slant and resuspended in 500 ml of TE buffer (10 mM Tris–1 mM EDTA [pH 8]) in a 1.5-ml microcentrifuge tube. Two milligrams of achromopeptidase (Sigma) per milliliter was added, and the samples were incubated for 1 h at 37°C. At that time, 120 mg of proteinase K/ml and 1.5% SDS were added, and samples were incubated for 10 min at 65°C. N-cetyl-N,N,N-trimethyl ammonium bromide (1.3%, vol/vol) was added,

Full Text Available On www.ijupbs.com

144 | P a g e International Standard Serial Number (ISSN): 2319-8141

and the samples were incubated for another 10 min at 65°C. These samples were then extracted twice with phenol-chloroform (1:1) and once with chloroform-isoamyl alcohol (24:1) and were ethanol precipitated. DNA was pelleted and resuspended in an appropriate volume of TE buffer. Molecular cloning and restriction endonuclease digestion were performed by standard techniques. Cloning vectors used were pBluescript KS(1) (Stratagene) and pNEB193 (New England Biolabs, Beverly, Mass.). Restriction endonucleases and other enzymes (New England Biolabs; Promega, Madison, Wis.) were used according to the manufacturers‘ instructions. The VKm cassette in plasmid pHP45VKm was graciously provided by the laboratory of Malcolm Winkler, Department of Microbiology and Molecular Genetics, University of Texas—Houston Medical School.[57] 5.3 Generation of transforming plasmids. A 9.4-kb BamHI/ClaI fragment containing the H37Rv fbpA gene was cloned into pBluescript KS by standard methods and identified by Southern blot hybridization using a PCR-generated fragment of fbpA as a probe. An internal 750-bp ApaI fragment was subcloned into pBluescript KS, excised by using the vector KpnI and EcoRI sites, and then ligated into pNEB193 linearized with the same two enzymes. The resultant plasmid, pLYAa6, was linearized at the unique SacII site within fbpA and treated with the Klenow fragment of DNA polymerase I to provide blunt ends. A blunt-ended VKm cassette was prepared by liberating the VKm fragment from pHP45VKm with EcoRI and treating the resultant fragment with the Klenow fragment. The blunt-ended pLYAa6 and VKm DNA fragments were ligated to generate plasmid pLYAa6VKm, containing an fbpA::VKm gene disruption. An internal 500-bp AccI fragment was subcloned directly into the AccI site of pNEB193 and likewise interrupted with the VKm cassette at the SacII site to generate the transforming plasmid pLYAa4VKm. For fbpB::VKm gene disruptions, a 6.6-kb EcoRI/HindIII fragment containing the fbpB gene of H37Rv was cloned into the EcoRI and HindIII sites of pBluescript KS. An internal 750-bp SacII fragment was subcloned into pBluescript KS and then into pNEB193 by using the vector SacI and XbaI sites to generate pLYAb5. This plasmid was linearized with EcoRV and ligated with a blunt-ended VKm cassette, prepared as described above, to generate plasmid pLYAb5VKm. A 2.3-kb

Full Text Available On www.ijupbs.com

145 | P a g e International Standard Serial Number (ISSN): 2319-8141

HindIII/NcoI fragment containing fbpB was subcloned into pNEB193 to generate pLYAb3. This plasmid was mutated by addition of a blunt-ended VKm cassette at the unique EcoRV site within fbpB to generate pLYAb3VKm. To prepare the DNA for transformation of M. tuberculosis, plasmids pLYAa4VKm and pLYAb5VKm were linearized with SacI and pLYAa6VKm was linearized with ClaI. In addition, pLYAa6VKm and pLYAb5VKm were treated with ApaI and SacII, respectively, to yield the mutated genes without vector sequences. The shuttle plasmid pLYAspk was generated by cloning the 3-kb KpnI/EcoRV origin of replication fragment of the Mycobacterium fortuitum plasmid pAL5000 from the recombinant plasmid pYUB18 into pBluescript KS and cloning the VKm marker into the unique BamHI site. This plasmid is able to replicate in both E. coli and M. tuberculosis and to confer kanamycin resistance.[58] 5.4 Electroporation of M. tuberculosis H37Rv. M. tuberculosis H37Rv was prepared for electroporation which is described as follows. Briefly, cells were grown in Middlebrook 7H9 medium–ADC–Tween 80 with gentle shaking to an optical density at 600 nm of 0.6 to 1.0, washed three times in 1/50 volume of cold 10% glycerol, resuspended in 10% glycerol at a concentration of ;1011 cells/ml, and stored at 270°C until needed. The linearized plasmids (2 to 4 mg of DNA) were electroporated at 0°C into 1010 electrocompetent H37Rv cells by using an Electroporator 2510 (Eppendorf North America, Madison, Wis.) at a setting of 1,250 V; under these conditions, the pulse time was 4 to 5 ms. One milliliter of 7H9–ADC broth without antibiotics was added immediately, and the bacteria were incubated at 37°C for 2.5 h with agitation. Transformants were then plated on 7H10–ADC–kanamycin plates

and incubated at 37°C for 3 weeks under 9.3% CO2. Individual kanamycin-resistant colonies were subcultured onto fresh 7H10–ADC–kanamycin plates and grown an additional 2 to 3 weeks prior to further evaluation.[59] 5.5 Hybridization analysis: Fluorescein conjugation of the DNA fragments used as probes and chemiluminescent detection of hybridization were carried out according to the GeneImages procedure (Amersham Life Science Inc., Arlington Heights, Ill.). For initial screening of transformants, chromosomal DNA liberated from boiled M. tuberculosis colonies was

Full Text Available On www.ijupbs.com

146 | P a g e International Standard Serial Number (ISSN): 2319-8141

immobilized onto a Hybond N1 nylon membrane (Amersham Life Science Inc.) by using a slot blot apparatus. Immobilized DNA was hybridized with a fluorescein-labeled 700-bp fragment from the VKm cassette obtained by digestion with PvuII, agarose gel separation, and purification using the PCR Cleanup kit (Promega). In addition, intact chromosomal DNA was digested with the enzymes indicated in Fig. 3, electrophoresed in 0.7% agarose, and transferred to a nylon membrane by using the alkaline transfer procedure. The membrane was then hybridized with a fluorescein-labeled probe (either the internal 750-bp ApaI fragment from fbpA or the internal 750-bp SacII fragment from fbpB).[60] 5.6 Polymerase Chain Reaction (PCR):. PCR was performed to screen for disruptions in fbpA and fbpB. Two primers were unique to the upstream regions of fbpA (59A2) and fbpB (59B2), and one primer was common to both fbpA and fbpB (39AB). The primers 59VKm and 39VKm were used to screen for the presence of the VKm cassette. Cells (104 to 106 per reaction) from transformants were boiled in TE buffer for 10 min to liberate chromosomal DNA, which was used as a template. PCR conditions were 10 mM Tris (pH 8.8), 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 mM deoxynucleoside triphosphates, 0.5 mM each primer, and 2 U of Thermalase polymerase (Amresco, Solon, Ohio) per 100 ml of reaction mixture. Denaturation, annealing, and extension temperatures (and times) were as follows: 1 cycle of 96°C for 2 min; 5 cycles of 94°C for 40 s, 56°C for 40 s, and 72°C for 1.5 min; 30 cycles of 94°C for 40 s, 68°C for 40 s, and 72°C for 1.5 min; and a final extension of 72°C for 10 min.[61] 5.7 Sequence analysis: The PCR primer pairs 59A2 and 39VKm2 and 59VKm2 and 39Aexp were used to amplify the 59 and 39 regions, respectively, of the fbpA gene locus in LAa1. Primers 39VKm2 and 59VKm2 are specific for sequences within the VKm cassette. PCR primers 59B2 and 39VKm2 were used to amplify the 59 region of the fbpB locus of LAb1. Southern blot analysis revealedthat the transforming vector pNEB193 had integrated into the fbpB locus. Primer pNEB1, which is specific for pNEB193, was used with 39Bexp to amplify the 39 region of LAb1. PCR products were purified, desalted, and used directly as templates for sequencing. DNA sequencing was performed by using an ABI 377 automatic

Full Text Available On www.ijupbs.com

147 | P a g e International Standard Serial Number (ISSN): 2319-8141

DNA sequencer (Perkin-Elmer/Applied Biosystems, Foster City, Calif.) at the DNA Core Laboratory, Department of Microbiology and Molecular Genetics, University of Texas– Houston Medical School. Sequences were analyzed with the GAP and BESTFIT programs (Genetics Computer Group, Madison, Wis.).[62] 5.8 SDS-PAGE and Western blot analysis: The parent strain, H37Rv, and the fbpA::VKm and fbpB::VKm mutants were grown in stationary cultures (without agitation) in Middlebrook 7H9 broth without additional supplements, except 20 mg of kanamycin/ml for selection of the two mutant strains. Five milliliters of 11-day cultures were filtered twice through a 22- mm-pore-size filter. Two milliliters of each filtrate was concentrated to ;150 ml by using a Centricon-10 membrane apparatus (Amicon, Beverly, Mass.). The retentates were resuspended in an equal volume of solubilization buffer (2% SDS, 5% 2-mercaptoethanol, 10% glycerol). Proteins were electrophoresed in 8-to-20% polyacryl-amide gradient gels and stained with Coomassie blue or transferred to polyvinyl difluoride (PVDF) membranes as previously described. Western blot analysis was carried out by incubating PVDF membranes with a 1:100 dilution of hybridoma culture supernatant containing the monoclonal antibody HYT27. This antibody has been shown to react with FbpA, FbpB, and FbpC. Second antibody incubation and detection were carried out according to the Gene Images procedure (Amersham).[63] 5.9 Construction of the bacterial one-hybrid reporter T-vector: For developing a new bacterial one-hybrid (B1H) reporter vector, an ;1.7-kb DNA fragment containing the HIS3– aadA reporter cassette was cloned from the BacterioMatch II two-hybrid reporter system (Stratagene) using a pair of unique primers. This reporter cassette was further used to replace lcI and lac-UV5 promoters from pBT to produce a preliminary vector named pRpb. To restrain the self-activation and reduce screening background, a mediator DNA fragment was screened successfully from the genomic library of archaeon Sulfolobus solfataricus and the fragment was inserted into the right upstream of the HIS3–aadA reporter cassette. After further modifications, a derivative reporter vector of pRpb-S7 was produced, in which a BamHI restriction enzyme site was integrated into the upstream of the HIS3–aadA reporter

Full Text Available On www.ijupbs.com

148 | P a g e International Standard Serial Number (ISSN): 2319-8141 cassette. For the convenient and rapid cloning of the short promoter DNA fragment into the one-hybrid system, further engineered a 1.2-kb MCMD segment containing two XcmI sites in both its termini, the XcmI cassette. The cassette was derived from the mini chromosome maintainance gene (MCM) of the archaeon S. solfataricus which was amplified by using a pair of specific primers containing the XcmI site. The XcmI cassette was inserted into BamHI-digested pRpb-S7 to produce a plasmid pBXcmT. When digested with XcmI, the recombinant plasmid pBXcmT resulted in a vector with a single deoxythymidine (dT) overhanging at its 39-end. This linearized T-vector could then be used for the rapid cloning of PCR products. Cloning of M. tuberculosis transcription factors and regulatory sequences of the target genes and bacterial one-hybrid assays About 150 transcription factors were predicted from the genome of M. tuberculosis. All of these probable transcription regulatory genes were amplified using their specific primers and were cloned into the pTRG vector. A subgenomic library for M.tuberculosis transcription factors was produced by mixing these recombinant plasmids. The promoters of the M. tuberculosis genes were amplified using their specific primers and were inserted directly into the XcmI site of pBXcmT. The E. coli XL1-Blue MRF9 Kan strain was used for the routine propagation of all pBXcmT and pTRG recombinant plasmids. A pair of pBXcmT/pTRG plasmids was co-transformed into the reporter strain and its growth was then tested, together with the self-activation control on the selective medium containing 3-AT, Kanr, Strr, and Chlr. To explore new regulators, the recombinant plasmid pBXcmT can also be used to screen the library for M. tuberculosis transcription factors. Positive growth cotransformants were selected on a selective screening medium plate containing 20 mM 3-AT, 16 mg/mL streptomycin, 15 mg/mL tetracycline, 34 mg/mL chloramphenicol, and 50 mg/mL kanamycin. The plates were incubated at 30°C for 3–4 d. stabilization, the purified transcription regulatory protein was passed over the chip. Experiments were performed in a running buffer consisting of 100 mM HEPES (pH 7.5), 50 mM EDTA, 0.1 mM DTT, and 100 mM NaCl at a flow rate of 10 mL per min at 25°C. Each analysis was performed in triplicate. An overlay plot was produced for depicting the

Full Text Available On www.ijupbs.com

149 | P a g e International Standard Serial Number (ISSN): 2319-8141

interaction between the transcription factor and the different concentrations of the promoter DNA.[64] 5.10 Cloning of fadD13 Gene: Based on the sequence available from the EMBL/Genbank, the primers 59catatgaagaacattggctggatgctcag 39 (forward primer containing NdeI restriction site) and 59ctcgagtcacttcggcaccgtcgccg 39 (reverse primer containing XhoI restriction site) were used to amplify the gene encoding Fatty Acyl-CoA Synthetase (Rv3089, FadD13) by using M.tb genomic DNA as template. The PCR amplicon was cloned into plitmus38 at EcoRV site resulting in plit38.fad. For expression studies, the gene was excised out by using NdeI and XhoI restriction enzymes and was cloned into pET28c at the same sites resulting in pET28c.fad. 5.11 Expression and Purification of Recombinant FadD13: E.coli BL21 (lDE3) cells were transformed with pET28c.fad, the transformants were grown to mid-logarithmic phase in LB media containing 25 mg/ml of kanamycin and synthesis of FadD13 protein was induced by the addition of 1 mM isoproryl-1-thio-β-D-galactopyranoside (IPTG) and the cells were harvested after incubation at 30uC for 3 hours with a constant shaking at 200 rpm. Induction in the case of mutant W377A was carried out at 18uC for 16 hours. The harvested cells were suspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 20% glycerol, 1 mM PMSF, 2 mM b-mercaptoethanol, pH 8.0) and lysed by using French press (SLM Instruments, Inc., Urbana, IL, USA). Purification was carried out by Ni-NTA agarose affinity chromatography. Briefly, the cell-extract-Ni-NTA agarose slurry was kept for binding on a rotary shaker for 2 hours at 4uC. After removal of unbound proteins (at 2000 g for 2 minutes), the resin was washed twice with lysis buffer. For higher stringency, washings were repeated twice with lysis buffer containing 20 mM imidazole and once with lysis buffer containing 50 mM imidazole. The protein was eluted by using lysis buffer containing 250 mM imidazole and purification was monitored on 10% SDS-polyacrylamide gel. The purified his-tagged protein was dialyzed against 1X PBS before use. Protein concentration was determined by Bradford‘s method with bovine serum albumin as the standard.

Full Text Available On www.ijupbs.com

150 | P a g e International Standard Serial Number (ISSN): 2319-8141

5.12 Determination of Oligomeric Nature of FadD13: The oligomeric status of FadD13 was determined by using Mycobacterial-Protein Fragment Complementation. For this, the gene encoding FadD13 was excised out from pET28c.fad, end repaired by Klenow polymerase and cloned into pUAB300 and pUAB400 (digested with BamHI and HindIII, respectively) resulting in pUAB300.fad and pUAB400.fad leading to production of FadD13[F1,2] and FadD13[F3], respectively. The digested vectors were end repaired and dephosphorylated before cloning. M.sm mc2155 cells were independently electroporated with M-PFC plasmids producing either (1)–FadD13[F1,2]/ FadD13[F3], (2)–hsp60[F1,2]/hsp60[F3], (3)– GCN4[F1,2]/GCN4[F3], (4) –FadD13[F1,2]/hsp60[F3], (5)–hsp60[F1,2]/FadD13[F3] and the transformants were selected on MB 7H11 agar containing 25 mg/ml kanamycin and 50 mg/ml hygromycin. The transformants were analyzed for oligomerization of FadD13 by their ability to grow in the presence of 50 mg/ml Trimethoprim. 5.13 Determination of Subunit Assembly by Gel Filtration Chromatography: A sephadex G-200 column (2.5 cm692 cm) equilibrated with 20 mM Tris-HCl pH 8.0, 0.1 M NaCl, 10% glycerol and 0.02% sodium azide was used to determine the subunit assembly of FadD13. 5 mg of purified FadD13 was resolved on the column and its molecular weight was determined by comparison with the known molecular weight standards. 5.14 Plasmid Constructs for M-PFC: The plasmids pKSFR and pKSFR contain mDHFRF(1, 2) (F[1,2]) and mDHFRF(3) (F[3]), respectively, fused in-frame with a 10-aa flexible Gly linker (Gly-10) and GCN4 leucine-zipper coding sequence; these plasmids were used as templates for generating M-PFC plasmids. Complementary oligonucleotides containing the restriction enzyme sites BamHI and AccI were used to PCR amplify F[1,2] along with a flexible Gly linker and leucine-zipper (GCN4) sequences (GCN4-[Gly]10- F[1,2]). The PCR fragment was digested and ligated to BamHI_ClaI-digested pMV261 (7), generating the episomal vector pUAB100. Similarly, a PCR amplicon containing F[3] along with the flexible glycine linker and GCN4 sequences (GCN4-[Gly]10-F[3]) was digested and ligated with MfeIHpaI-digested pMV361 to generate the integrating vector pUAB200. These constructs contain the GCN4 homodimerization domains fused to the N terminus of

Full Text Available On www.ijupbs.com

151 | P a g e International Standard Serial Number (ISSN): 2319-8141

mDHFR fragments. When necessary, the GCN4 domains from pUAB100 and pUAB200 were replaced with bait or prey DNA sequences. For library screens, the M-PFC vectors were modified by cloning the F[3]-[Gly]10 sequence into the E. coli–mycobacterial shuttle vector pMV761 to generate the integrating vector pUAB400. Similarly, the complementary fragment of mDHFR, i.e., F[1,2] along with the flexible glycine linker (F[1,2]-[Gly]10), was PCRamplified and cloned in pMV762 to create the episomal plasmid pUAB300.[65] 5.15 M-PFC Library Screen: The Mtb genomic DNA library containing 5 to 105 independent clones was prepared and cloned into the unique ClaI site of pUAB300. The bait plasmid was constructed by PCR-amplifying cfp-10 and subsequent ligation to MunIClaI linearized pUAB400 to create pUAB400-Cfp10. The bait plasmid was transformed into Msm. The subsequent transformed strain was then electroporated with the Mtb library DNA. Interacting clones were selected by plating transformants on 7H11 media containing KAN, HYG, and TRIM (50g/ml). Colonies that showed growth on 7H11-TRIM plates were lysed, and plasmid DNA was isolated, amplified in E. coli, and again transformed into Msm containing pUAB400-Cfp10. Clones were again streaked on 7H11_TRIM plates and assessedfor growth. Library plasmids from Msm clones that showed growth on TRIM plates were sequenced. 5.16 Identification of the High-Affinity PhoP-Binding Sequence by SELEX: A random pool of oligonucleotides 5′-GGTGCAGGCATATGAAAG(N25)CTGGACCATATGCTC CAG-3′, where N25 represents 25 randomized nucleotides, was synthesized by equimolar incorporation of A, G, C, and T at each ―N‖ position (Integrated DNA Technologies). The two sets of 18 nucleotides flanking the 25-nucleotide random core were designed for amplification by PCR. The double-stranded random DNA library was generated by a primer extension reaction, in which 20 μg of the random oligonucleotides was mixed with the reverse PCR primer complementary to the last 18 bases, T4 DNA polymerase (New England Biolabs), and dNTPs in a final volume of 50 μL. The reaction mixture was incubated at 37 °C for 30 min. The quality of the doublestranded random DNA was examined by agarose gel electrophoresis. To conduct the SELEX experiments, 10 μg of purified His-PhoP was bound

Full Text Available On www.ijupbs.com

152 | P a g e International Standard Serial Number (ISSN): 2319-8141

to 10 μL of Ni-NTA Sepharose (Qiagen). This PhoP-Ni-NTA resin was washed twice with a

binding buffer [20 mM Hepes (pH 7.5), 150 mM NaCl, 5 mM MgCl2, and 5% glycerol] and then resuspended in 200 μL of a binding buffer containing 50 μg/mL herring sperm DNA, 100 μg/mL poly(dI-dC), and 0.1 mg/mL BSA. The mixture was incubated for 30 min at room temperature. The primer extension product (50 μL) were then added and incubated for 1 h while being gently shaken. The resin was washed three times with 500 μL of a binding buffer and once with a binding buffer containing additional NaCl (concentration of 200 mM). The protein−DNA complex was eluted with 20 μL of elution buffer [25 mM phosphate (pH 7.4), 250 mM NaCl, and 300 mM imidazole]. The eluted DNA was amplified by 15 cycles of PCR with Taq DNA polymerase (Genscript, Piscataway, NJ). The PCR product was purified from a 6% native polyacrylamide gel with the QIAEX II gel extraction kit (QIAGEN). The purified PCR product was used in the second round of SELEX. After three or more serial selection rounds, the DNA was ligated into a TOPO vector using the TOPO TA cloning kit and subjected to DNA sequencing.[66] 5.17 Electrophoretic Mobility Shift Assays: Double-stranded DNA fragments were prepared by mixing equimolar amounts of two complementary oligonucleotides in 10 mM Tris (pH 8.0) and 50 mM NaCl, heating the mixture at 90 °C for 10 min, and slowly cooling it to room temperature. The duplex DNA was purified from a 6% native polyacrylamide gel using the QIAEX II gel extraction kit. Purified DNA fragments were labeled with the biotin DNA labeling kit (Pierce). EMSA experiments were performed in a total volume of 10 μL

containing 20 mM Hepes (pH 7.5), 50 mM NaCl, 5 mM MgCl2, 5% glycerol, 1 μg of poly(dI-dC), 0.12−0.15 μM labeled DNA, and 0.72−3.6 μM PhoP protein. The reaction mixtures were incubated at room temperature for 20 min and then loaded onto a 6% DNA retardation gel (Invitrogen). The gel was run at 100 V in 0.5× TBE buffer at 4 °C. The DNA was transferred to a nylon membrane by electroblotting and crosslinked to the membrane using a Stratalinker UV cross-linker on the autocrosslink setting. The blot was developed using the Pierce chemiluminescent nucleic acid detection kit. To obtain phosphorylated PhoP, 18 μM protein was incubated with 50 mM acetyl phosphate (AcP) at room

Full Text Available On www.ijupbs.com

153 | P a g e International Standard Serial Number (ISSN): 2319-8141

temperature in 500 μL of buffer containing 20 mM Hepes (pH 7.5), 100 mM NaCl, and 5 mM MgCl2. At certain time intervals, samples were taken, mixed with SDS sample buffer, and kept on ice. Samples were resolved on a 10%polyacrylamide gel containing 50 μM Phos-tag acrylamide35 to check the level of phosphorylation. The phosphorylated PhoP sample was used for an EMSA following the same procedure described above.[67] 5.18 Isothiocynate (ITC) Measurements: ITC experiments were conducted at 25 °C with a MicroCal iTC200 system in a buffer containing 20 mM Hepes (pH 7.5), 100 mM NaCl, and 5 mM MgCl2. The sample cell was stirred at 1000 rpm. The protein (10−20 μM) in the sample cell was titrated with 50−100 μM synthetic DNA duplex in the injection syringe. Titration was initiated by one 0.4 μL injection followed by 18 injections of 2 μL spaced by 120 s intervals. The data were analyzed using Origin 7.0 and fit with a one-set-of-sites binding model to obtain values of the stoichiometry (N), enthalpy change (ΔH), and association constant (Ka). 5.19 Size-Exclusion Chromatography: PhoP was mixed with double-stranded DNA fragments in a binding buffer [20 Mm Hepes (pH 7.5), 100 mM NaCl, and 5 mM MgCl2] at room temperature for 20 min. The protein−DNA complexes were loaded onto a Superdex 200 HR 10/30 column (GE Life Sciences) equilibrated with the binding buffer and eluted at room temperature at a flow rate of 0.5 mL/min. 5.20 Analytical Ultracentrifugation: The AUC sedimentation velocity (SV) experiments were conducted in a Beckman Optima XL-A analytical ultracentrifuge using an An60Ti rotor and Epon charcoal standard double-sector centerpieces (12 mm optical path length). Samples containing DNA, protein, or the DNA−protein complex in a binding buffer [20 mM Hepes (pH 7.5), 100 mM NaCl, and 5 mM MgCl2] were centrifuged at 20°C and 45000 rpm. Absorbance scans were taken at 260 nm for DNA alone and at 280 nm for protein and protein−DNA samples in continuous mode. SEDNTERP36 was used to calculate the buffer viscosity (η), buffer density (ρ), and protein partial specific volume values at 20 °C. The GC content for the DNA used in these experiments was ≥ 40%, and the partial specific volume was calculated to be 0.59 cm3 g−1. Sedimentation coefficient distributions were calculated

Full Text Available On www.ijupbs.com

154 | P a g e International Standard Serial Number (ISSN): 2319-8141

with data from 300 SV scans by using SEDFIT.37 A resolution setting of 200 and a confidence interval of 0.8 were used. For phosphorylation samples, 26 μM PhoP was mixed with 50 mM AcP in a buffer identical to that for the PhoP alone sample, immediately prior to loading the sample into the AUC cell. The rotor with the sample was cooled and incubated at 20 °C for 2 h before centrifugation was started.[68] 6. Some Trends For Mycobacterial Genomics involved in Drug Resistance in TB: Newly emerging multi-drug resistant strains of Mycobacterium tuberculosis (M.tb) severely limit the treatment options for tuberculosis (TB); hence, new antitubercular drugs are urgently needed. The mymA operon is essential for the virulence and intracellular survival of M.tb and thus represents an attractive target for the development of new antitubercular drugs. This study is focused on the structure-function relationship of Fatty Acyl-CoA Synthetase (FadD13, Rv3089) belonging to the mymA operon. Eight site-directed mutants of FadD13 were designed, constructed and analyzed for the structural-functional integrity of the enzyme. The study revealed that mutation of Lys487 resulted in,95% loss of the activity thus demonstrating its crucial requirement for the enzymatic activity. Comparison of the kinetic parameters showed the residues Lys172 and Ala302 to be involved in the binding of ATP and Ser404 in the binding of CoenzymeA. The influence of mutations of the residues Val209 and Trp377 emphasized their importance in maintaining the structural integrity of FadD13. Besides, we show a synergistic influence of fatty acid and ATP binding on the conformation and rigidity of FadD13. FadD13 represents the first Fatty Acyl-CoA Synthetase to display biphasic kinetics for fatty acids. FadD13 exhibits a distinct preference for C26/C24 fatty acids, which in the light of earlier reported observations further substantiates the role of the mymA operon in remodeling the cell envelope of intracellular M.tb under acidic conditions. A three-dimensional model of FadD13 was generated; the docking of ATP to the active site verified its interaction with Lys172, Ala302 and Lys487 and corresponded well with the results of the mutational studies. This study provides a significant understanding of the FadD13 protein including the identification of residues important for its activity as well as in the maintenance of structural integrity. It believes that the findings of this study will provide

Full Text Available On www.ijupbs.com

155 | P a g e International Standard Serial Number (ISSN): 2319-8141 valuable inputs in the development of inhibitors against the mymA operon, an important target for the development of antitubercular drugs.[69] The mechanism of pathogenesis of Mycobacterium tuberculosis is thought to be multifactorial. Among the putative virulence factors is the antigen 85 (Ag85) complex. This family of exported fibronectin-binding proteins consists of members Ag85A, Ag85B, and Ag85C and is most prominently represented by 85A and 85B. These proteins have recently been shown to possess mycolyl transferase activity and likely play a role in cell wall synthesis. The purpose of study was to generate strains of M. tuberculosis deficient in expression of the principal members of this complex in order to determine their role in the pathogenesis of M. tuberculosis. Constructs of fbpA and fbpB disrupted with the kanamycin resistance marker VKm and containing varying amounts of flanking gene and plasmid vector sequences were then introduced as linear fragments into H37Rv by electroporation. Southern blot and PCR analyses revealed disruption of the homologous gene locus in one fbpA::VKm transformant and one fbpB::VKm transformant. The fbpA::VKm mutant, LAa1, resulted from a double-crossover integration event, whereas the fbpB::VKm variant, LAb1, was the product of a single-crossover type event that resulted in insertion of both VKm and plasmid sequences. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot analysis confirmed that expression of the disrupted gene was not detectable in the fbpA and fbpB mutants. Analysis of growth rates demonstrated that the fbpB mutant LAb1 grew at a rate similar to that of the wild-type parent in enriched and nutrient-poor laboratory media as well as in human (THP-1) and mouse (J774.1A) macrophage-like cell lines. The fbpA mutant LAa1 grew similarly to the parent H37Rv in enriched laboratory media but exhibited little or no growth in nutrient-poor media and macrophage-like cell lines. The targeted disruption of two genes encoding mycolyl transferase and fibronectinbinding activities in M. tuberculosis will permit the systematic determination of their roles in the physiology and pathogenesis of this organism.[70] Sequence-specific DNA-binding transcription factors have widespread biological significance in the regulation of gene expression. However, in lower prokaryotes and

Full Text Available On www.ijupbs.com

156 | P a g e International Standard Serial Number (ISSN): 2319-8141 eukaryotic metazoans, it is usually difficult to find transcription regulatory factors that recognize specific target promoters. To address this, a new bacterial one-hybrid reporter vector system that provides a convenient and rapid strategy to determine the specific interaction between target DNA sequences and their transcription factors. Using this system, we have successfully determined the DNA-binding specificity of the transcription regulator Rv3133c to a previously reported promoter region of the gene Rv2031 in Mycobacterium tuberculosis. In addition, we have tested more than 20 promoter regions of M. tuberculosis genes using this approach to determine if they interact with;150 putative regulatory proteins. A variety of transcription factors are found to participate in the regulation of stress response and fatty acid metabolism, both of which comprise the core of in vivo-induced genes when M. tuberculosis invades macrophages. Interestingly, among the many new discovered potential transcription factors, the WhiB-like transcriptional factor WhiB3 was identified for the first time to bind with the promoter sequences of most in vivo-induced genes. Therefore, this study offers important data in the dissection of the transcription regulations in M. tuberculosis, and the strategy should be applicable in the study of DNA-binding factors in a wide range of biological organisms.[71-72] The sudden increase in information derived from the completed Mycobacterium tuberculosis (Mtb) genome sequences has revealed the need for approaches capable of converting raw genome sequence data into functional information. To date, an experimental system for studying protein–protein association in mycobacteria is not available. We have developed a simple system, termed mycobacterial protein fragment complementation (M-PFC), that is based upon the functional reconstitution of two small murine dihydrofolate reductase domains independently fused to two interacting proteins. Using M-PFC, we have successfully demonstrated dimerization of yeast GCN4, interaction between Mtb KdpD and KdpE, and association between Esat-6 and Cfp-10.Some authors established the association between the sensor kinase, DevS, and response regulator, DevR, thereby demonstrating the potential of M-PFC to study protein associations in the mycobacterial membrane. To validate and screened an Mtb library system, for proteins that associate with the secreted antigen Cfp-

Full Text Available On www.ijupbs.com

157 | P a g e International Standard Serial Number (ISSN): 2319-8141

10 and consistently identified Esat-6 in our screens. Additional proteins that specifically associate with Cfp-10 include Rv0686 and Rv2151c (FtsQ), a component and substrate, respectively, of the evolutionary conserved signal recognition pathway; and Rv3596c (ClpC1), an AAA-ATPase chaperone involved in protein translocation and quality control. This results provide empirical evidence that directly links the Mtb specialized secretion pathway with the evolutionary conserved signal recognition and SecA-SecYEG pathways, suggesting they share secretory components. It was anticipates that M-PFC will be a major contributor to the systematic assembly of mycobacterial protein interaction maps that will lead to the development of better strategies for the control of tuberculosis.[73] 7. Conclusion: The Electron Transport Chain (ETC) and Mycobacterial Protein Fragment Complementation (M-PFC) are essential components for energy production through the generation of ATP, which is required for metabolic processes within the cell. The ETC has gained recent prominence in TB drug development through the discovery of numerous compounds that target this pathway such as bedaquiline and Q203. However, in addition to the obvious effects of inhibiting the ETC, a secondary effect of targeting this pathway would be a reduction in the activity of the various M-PFC /ATPdependent Excitation Potential (EPs) present in M. tuberculosis. These effects may accelerate cell death through higher intracellular concentrations of drugs and reduced extrusion of toxic metabolites, with an added benefit of reducing transient drug tolerance and consequent drug resistance. Various studies now point to potentially positive therapeutic effects of using EP inhibitors such as verapamil to increase the potency of drugs and limit the acquisition of drug resistance. Energy metabolism, including the regulation thereof, represents an ideal component of metabolism to mine for new drug targets. REFERENCES: 1. Digel M, Ehehalt R, Stremmel W, et.al., (2009); Acyl-CoA Synthetases: fatty acid uptake and metabolic channeling. Mol Cell Biochem 326: 23–28.

Full Text Available On www.ijupbs.com

158 | P a g e International Standard Serial Number (ISSN): 2319-8141

2. Garima Khare,( 2009); Dissecting the Role of Critical Residues and Substrate Preference of a Fatty Acyl-CoA Synthetase (FadD13) of Mycobacterium tuberculosis, PLoS ONE | www.plosone.org | Volume 4 | Issue 12 | e8387 1-15. 3. Zheng CJ, Yoo JS, Lee TG, et.al.,( 2005); Fatty acid synthesis is a target for antibacterial activity of unsaturated fatty acids. FEBS Lett; 579: 5157–5162. [PubMed: 16146629]. 4. Quemard A, Sacchettini JC, Dessen A,et.al., (1995); Enzymatic characterization of the target for isoniazid in Mycobacterium tuberculosis. Biochemistry; 34:8235–8241. [PubMed: 7599116]. 5. Hunter SW, Brennan PJ, (1990); Evidence for the presence of a phosphatidylinositol anchor on the lipoarabinomannan and lipomannan of Mycobacterium tuberculosis. J Biol Chem;265: 9272– 9279. [PubMed: 2111816]. 6. Schlesinger LS., (1993); Macrophage phagocytosis of virulent but not attenuated strains of Mycobacterium tuberculosis is mediated by mannose receptors in addition to complement receptors. J Immunol;150: 2920–2930. [PubMed: 8454864]. 7. Azad AK, Torrelles JB, Schlesinger LS.,(2008); Mutation in the DC-SIGN cytoplasmic triacidic cluster motif markedly attenuates receptor activity for phagocytosis and endocytosis of mannose containing ligands by human myeloid cells. J Leukoc Biol. 265: 372–379. 8. Lemassu A, Daffe M., (1994); Structural features of the exocellular polysaccharides of Mycobacterium tuberculosis. Biochem J; 297 (Pt 2):351–357. [PubMed: 8297342]. 9. Chatterjee D, Khoo K-H.,( 1998); Mycobcterial lipoarabinomannan: an extraordinary lipoheteroglycan with profound physiological effects. Glycobiology;8:113–120. [PubMed: 9451020]. 10. Rojas M, Garcia LF, Nigou J, et. al. (2000); Mannosylated lipoarabinomannan antagonizes Mycobacterium tuberculosis-induced macrophage apoptosis by altering Ca+2-dependent cell signaling. J Infect Dis; 182:240–251. [PubMed: 10882603].

Full Text Available On www.ijupbs.com

159 | P a g e International Standard Serial Number (ISSN): 2319-8141

11. Nigou J, Gilleron M, Rojas M, et. al. (2002); Mycobacterial lipoarabinomannans: Modulators of dendritic cell function and the apoptotic response. Microbes Infect; 4:945– 953. [PubMed: 12106787]. 12. Xu S, Cooper A, Sturgill-Koszycki S, Van Heyningen T, et. al. (1994); DG. Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J Immunol 1994;153:2568–2578. [PubMed: 8077667]. 13. Prigozy TI, Sieling PA, Clemens D, et. al. (1997); Kronenberg M. The mannose receptor delivers lipoglycan antigens to endosomes for presentation to T cells by CD1b molecules. Immunity; 6:187–197. [PubMed: 9047240]. 14. Sieling PA, Chatterjee D, Porcelli SA, et. al. (1995); CD1-restricted T cell recognition of microbial lipoglycan antigens. Science;269:227–230. [PubMed: 7542404]. 15. Torrelles, JB.; Sieling, PA.; Brennan, PJ., et. al. (2003); Characterization of Lipoarabinomannan Isoforms of Mycobacterium tuberculosis responsible for precise recognition by CD1-restricted T cells. Tuberculosis: Integrating host and pathogen biology, Keystone symposia; Taos, New Mexico. Abstract. 16. Kang PB, Azad AK, Torrelles JB, et. al. (2005); LS. The human macrophage mannose receptor directs Mycobacterium tuberculosis lipoarabinomannan-mediated phagosome biogenesis. J Exp Med 2005;202:987–999. [PubMed:16203868]. 17. Kusner DJ., (2005); Mechanisms of mycobacterial persistence in tuberculosis. Clin Immunol; 114:239–247. [PubMed: 15721834]. 18. Vergne I, Chua J, Deretic V., (2003); Tuberculosis toxin blocking phagosome maturation inhibits a novel Ca2+/calmodulin-PI3K hVPS34 cascade. J Exp Med; 198:653–659. [PubMed: 12925680]. 19. Fratti RA, Chua J, Vergne I, et. al. (2003); Mycobacterium tuberculosis glycosylated phosphatidylinositol causes phagosome maturation arrest. Proc Natl Acad Sci U S A ;100:5437–5442. [PubMed: 12702770].

Full Text Available On www.ijupbs.com

160 | P a g e International Standard Serial Number (ISSN): 2319-8141

20. Welin A, Winberg ME, Stendahl O, et. al. (2008); Incorporation of Mycobacterium tuberculosis lipoarabinomannan into macrophage membrane rafts is a prerequisite for the phagosomal maturation block. Infect Immun; 76:2882–2887. [PubMed: 18426888]. 21. Abou-Zeid, C., T. L. Ratliff, H. G. Wiker, et. al. (1988); Characterization of fibronectin- binding antigens released by Mycobacterium tuberculosis and Mycobacterium bovis BCG. Infect. Immun. 56:3046–3051. 22. Aldovini, A., R. N. Husson, and R. A. Young., (1993) The uraA locus and homologous recombination in Mycobacterium bovis BCG. J. Bacteriol. 175: 7282–7289. 23. Wang, S., Engohang-Ndong, J., and Smith, I., (2007); Structure of the DNA-binding domain of the response regulator PhoP from Mycobacterium tuberculosis. Biochemistry 46, 14751−14761. 24. Cimino, M., Thomas, C., Namouchi, A., (2012); Identification of DNA binding motifs of the Mycobacterium tuberculosis PhoP/PhoR two-component signal transduction system. PLoS One 7, e42876. 25. Solans, L., Gonzalo-Asensio, J., Sala, C., (2014); The PhoP-dependent ncRNA Mcr7 modulates the TAT secretion system. 26. Flynn JL, Chan J. (2001); Annu Rev Immunol.; 19:93. [PubMed: 11244032]. 27. Houben EN, Nguyen L, Pieters J. (2006); Curr Opin Microbiol.; 9:76. [PubMed: 16406837]. 28. Vergne I, Chua J, Lee HH, (2005); Proc Natl Acad Sci USA.; 102:4033. [PubMed: 15753315]. 29. Giacomini E, Iona E, Ferroni L, et .al. (2001); Immunol.; 166:7033. [PubMed: 11390447]. 30. Henderson RA, Watkins SC, Flynn JL., (1997); J Immunol.; 159:635. [PubMed: 9218578]. 31. Salgame P., (2005); Curr Opin Immunol.; 17:374. [PubMed: 15963709]. 32. Uehira K, Amakawa R, Ito T, et. al. (2002); Clin Immunol.; 105:296. [PubMed: 12498811].

Full Text Available On www.ijupbs.com

161 | P a g e International Standard Serial Number (ISSN): 2319-8141

33. Cosma CL, Humbert O, Ramakrishnan L.,(2004); Nat Immunol. 5:828. [PubMed: 15220915]. 34. Russell DG. Nat Rev Microbiol. 2007; 5:39. [PubMed: 17160001]. 35. Saunders BM, Cooper AM., (2000); Immunol Cell Biol.; 78:334. [PubMed: 10947857]. 36. Ulrichs T, Kaufmann SH. J Pathol., ( 2006); 208:261. [PubMed: 16362982]. 37. Lazarevic V, Nolt D, Flynn JL. (2005); J Immunol.; 175:1107. [PubMed: 16002712]. 38. Boshoff HI, Barry CE, (2005); 3rd. Nat Rev Microbiol.; 3:70. [PubMed: 15608701]. 39. Tufariello JM, Chan J, Flynn JL. Lancet Infect Dis. 2003; 3:578. [PubMed: 12954564]. 40. Nathan C, Shiloh MU. Proc Natl Acad Sci USA. 2000; 97:8841. [PubMed: 10922044]. 41. Hampshire T, Soneji S, Bacon J, (2004); Tuberculosis (Edinb).; 84:228. [PubMed: 15207492]. 42. Manganelli R, Voskuil MI, Schoolnik GK, et. al. (2002); Mol Microbiol.; 45:365. [PubMed: 12123450]. 43. Ohno H, Zhu G, Mohan VP, et. al. (2003); Cell Microbiol.; 5:637. [PubMed: 12925133]. 44. Pinto R, Tang QX, Britton WJ, et. al. (2004); Microbiology.; 150:1681. [PubMed: 15184554]. 45. Rengarajan J, Bloom BR, Rubin EJ., et. al. (2005); Proc Natl Acad Sci USA.; 102:8327. [PubMed: 15928073]. 46. Sassetti CM, Boyd DH, Rubin EJ., (2001); Proc Natl Acad Sci USA.; 98:12712. [PubMed: 11606763]. 47. Sassetti CM, Boyd DH, Rubin EJ. (2003) Mol Microbiol.; 48:77. [PubMed: 12657046]. 48. Sassetti CM, Rubin EJ. (2003) Proc Natl Acad Sci USA.; 100:12989. [PubMed: 14569030]. 49. Schnappinger D, Ehrt S, Voskuil MI (2003); J Exp Med. 2003; 198:693. [PubMed: 12953091]. 50. Sherman DR, Voskuil M, Schnappinger D, et. al. (2001); Proc Natl Acad Sci USA.; 98:7534. [PubMed: 11416222]. 51. Kredich, NM., (1996); Escherichia coli and Salmonella: Cellular and Molecular Biology.

Full Text Available On www.ijupbs.com

162 | P a g e International Standard Serial Number (ISSN): 2319-8141

52. Niedhardt, FC., editor. Vol. 1. ASM Press; Washington, D. C.: p. 514-527. 53. Newton GL, Fahey RC.(2002)Arch Microbiol.; 178:388. [PubMed: 12420157]. 54. Takayama K, Wang C, Besra GS. (2005); Clin Microbiol Rev.; 18:81. [PubMed: 15653820]. 55. Leyh TS., (1993); Crit Rev Biochem Mol Biol.:28–515. 56. Mougous JD, Green RE, Williams SJ, et. al. (2002); Chem Biol. 2002; 9:767. [PubMed: 12144918]. 57. Nathan C., (2004); Nature.; 431:899. [PubMed: 15496893]. 58. Schelle MW, Bertozzi CR. Chembiochem. 2006; 7:1516. [PubMed: 16933356]. 59. Williams SJ, Senaratne RH, Mougous JD, et. al. (2002); J Biol Chem. 2002; 277:32606. [PubMed: 12072441]. 60. Aoki Y, Kondoh M, Nakamura M, et. al. (1994); J Antibiot (Tokyo).; 47:909. [PubMed: 7928678]. 61. Ejim LJ, Blanchard JE, Koteva KP, et. al. (2007); J Med Chem.; 50:755. [PubMed: 17300162]. 62. Sambrook J., E. F. Fritsch, and T. Maniatis., (1989); Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 25-50. 63. Wilson, T., B. J. Wards, S. J. White, et. al. (1997); Production of avirulent Mycobacterium bovis strains by illegitimate recombination with deoxyribonucleic acid fragments containing an interrupted ahpC gene. Tuber. Lung Dis. 78:229–235. 64. Young, D. B., S. H. E. Kaufmann, P. W. M. Hermans, et. al. (1992); Mycobacterial protein antigens: a compilation. Mol. Microbiol. 6:133–145. 65. Meng X, Brodsky MH, Wolfe SA., (2005); A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Nat Biotechnol 23: 988–994. 66. Zahrt TC, Deretic V., (2000); An essential two-component signal transduction system in Mycobacterium tuberculosis. J Bacteriol 182: 3832–3838.

Full Text Available On www.ijupbs.com

163 | P a g e International Standard Serial Number (ISSN): 2319-8141

67. West, A. H., and Stock, A. M., (2001); Histidine kinases and response regulator proteins in two-component signaling systems. Trends Biochem. Sci. 26, 369−376. 68. Ryndak, M., Wang, S., and Smith, I., (2008); PhoP, a key player in Mycobacterium tuberculosis virulence. Trends Microbiol. 16, 528−534. 69. Lisa Y. Armitige, (2000); Disruption of the Genes Encoding Antigen 85A and Antigen 85B of Mycobacterium tuberculosis H37Rv: Effect on Growth in Culture and in Macrophages, Infection And Immunity,0019-9567/00/$04.0010, Vol. 68, No. 2., p. 767– 778. 70. Manman Guo, (2009); Dissecting transcription regulatory pathways through a new bacterial one-hybrid reporter system; by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/09; www.genome.org Genome Research, www.genome.org, 19:1301–1308. 71. Amit Singh, (2006); Dissecting virulence pathways of Mycobacterium tuberculosis through protein–protein association, PNAS www.pnas.org.cgi.doi.10.1073pnas.0602817103, vol. 103, no. 30, 11346–11351. 72. Tekaia, F., Gordon, S. V., Garnier, T., et. al. (1999); Tuber. Lung Dis. 79, 329–342. 73. Cohen, B. D., Lowy, D. R. & Schiller, J. T. (1993) Mol. Cell. Biol. 13, 6462–6468. 74. Li, B. & Fields, S., (1993); FASEB J. 7, 957–963.

Full Text Available On www.ijupbs.com