sign in sign up
<<
Home , Vitamin A

Downloaded from

British Journal of (2007), 97, 263–272 DOI: 10.1017/S0007114507182659 q The Authors 2007

https://www.cambridge.org/core

Vitamin A deficiency modifies in rat

Liliana B. Oliveros, Marı´a A. Domeniconi, Vero´nica A. Vega, Laura V. Gatica, Ana M. Brigada

and Marı´a S. Gimenez* . IP address: Laboratory of Biological Chemistry, Faculty of Chemistry, Biochemistry and Pharmacy, National University of San Luis, Avenida Eje´rcito de los Andes 954, 5700 San Luis, Argentina

170.106.33.22 (Received 11 January 2006 – Revised 24 May 2006 – Accepted 8 June 2006)

, on Liver of male rats fed on a A-deficient for 3 months from 21 d of age was evaluated. Vitamin A restriction

01 Oct 2021 at 13:42:02 produced subclinical plasma and negligible liver concentrations, compared with the control group receiving the same diet with 4000 IU vitamin A (8 mg retinol as )/kg diet. Vitamin A deficiency induced a hypolipidaemic effect by decreasing serum triacylglycerol, cholesterol and HDL-cholesterol levels. The decrease of liver total phospholipid was associated with low synthesis observed by lower [14C] incorporation into phosphatidylcholine, compared with control. Also, liver decreased, as was indicated by activity and mRNA expression of acetyl-CoA carboxylase (ACC), and incorporation of [14C]acetate into saponified . A decrease of the PPARa mRNA expression was observed. Liver mitochondria of vitamin A-deficient rats showed a lower total phospholipid concentration coinciding with a decrease of the cardiolipin proportion, without changes in the other phospholipid fractions determined. The mitochondria , subject to the Cambridge Core terms of use, available at fatty acid oxidation increased by 30 % of the control value and it was attributed to a high activity and mRNA expression of palmitoyl- transferase-I (CPT-I). An increase in serum b-hydroxybutyrate levels was observed in vitamin A-deficient rats. Vitamin A deficiency alters the mitochondria lipid composition and also enhances fatty acid oxidation by modifiying the production of malonyl-CoA, the endogenous inhibitor of CPT-I, due to decreased activity of liver ACC. The incorporation of vitamin A into the diet of vitamin A-deficient rats reverted all the changes observed.

Vitamin A deficiency: Carnitine palmitoyltransferase-I: Acetyl-CoA carboxylase: PPARa: Liver

Vitamin A deficiency is an important public health problem in of defences leading to hepatic lipoperoxidation many developing nations. Particularly, marginal vitamin A (Oliveros et al. 2000; Korichneva et al. 2003). deficiency is associated with increased morbidity and mor- Acetyl-CoA carboxylase (ACC) catalyses the first step com- tality in young children (Humphrey et al. 1992; Fawzi et al. mitted to fatty acid synthesis and is generally accepted to be a 1993). Vitamin A is a generic term which describes a potentially rate-limiting enzyme in that pathway. Mammals

https://www.cambridge.org/core/terms number of molecules exhibiting the biological activity of reti- have two major isoforms of ACC (a and b). ACCa is the nol, the precursor of naturally occurring . It is an major isoform in lipogenic tissues such as adipose and liver essential required for vision, growth, embryological tissue, and ACCb has a predominant location in heart and development, cell differentiation, reproduction, maintenance skeletal muscles (Lo´pez-Casillas & Kim, 1991). The carboxy- of mucous secretion and in man and rats. The mol- lation of acetyl-CoA by ACC produces malonyl-CoA, which ecular mechanism of action mainly involves the participates in fatty acid biosynthesis and also acts as a phys- binding and activation of specific nuclear receptors, retinoic iological regulator of fatty acid oxidation in the liver through acid receptor and X receptor, that modulate gene inhibition of carnitine palmitoyltransferase-I (CPT-I; McGarry expression (Chambon, 2005). The liver is the body’s main & Brown, 1997). CPT-I is an integral of the outer storage site for vitamin A and also regulates the secretion of mitochondrial membrane that catalyses the initial reaction in

. retinol into the circulation in response to the demands of vit- the mitochondrial import of long-chain fatty acid-CoA https://doi.org/10.1017/S0007114507182659 amin A-requiring target tissues (Blomhoff et al. 1990). where they are oxidized. This is a tightly regulated step in A relationship between vitamin A nutritional status and the cellular fatty acid utilization pathway. The enzyme exists blood lipids has been indicated. It is known that vitamin A as two isoforms encoded by separated genes, the liver-type and its derivatives cause hypertriglyceridaemia with high (L-CPT-I or CPT-IA), a hepatic-enriched, ubiquitously levels of intake (Dicken, 1881). On the other hand, it has expressed protein (McGarry, 1995), and the muscle-type been revealed that vitamin A deficiency in maturing male (M-CPT-I or CPT-IB) that is highly expressed in heart, skel- rats results in hypotriglyceridaemia and increased microvisc- etal muscle, brown and white adipocytes and testes (Esser osity of liver lipids (Kon’IIa et al. 1990) and also in a decrease et al. 1996). Retinoids have been proposed to regulate

Abbreviations: ACC, acetyl-CoA carboxylase; CPT-I, carnitine palmitoyltransferase-I. * Corresponding author: Dr Marı´a S. Gimenez, fax þ54 2652 430224/431301, email [email protected] Downloaded from

264 L. B. Oliveros et al.

mitochondrial processes. The existence of a retinoic acid bind- prepared according to AIN-93 for laboratory rodents (Reeves https://www.cambridge.org/core ing protein associated with mitochondria that binds and keeps et al. 1993). The diets have the following composition retinoic acid in the mitochondria has been described (Ruff & (g/kg): 397·5 starch, 100 sucrose, 132 dextrinized Ong, 2000). maize starch, 200 vitamin-free casein, 70 soyabean oil, 50 cel- The expression of several genes involved in intra- and lulose fibre, 35 AIN-93 mix, 10 AIN-93 vitamin mix extracellular is mediated by ligand-activated (devoid of vitamin A for the vitamin A-deficient diet), 3 receptors, collectively referred to as PPAR. PPAR activate or L-cystine, 2·5 choline bitartrate and 0·014 tert-butylhydroqui- repress gene expression in response to cognate ligands by none. Body weight and intake were registered daily.

binding in conjunction with the obligate heterodimerization . IP address: partner, , to specific cis-acting regulatory elements called peroxisome proliferator-response elements Plasma and liver retinol concentration analyses present in the promoter regions of target genes (Berger & Moller, 2002). Three different isoforms (a, g and d) have Rats were killed by cervical dislocation at 09:00 hours. Blood 170.106.33.22 been identified and found to exhibit tissue-specific distri- samples were collected in EDTA-coated tubes. The liver was butions; although all three exert broad regulatory effects separated, immediately washed several times in ice-cold iso- tonic saline, blotted on paper to remove excess blood and primarily on lipid homeostasis, PPARa predominantly regu- , on then weighed. To minimize photoisomerization of vitamin A lates pathways of fatty acid oxidation (Issemann et al. 01 Oct 2021 at 13:42:02 1993). Cross-talk between retinoid X receptor and PPARa the plasma and tissues samples were taken under reduced in the liver, activated by rexinoids (selective retinoid X recep- yellow light and frozen in the dark at 2708C until determi- tor-activators), has been reported (Ouamrane et al. 2003). nation of retinol concentrations. Analyses were carried out In view of the previous observations, it was of interest to within 1–3 weeks of obtaining the samples. Plasma and study the influence of retinol deficiency on liver fatty acid tissue retinol concentration was determined by HPLC (Bieri et al. 1979). Retinoids were extracted from plasma (0·5 ml) metabolism since this organ plays a major role in long-chain , subject to the Cambridge Core terms of use, available at fatty acid and vitamin A metabolism. We examined the syn- into hexane containing 5 mg /ml as thesis and oxidation of fatty acids and the mRNA expression antioxidant for analysis. To determine tissue retinol mass, tri- of enzymes of regulatory importance involved in those pro- plicate aliquots (0·2 g) of tissue were homogenized in deio- cesses. Also, the mRNA PPARa was analysed in the liver nized water, lyophilized and saponified in 1 ml ethanolic of vitamin A-deficient rats. Results were compared to the cor- solution containing 0·9 mol/l hydroxide for 1 h at responding data from rats fed on an isoenergetic sufficient 608C under nitrogen atmosphere. was used vitamin A diet. Finally, the effect of vitamin A restitution to as internal standard. Retinol and internal standard were vitamin A-deficient rats on lipid metabolism was analysed. extracted into hexane for analysis. Chromatography was per- formed on a Nucleosil 125 C-18 HPLC column with metha- nol–water (95:5, v/v) as the mobile phase. Retinol was Materials and methods detected by UV absorbance at 325 nm (Model 440; Waters Associates, Milford, MA, USA) and peak areas were calcu- Chemicals and radioisotopes lated by integration (Spectra Physics Analytical, San Jose, 14 2 14 [ C]NaCO3H (266·4 MBq/mmol), acetic acid, [1- C] CA, USA). 14 N L salt (73·99 MBq/mmol) and [ -Me- C] -carnitine were pur- https://www.cambridge.org/core/terms chased from Dupont, New England Company (Boston, MA, USA). Retynil-palmitate, all-trans retinol and lipids standards Serum lipid, and b-hydroxybutyrate determinations were acquired from Sigma Chemical Co. (St Louis, MO, USA). All other chemicals were reagent grade and were Glucose, lipid and b-hydroxybutyrate concentrations were obtained from Merck Laboratory (Buenos Aires, Argentina). detemined using fresh serum from rats that had been starved for 12 h. Serum glucose, cholesterol and HDL-cholesterol were determined by enzymatic methods using kits from Boeh- Diet and experimental design ringer Mannheim Diagnostics (Indianapolis, IN, USA). Serum b-hydroxybutyrate was analysed using an enzyme colori- Male Wistar rats were obtained from Romanelli S.R.L. metric assay (Sigma Chemical Co.).

(Buenos Aires, Argentina). Rats at 21 d old were housed indi- . vidually in stainless steel cages and randomly divided into two https://doi.org/10.1017/S0007114507182659 groups (eight per group) given either the experimental diet, Liver acetyl-CoA carboxylase activity devoid of vitamin A (vitamin A-deficient diet), or the same diet (control diet) supplemented with 4000 IU vitamin A The activity of ACC (EC 6.4.1.2) was measured in the cytoso- 14 2 (8 mg retinol as retinyl palmitate)/kg diet. Also, a group of lic fraction of liver using [ C]NaCO3H (266·4 MBq/mmol) eight deficient animals were fed with the control diet 15 d according to the method of Allred & Roehrig (1978). The before being killed (vitamin A-refed group) for determination liver was homogenized in an Ultra Turrax T25 machine of mRNA expressions. Rats were housed in individual cages with 1·5 volumes of cold 0·3 M-manitol and centrifuged at and kept in a 21–238C controlled environment with a 12 h 100 000 g for 1 h with a Beckman model L2 65B ultracentri- 14 2 light–dark cycle. They were given free access to food and fuge. Results were expressed in pmol [ C]NaCO3H fixed/ water throughout the entire 3 months of the experimental mg protein per min. Enzymatic assays were conducted in period. The experiment was conducted according to our duplicate. Protein concentration was determined using the committee recommendations for animal care. Diets were method of Lowry et al. (1951). Downloaded from

Vitamin A and liver lipid metabolism 265

Incorporation of [14C]acetate into liver lipids activity (,4 %) of the total homogenate catalase activity https://www.cambridge.org/core when assayed by the method of Chance et al. (1979). Liver slices (100 mg) were preincubated in 0·5 ml Krebs Ringer-glucose solution, pH 7·2, for 10 min at 378Cina 95 % air–5 % CO2 atmosphere. Then the medium was Lipid determinations in hepatic tissue and mitochondria replaced by 1·0 ml fresh Krebs Ringer solution with [14C]acet- The lipids from hepatic tissue and mitochondria were ate (0·04 MBq) added and the different samples were incu- extracted with chloroform–methanol (2:1) according to the bated for 60 min. The reaction was stopped by addition of method of Folch et al. (1957). An aliquot of the lipid extracts 0·2 ml 3 M-sulphuric acid and tissues were thoroughly

was taken to determine total cholesterol, and another one to . IP address: washed in ice-cold Krebs Ringer solution until no more radio- separate the different lipid fractions by TLC using plates activity was detected in the wash solution before storing coated with silica gel G (Merck, Darmstadt, Germany), with samples at 2708C until use. Lipids were saponified by treat- an n-hexane–diethyl ether–acetic acid (80:20:1, by vol.) sol- ment with 10 % (w/v) KOH in ethanol–water (100:15, v/v) 170.106.33.22 vent system. Lipids were detected by exposing the plates to for 3 h at 808C. NEFA were recovered from the lower phase vapours. After eluting the scraped bands, aliquots after acidification with 0·3 ml 1·2 M-HCl and extracted three were used for mass determination according to the methods times with petroleum ether (2·5 ml, boiling point 30–408C).

of Rauser et al. (1970) for phospholipids, of Sardesai & , on This fraction was dried down in a stream of nitrogen before

Manning (1968) for triacylglycerols and of Zak et al. (1954) 01 Oct 2021 at 13:42:02 counting its radioactivity. Aliquots of the non-saponified frac- after saponification (Abell et al. 1952) for free and esterified tion (upper phase) were used for separation of the cholesterol cholesterol. On average, 93 % of cholesterol mass was recov- fraction by TLC before counting its radioactivity in a Wallac ered by TLC. 1409 DSA liquid scintillation counter. The results are Phospholipids were separated into component species by expressed as mmol [14C]acetate incorporated/h per mg protein. TLC using silica gel G plates and chloroform–methanol–

water (65:25:4, by vol.) as the solvent system. The individual , subject to the Cambridge Core terms of use, available at Incorporation of [1-14C]choline into phosphatidylcholine phospholipids were identified, recovered and quantified for content as described earlier. The results were Slices of liver were preincubated in 0·5 ml Krebs Ringer-glu- expressed as percentage of total phospholipid phosphorus con- cose solution, pH 7·2, for 10 min at 378C in a 95 % air–5 % tent. The position of neutral lipids and individual phospholi- CO2 atmosphere. After that, the medium was replaced by pids was determined using the respective standard lipids. 0·5 ml fresh Krebs Ringer solution added with [1-14C]choline (0·04 MBq) added and the different samples were incubated for 60 min. The reaction was stopped by addition of 0·2 ml Carnitine palmitoyltransferase-I activity 3 M-sulphuric acid and tissues were thoroughly washed in The activity of CPT-I was assayed using a method similar ice-cold Krebs Ringer solution until no more radioactivity to that described by Grantham & Zammit (1986) with was detected in the wash solution. Phospholipid classes were some modifications. The CPT-I activity was measured in separated by TLC (described earlier) and bands were scraped mitochondria (400 mg protein) at 378C in the direction: palmi- off and their radioactivity quantified. The results are expressed toyl-CoA þ[14C]carnitine ! [14C]palmitoylcarnitine þ CoA. 14 as pmol [1- C]choline incorporated/h per mg protein. Assays were performed in a medium containing 150 mmol/l

KCl, 5 mM-Tris-HCl (pH 7·4), 1 mmol/l dithiothreitol, https://www.cambridge.org/core/terms 80 mmol/l palmitoyl-CoA, 1 mmol/l EGTA, 1·3 g/l defatted Preparation of mitochondria bovine serum albumin, 1 mg/l rotenone and 1 mg/l antimicyn Liver mitochondria were prepared according to McGarry et al. A. The mitochondria were preincubated in this medium for (1983) by isolating them from the low-speed nuclear pellet of 5 min at 378C before the initiation of the reaction. The reaction the original homogenate that yields mitochondria with only (500 ml final volume) was started with 0·2 mmol/l carnitine 14 minimal contamination from other subcellular organelles. and L-[N-Me- C]carnitine (0·04 MBq). After 4 min the reaction Briefly, were removed, immediately thereafter washed was stopped with 1 ml ice-cold 1·2 mol/l HCl, and water- several times in ice-cold isotonic saline and chopped with scis- saturated 1-butanol was added to extract the product sors in ice-cold 0·25 mol/l sucrose. The medium was decanted palmitoyl-[14C]carnitine. Aliquots were assayed for radioac-

and the tissue was resuspended in 10 volumes of fresh medium tivity in a Wallac 1409 DSA liquid scintillation counter. . and then homogenized in a Teflon pestle in a 10 ml Potter- Assays were run in duplicate and performed under conditions https://doi.org/10.1017/S0007114507182659 Elvehjem homogenizer mantained in ice throughout. The where product formation was linear with respect to both time homogenate was centrifuged at 1000 g for 15 min. The super- of incubation and amount of protein. natant was discarded and replaced with an equivalent volume of medium. The pellet was rehomogenized and centrifuged at RNA isolation and RT–PCR analysis of acetyl-CoA 600 g for 10 min. The supernatant was used as the source for carboxylase, carnitine palmitoyltransferase-I and PPARa mitochondria, and it was pelleted by centrifugation at 15 000 g for 15 min. The mitochondrial pellet was washed Total RNA was isolated from 200 mg liver using TRIzol (Life twice with 0·25 mol/l sucrose and 0·15 M-KCl and finally Technologies, New York, USA). All RNA isolations were per- resuspended in the latter and kept on ice until used (within formed as directed by the manufacturers. Gel electrophoresis 30 min). Protein was measured by the method of Lowry et al. and ethidium bromide staining confirmed the purity and integ- (1951). Preparations of mitochondria were practically devoid rity of the samples. Quantification of RNA was based on spec- of peroxisomes, as judged from measurements of catalase trophotometric analysis at 260/280 nm. Total RNA (10 mg) Downloaded from

266 L. B. Oliveros et al.

was reverse-transcribed with 200 U MMLV RT (Promega Inc., increased the plasma and liver vitamin A concentrations in https://www.cambridge.org/core Madison, WI, USA) using random hexamers as primers in a relation to vitamin A-deficient rats. 20 ml reaction mixture, following the manufacturer’s instruc- Vitamin A deficiency resulted in a significant decrease in tions. RT-generated fragments coded for b-actin (Choi & serum triacylglycerol, cholesterol and HDL-cholesterol con- Choi, 2000), ACC (Zhou et al. 1999), CPT-I (Zhou et al. centrations, but did not modify serum VLDL þ LDL-choles- 1999) and PPARa (Hoekstra et al. 2003). PCR was performed terol. The serum b-hydroxybutyrate levels increased (þ30 %) in 35 ml reaction solution containing 0·2 mM-dNTP, 1·5 mM- compared with control. In spite of a tendency toward lower MgCl2, 1·25 U Taq polymerase, 50 pmol of each rat specific serum glucose levels in the vitamin A-deficient rats compared

oligonucleotide primer and RT product (1/10 of RT reaction). with control rats, no statistical difference was observed. In the . IP address: The sequences of the different primers are shown on Table 1. vitamin A-refed group serum b-hydroxybutyrate and all lipid The predicted sizes of the PCR-amplified products were levels reached the control values (Table 2). 243 bp for b-actin, 535 bp for ACC, 629 bp for CPT-I and 106 bp for PPARa. The samples were heated to 948C for 170.106.33.22 Changes in lipid profile of liver with vitamin A-deficient diet 2 min, followed by thirty-five temperature cycles. Each cycle consisted of three periods: (1) denaturation, 948C for 1 min; As shown in Table 3, vitamin A deficiency affected the con-

(2) annealing, 588C for ACC, CPT-I and b-actin, and 608C tent of liver total phospholipids. Its concentration decreased, , on

for PPARa for 1 min; (3) extension, 728C for 1 min. After while cholesterol and triacylglycerol did not change in the 01 Oct 2021 at 13:42:02 thirty-five reaction cycles, the extension reaction was contin- vitamin A-deficient group in relation to those of the control ued for another 5 min (Thermal Cycler 2400, Perkin-Elmer). group. Consequently, the ratio of total cholesterol/phospholi- The PCR products were electrophoresed on 2 % (w/v) agar- pids increased (P,0·05) in the liver of vitamin A-deficient ose gel with 0·01 % (w/v) ethidium bromide. The image was rats. Vitamin A refeeding normalized the phospholipid visualized and photographed under UV transillumination. content.

The intensity of each band was measured using National Insti- , subject to the Cambridge Core terms of use, available at tutes of Health Image software and reported as the values of Effect of vitamin A deficiency on the synthesis of band intensity units. phosphatidylcholine, sphingomyelin, fatty acids and cholesterol in liver slices Statistical analyses The [14C]choline incorporated into phosphatidylcholine by Data are presented as means and their standard errors. Signifi- liver was decreased by ,43 % in the vitamin A-deficient cant differences among means were considered at a level of rats, without change in sphingomyelin, when compared with 14 P,0·05 and identified by one-way ANOVA. control. The [ C]acetate incorporated into the saponifiable lipid fraction, indicating de novo synthesis of fatty acids, was decreased in liver from vitamin A-deficient rats Results (P,0·001). No change in non-saponifiable (cholesterol) lipid fractions Body and liver weight, plasma and liver retinol, and serum was observed. lipids In the vitamin A-refed animals the decrease of [14C]choline 14 The initial body weight of the rats in the three dietary groups incorporation into phosphatidylcholine and that of [ C]acet- https://www.cambridge.org/core/terms was similar. At the time of killing, there was a significant ate into fatty acids were partially reversed (Table 4). effect of vitamin A deficiency on body weight gain, while that of the vitamin A-refed group was near to control and sig- Liver acetyl-CoA carboxylase activity: effect of vitamin A nificantly higher than that of vitamin A-deficient rats deficiency (P,0·05). The liver weight did not change among groups. Since plasma retinol is not directly representative of liver As shown in (Fig. 1), the ACC activity was significantly lower vitamin A stores, the vitamin A deficiency was confirmed (by 36 %) in the liver of vitamin A-deficient rats than those of by analysis of liver concentrations of retinol. The plasma reti- controls. Vitamin A refeeding in deficient animals did not nol concentrations of rats fed on the vitamin A-deficient diet completly restored the enzyme activity to control values.

were significantly lower (P,0·001) than those of control. The cytosolic protein concentration was not modified among . Total liver retinol stores of vitamin A-deficient rats were the three groups in the supernatant used to measure the https://doi.org/10.1017/S0007114507182659 depleted, being ,7 % of the accumulated total liver retinol enzyme activity (data not shown). Thus, the change observed stores of control rats. Vitamin A refeeding considerably in the enzyme activity was specifically due to change in

Table 1. Sequences of the primers used to amplify the different genes by RT–PCR and sizes of the fragments generated

Gene Gen Bank accession Forward primer Reverse primer Amplicon size (bp)

b-Actin NM 031144 CGTGGGCCGCCCTAGGCACCA TTGGCCTTAGGGTTCAGAGGGG 243 CPT-I L07736 TATGTGAGGATGCTGCTTCC CTCGGAGAGCTAAGCTTGTC 629 ACC M76767 ACTCCAGGACAGCACAGATC TCTGCCAGTCCAATTCTAGC 535 PPARa NM013196 TGAACAAAGACGGGATG TCAAACTTGGGTTCCATGAT 106

ACC, acetyl-CoA carboxylase; CPT-I, carnitine palmitoyltransferase-I. Downloaded from

Vitamin A and liver lipid metabolism 267

Table 2. Body and liver weight, plasma and tissue retinol levels, and serum lipids and b-hydroxybutyrate https://www.cambridge.org/core in vitamin A-deficient rats (eight rats per dietary group)‡ (Mean values with their standard errors)

Control Vitamin A-deficient Vitamin A-refed

Mean SEM Mean SEM Mean SEM

Initial body wt (g) 49·50 2·2 51·03 2·4 52·01 2·8 Body wt gain (g) 313·5 8·1 275·1*† 6·4 309·7 8·5

Total liver wt (g) 12·9 0·73 11·05 0·67 11·9 0·84 . IP address: Liver retinol (mmol/g wt) 1·65 0·06 0·11***††† 0·01 1·48 0·05 Plasma retinol (mmol/l) 1·42 0·05 0·45***††† 0·02 1·33 0·06 Serum glucose (mg/dl) 119 6·1 107 2·8 113 3·7

Serum b-hydroxybutyrate (mg/dl) 8·63 0·24 12·50*† 0·57 8·01 0·63 170.106.33.22 Triacylglycerol (mg/dl) 80·45 1·11 59·09***††† 1·16 75·97 1·34 Total cholesterol (mg/dl) 57·12 2·16 40·33**†† 1·27 55·65 2·31 HDL-cholesterol (mg/dl) 42·47 1·90 29·53*† 1·45 41·06 1·85 LDL þ VLDL-cholesterol (mg/dl) 14·41 1·71 11·01 1·36 13·78 1·90

, on

Mean values were significantly different from those of the control group (one-way ANOVA): *P,0·05; **P,0·01; 01 Oct 2021 at 13:42:02 ***P,0·001. Mean values were significantly different from those of the vitamin A-refed group (one-way ANOVA): †P,0·05; ††P,0·01; †††P,0·001. ‡ For details of procedures, see pp. 264–265.

the activity itself but it was not influenced by the total soluble vitamin A refeeding, no statistical differences were observed , subject to the Cambridge Core terms of use, available at protein concentration. compared with vitamin A-deficient rats. No changes in choles- terol contents among the three groups were observed. On a percentage basis the phospholipid composition was Mitochondrial carnitine palmitoyltransferase-I activity: effect modified in the mitochondria of vitamin A-deficient rats, show- of vitamin A deficiency ing a significant decrease in cardiolipin content (P,0·01) The CPT-I activity in the liver mitochondria of rats fed on the compared with controls. No change in phosphatidylcholine, phosphatidylethanolamine, sphingomyelin and phosphatidyl- vitamin A-deficient diet was increased by 40 % of the control inositol þ phosphatidylserine content was observed (Table 6). value. This increase was reverted by vitamin A refeeding, reaching values similar to control (Fig. 2).

Vitamin A deficiency on the levels of mRNA expression of Liver mitochondria lipid content carnitine palmitoyltransferase-I, acetyl-CoA carboxylase and PPARa The content of the different mitochondrial lipids of liver is showed in Table 5. The concentration of triacylglycerols As shown in Fig. 3, the expression of CPT-I mRNA, the main https://www.cambridge.org/core/terms increased and total phospholipid contents decreased in the regulator of fatty acid b-oxidation, was increased in vitamin vitamin A-deficient group in relation to that of the control A-deficient rats (P,0·01) as compared to controls and totally group. The vitamin A refeeding partially restored the phospho- restored by the vitamin A refeeding. The expression of ACC lipid content. In spite of a tendency toward recovering the tri- mRNA was significantly lower in liver from vitamin acylglycerol mass and cholesterol/phospholipid ratio after A-deficient rats than those from control and vitamin A-refed

Table 3. Effect of vitamin A deficiency on liver lipid composition (mmol/g liver; eight rats per dietary group)‡

(Mean values with their standard errors) .

https://doi.org/10.1017/S0007114507182659

Control Vitamin A-deficient Vitamin A-refed

Mean SEM Mean SEM Mean SEM

Triacylglycerol 10·12 2·51 11·01 0·86 9·76 1·35 Total cholesterol 6·80 0·48 6·31 0·64 7·05 0·21 Free cholesterol 6·01 0·75 5·60 0·93 6·43 0·46 Esterified cholesterol 0·79 0·05 0·69 0·08 0·62 0·07 Phospholipids 35·60 0·97 27·01*† 1·03 37·03 0·82 Total cholesterol/phospholipids 0·19 0·06 0·24**†† 0·04 0·19 0·05

Mean values were significantly different from those of the control group (one-way ANOVA): *P,0·05; **P,0·01. Mean values were significantly different from those of the vitamin A-refed group (one-way ANOVA): †P,0·05; ††P,0·01. ‡ For details of procedures, see pp. 264–265. Downloaded from

268 L. B. Oliveros et al.

14 Table 4. Incorporation of [1- C]acetate into saponified and non-saponified lipid fractions, and https://www.cambridge.org/core [methyl-14C]choline into phosphatidylcholine and sphingomyelin (two experiments with four rats per dietary group)‡ (Mean values with their standard errors)

Vitamin A- Control Vitamin A-deficient refed

Mean SEM Mean SEM Mean SEM

14 Incorporation of [1- C]acetate (mmol/h per mg protein) . IP address: Fatty acids (saponified lipids) 6·52 0·72 3·73***† 0·28 5·25 0·76 Cholesterol (non-saponified lipid) 0·70 0·08 0·65 0·09 0·81 0·10 Incorporation of [methyl-14C]choline (pmol/h per mg protein)

Phosphatidylcholine 33·12 2·41 18·07***† 1·76 26·02 2·05 170.106.33.22 Sphingomyelin 9·22 2·17 7·89 1·18 7·96 1·55

Mean values were significantly different from those of the control group (one-way ANOVA): ***P,0·001. Mean values were significantly different from those of the vitamin A-refed group (one-way ANOVA): †P,0·05. ‡ For details of procedures, see pp. 264–265. , on

01 Oct 2021 at 13:42:02 groups. The restitution of vitamin A to the diet of vitamin A- reliably predict liver stores unless the plasma level reaches deficient rats did not completely restore the ACC mRNA ,0·35 mmol/l (Olson, 1982). In the present study, the 3 expression to control values. months of vitamin A deprivation after weaning produced subcli- A significant decrease of PPARa mRNA expression nical plasma retinol concentration and negligible total retinol

(P,0·001) was observed in vitamin A-deficient rats in relation stores in the liver; the data confirmed vitamin A deficiency. , subject to the Cambridge Core terms of use, available at to control. The vitamin A refeeding reverted that change, Lower body weights of vitamin A-depleted rats has also been reaching values similar to control indicating that PPARa shown by other authors (Wright et al. 2002). We have previously could be involved in the effects of vitamin A deficiency. demonstrated that deprivation of vitamin A for 3 months does not affect daily food intake in relation to control rats (Oliveros et al. 2000). Discussion It is well established that liver phospholipid content decreases The present in vivo study was undertaken to investigate the effect in rats with vitamin A deficiency (Khanna & Reddy, 1983) and, of vitamin A deprivation on liver fatty acid metabolism. The by contrast, it increases in guinea pigs with the administration of quantity of retinol stored in the neonatal liver during the nursing 30 mg retinol for 7 d (Alarcon Corredor et al. 1996). In the pre- period is greatly influenced by maternal diet during lactation. sent study, we have also observed a lower content of total phos- We did not restrict the vitamin A intake of the dams of the exper- pholipids in liver of vitamin A-deficient rats. This was imental rats, and for this reason we prolonged the vitamin A diet- associated with a lower synthesis of the major phospholipid ary deficiency for 3 months. Plasma retinol levels alone do not since [14C]choline incorporation into phosphatidylcholine

https://www.cambridge.org/core/terms 50 25 * 45

40 20 C]

35 C] 14 *† 14 30 15 25

20

10 .

https://doi.org/10.1017/S0007114507182659 15 fixed/min per mg protein) – 3 ACC activity (pmol [ 10 CPT-I activity (nmol [ 5 HCO 5

0 Control Vitamin Vitamin carnitine incorporated/min per mg protein) 0 A-deficient A-refed Control Vitamin Vitamin A-deficient A-refed Fig. 1. Acetyl-CoA carboxylase (ACC) activity in the liver of control, vitamin A- deficient and vitamin A-refed rats. For details of procedures, see pp. 264–265. Fig. 2. Carnitine palmitoyltransferase-I (CPT-I) activity in the liver mitochondria Values are means with their standard errors depicted by vertical bars (eight rats of control, vitamin A-deficient and vitamin A-refed rats. For details of procedures, per dietary group). Mean value was significantly different from that of the control see pp. 264–265. Values are means with their standard errors depicted by verti- group: *P,0·001. Mean value was significantly different from that of the vitamin cal bars (eight rats per dietary group). Mean value was significantly different A-refed group: †P,0·01. from those of the control group and the vitamin A-refed group: *P,0·001. Downloaded from

Vitamin A and liver lipid metabolism 269

Table 5. Effect of vitamin A deficiency on liver mitochondrial lipid compositions (mg/g protein; https://www.cambridge.org/core eight rats per dietary group)‡ (Mean values with their standard errors)

Control Vitamin A-deficient Vitamin A-refed

Mean SEM Mean SEMQ Mean SEM

Cholesterol 5·42 0·46 4·80 0·59 5·60 0·57 Triacylglycerols 6·10 0·32 8·76** 0·45 7·51 0·38

Phospholipids 90·02 6·83 63·50**† 4·79 80·12 3·16 . IP address: Cholesterol/phospholipids 0·060 0·006 0·075* 0·008 0·071 0·009

Mean values were significantly different from those of the control group (one-way ANOVA): *P,0·05; **P,0·01.

Mean values were significantly different from those of the vitamin A-refed group (one-way ANOVA): †P,0·05. 170.106.33.22 ‡ For details of procedures, see pp. 264–265.

Table 6. Effect of the diet on phospholipid compositions of liver mitochondria (percentage of total lipid phosphorus

, on (w/w); eight rats per dietary group)‡

01 Oct 2021 at 13:42:02 (Mean values with their standard errors)

Control Vitamin A-deficient Vitamin A-refed

Mean SEM Mean SEM Mean SEM

Cardiolipin 22·05 1·63 15·06** 1·05 18·61 1·75 Phosphatidylcholine 44·10 2·01 49·14 1·70 45·67 2·30 , subject to the Cambridge Core terms of use, available at Phosphatidylethanolamine 27·04 1·64 28·10 1·88 26·51 2·02 Sphingomyelin 1·74 0·07 1·67 0·09 1·81 0·11 Phosphatidylserine þ phosphatidylinositol 5·08 0·84 6·01 0·96 6·89 0·79

Mean values were significantly different from those of the control group (one-way ANOVA): **P,0·01. ‡ For details of procedures, see pp. 264–265. decreased. In addition, the decreased incorporation of [14C]acet- palmitoyltransferase-II does not possess a malonyl-CoA bind- ate into saponifiable lipids and the low activity of ACC indicated ing domain (Cohen et al. 1998). a decrease in fatty acid synthesis, suggesting a low availability of Furthermore, the high CPT-I activity coincided with an fatty acids to form phospholipids in the liver of vitamin A- enhanced CPT-I mRNA level, and the low ACC activity deficient rats. These metabolic changes can possibly affect the was in agreement with a decreased ACC gene. The incorpor- serum lipid levels. In particular, phospholipids are an important ation of vitamin A into the diet of vitamin A-deficient rats component of HDL, the level of which is reduced in serum of considerably improved both activities and genes expressions vitamin A-deficient rats. of CPT-I and ACC. https://www.cambridge.org/core/terms Vitamin A deficiency did not alter liver cholesterol syn- To gain more insight into the control of fatty acid metab- thesis, since incorporation of [14C]acetate into cholesterol olism by vitamin A deficiency, we have examined the tran- was not modified compared with control. However, there scriptional regulation of the PPARa gene, which plays a was a decrease of the serum cholesterol associated with a pivotal role in the transcriptional regulation of genes involved low HDL-cholesterol level. Although the mechanism of this in cellular lipid metabolism (Issemann et al. 1993; Kersten, hypolipidaemic effect is not the purpose of the present 2002). The low PPARa mRNA expression in vitamin study, the possibility that vitamin A deficiency may play a A-deficient rats could be explained by low fatty acid synthesis role in altering lipoprotein secretion from the liver into the cir- and the depletion of retinoids, since fatty acids are able to acti- culation can be considered. It has been shown that retinoic vate PPARa (Forman et al. 1997), and 9-cis retinoic acid is

acid increases in a dose-dependent manner the secretion of the ligand for the retinoid X receptor, which in turn acts as .

https://doi.org/10.1017/S0007114507182659 apo A I, B 100, C III and A II in cultures of Hep G2 cells the dimerization partner for PPARa. The expression of the (Liu et al. 2001). In addition, we have observed a decrease PPARa gene was restored with a vitamin A-sufficient diet, in serum triacylglycerol levels in vitamin A-deficient rats. indicating that it is involved in the effects of vitamin A Fatty acid utilization through the mitochondrial b-oxidation deficiency on liver fatty acid metabolism. pathway was clearly affected by the vitamin A deficiency. The We also observed a significant decrease of total phospholi- increase in serum b-hydroxybutyrate was attributed to high pid content in mitochondria of vitamin A-deficient rats given CPT-I activity in liver mitochondria of vitamin A-deficient an increased cholesterol–phospholipid relation, suggesting rats. This fact was associated with the low ACC activity, that membrane fluidity can be altered. Kon’IIa et al. (1990) which catalyses the formation of malonyl-CoA (Lo´pez- found that vitamin A deficiency in maturing male rats changes Casillas & Kim, 1991), a strong inhibitor of synthesis and acti- the lipid composition of liver microsomal membranes vation of CPT-I (Jackson et al. 2000). Malonyl-CoA increasing the cholesterol/phospholipid ratio. We have seen sensitivity is an intrinsic property of L-CPT-I since carnitine a significant decrease (by 36 %) of mitochondrial cardiolipin Downloaded from

270 L. B. Oliveros et al.

(A) 1500 https://www.cambridge.org/core *† +A –A R 1000

< 629 bp 500 Arbitrary units 0 +A –A R

. IP address: (B) 1000

750 *†

170.106.33.22 500 < 535 bp 250 Arbitrary units

, on 0 +A –A R 01 Oct 2021 at 13:42:02

(C) 1500

**† 1000

, subject to the Cambridge Core terms of use, available at < 106 bp 500 Arbitrary units 0 +A –A R

(d) < 243 bp

Fig. 3. Expression of genes involved in liver fatty acid metabolism. For details of procedures, see pp. 264–265. Bars show quantification of the intensity of the fragment bands in relation to the intensity of the internal control bands. Values are means with their standard errors depicted by vertical bars (four rats per dietary group). þ A, control; 2A, vitamin A-deficient; R, vitamin A-refed rats. Mean value was significantly different from that of the þA group: *P,0·001; **P,0·01. Mean value was significantly different from that of the R group: †P,0·01. The photographs are ethidium bromide-stained agarose gels of carnitine palmitoyltrans- ferase-I PCR products (A); acetyl-CoA carboxylase PCR products (B); PPARa PCR products (C); b-actin PCR products, used as an internal control (D). The results are typical of four independent observations.

https://www.cambridge.org/core/terms content induced by vitamin A deficiency that could also indi- input of fatty acids and consequently their b-oxidation in cate a mitochondrial dysfunction. Cardiolipin is recognized to the liver of vitamin A-deficient rats. be an essential phospholipid in eukaryotic energy metabolism The present results confirm and extend the observation that and in maintaining mitochondrial structure and function. vitamin A depletion rendered important alterations in total A direct relationship between cardiolipin loss and cytochrome liver lipid metabolism and mitochondrial lipid compositions. c release from mitochondria has been identified as an initial In particular, the results show that 3 months of feeding the vita- step in the phatway to apoptosis (McMillin & Dowhan, min A-deficient diet to the rats causes a significant increase in 2002). In addition, in a previous report we showed that vit- mitochondrial fatty acid oxidation by an enhancement of CPT- amin A deprivation for 3 months induces oxidative stress in I activity and gene expression. This is mainly attributed to a

. rat liver (Anzulovich et al. 2000). It is known that reactive decrease in availability of malonyl-CoA due to a diminution https://doi.org/10.1017/S0007114507182659 oxygen species affect the activity of heart mitochondrial com- of ACC activity and gene expression. The present observation plex III leading to mitochondrial dysfunction via cardiolipin establishes an explanation for vitamin A action, which could oxidative damage. This has been mainly ascribed to a specific control energetic mitochondrial processes in situations such as loss in mitochondrial content of cardiolipin (Petrosillo et al. retinoic treatment. 2003). The increased triacylglycerol content could be due to a decrease in the lipid membrane turnover, as has been suggested by Barber et al. (2000), who found changes in Acknowledgements lipid composition of liver mitochondria associated with oxi- dative damage induced by chronic vitamin A deficiency. Marı´a Sofı´a Gimenez is a member of the National Investi- Considering all these observations, it is also conceivable gations Council of Science and Technology (CONICET), that modified mitochondria lipid composition can alter the Argentina. Downloaded from

Vitamin A and liver lipid metabolism 271

References Issemann I, Prince RA, Tugwood JD & Green S (1993) The peroxi- https://www.cambridge.org/core some proliferator-activated receptor:retinoid X receptor heterodi- Abell LL, Levy BB, Brodie BB & Kendall FE (1952) A simplified mer is activated by fatty acids and fibrate hypolipidaemic drugs. method for the estimation of total cholesterol in serum and demon- J Mol Endocrinol 11, 37–47. stration of its specificity. J Biol Chem 195, 357–366. Jackson VN, Zammit VA & Price NT (2000) Identification of positive Alarcon Corredor OM, Silva Larralte T, Chacon Patino A, and negative determinants of malonyl-CoA sensitivity and carnitine Pachano Primera YJ, Alarcon AO & Reinosa J (1996) Changes affinity within the amino termini of rat liver- and muscle-type carni- in liver and kidney phosphorus in guinea pigs exposed to high tine palmitoyltransferase I. J Biol Chem 275, 38410–38416. doses of citamin a (retinol). Acta Cient Venez 47, 127–131. Kersten S (2002) Peroxisome proliferator activated receptors and obes-

Allred JB & Roehrig KL (1978) Heat activation of rat liver acetyl- ity. Eur J Pharmacol 440, 223–234. . IP address: CoA carboxylase in vitro. J Biol Chem 253, 4826–4829. Khanna A & Reddy TS (1983) Effect of undernutrition and vitamin Anzulovich AC, Oliveros LB, Mun˜oz E, Martı´nez LD & Gimenez MS A deficiency on the phospholipid composition of rat tissues at 21 (2000) Nutritional vitamin A deficiency alters antioxidant defenses days of age. I. Liver, spleen and kidney. Int J Vitam Nutr Res and modifies the liver histoarchitecture in rat. J Trace Elem Exp 53,3–8. 170.106.33.22 Med 13, 343–357. Kon’ IIa, Sokolov AI, Filatov IIu, Deev AI & Gapparov MM (1990) Barber T, Borra´s E, Torres L, Garcı´a C, Cabezuelo F, Lloret A, Vitamin A and microsomal membranes: the effect of retinol Pallardo´ F & Vin˜a JR (2000) Vitamin A deficiency causes oxidative deficiency on lipid microviscosity and phospholipid turnover in damage to liver mitochondria in rats. Free Radic Biol Med 29,1–7. rat liver microsomes. Biokhimiia 55, 982–987. , on

Berger J & Moller DE (2002) The mechanisms of action of PPARs. Korichneva I, Waka J & Hammerling U (2003) Regulation of the car- 01 Oct 2021 at 13:42:02 Annu Rev Med 53, 409–435. diac mitochondrial membrane potential by retinoids. J Pharmacol Bieri J, Tolliver T & Catagnani G (1979) Simultaneous determination Exp Ther 305, 426–433. of alpha- and retinol in plasma or red cells by Liu H, Wu Z & Liu B (2001) Effects of retinoic acid on secretion of high pressure liquid chromatography. Am J Clin Nutr 32, apolipoproteins A I, A II, B 100, C III and E by cultures of HepG2 2143–2149. cells. Hua Xi Yi Ke Da Xue Xue Bao 32, 52–54. Blomhoff R, Green MH, Berg T & Norum KR (1990) Transport and Lo´pez-Casillas F & Kim K-H (1991) The 50 untranslated regions of storage of vitamin A. Science 250, 399–404. acetyl coenzyme A carboxylase mRNA provide specific transla- , subject to the Cambridge Core terms of use, available at Chambon P (2005) The superfamily: a personal ret- tional control in vitro. Eur J Biochem 201, 119–127. rospect on the first two decades. Mol Endocrinol 19, 1418–1438. Lowry OH, Rosebrough NJ, Farr AL & Randall RJ (1951) Protein Chance B, Sies H & Boveris A (1979) Hydroperoxide metabolism in measurement with the Folin phenol reagent. J Biol Chem 193, mammalian tissue. Physiol Rev 59, 527–605. 265–275. Choi JW & Choi HS (2000) The regulatory effects of thyroid hor- McGarry JD (1995) The mitochondrial carnitine palmitoyltransferase mone on the activity of 3-hydroxy-3-methylglutaryl coenzyme A system: its broadening role in fuel homoeostasis and new insights reductase. Endocr Res 26, 1–21. into its molecular features. Biochem Soc Trans 23, 321–324. Cohen I, Kohl C, McGarry JD, Girard J & Prip-Buus C (1998) The McGarry JD & Brown NF (1997) The mitochondrial carnitine palmi- N-terminal domain of rat liver carnitine palmitoyltransferase 1 toyltransferase system. Eur J Biochem 244, 1–14. mediates import into the outer mitochondrial membrane and is McGarry JD, Mills SE, Long CS & Foster DW (1983) Observations essential for activity and malonyl-CoA sensitivity. J Biol Chem on the affinity for carnitine, and malonyl-CoA sensitivity, of carni- 273, 29896–29904. tine palmitoyltransferase I in animal and human tissues. Biochem J Dicken CH (1981) Elevation of blood triglyceride levels secondary to 214, 21–28. administration of vitamin A. Arch Dermatol 117, 189–190. McMillin JB & Dowhan W (2002) Cardiolipin and apoptosis. Bio- Esser V, Brown NF, Cowan AT, Foster DW & McGarry JD (1996) chim Biophys Acta 1585, 97–107.

Expression of a cDNA isolated from rat brown adipose tissue Oliveros LB, Vega VA, Anzulovich AC, Ramı´rez DC & https://www.cambridge.org/core/terms and heart identifies the product as the muscle isoform of carnitine Gime´nez MS (2000) Vitamin A deficiency modifies antioxidant palmitoyltransferase I (M-CPT I). M-CPT I is the predominant defenses and essential element contents in rat heart. Nutr Res CPT I isoform expressed in both white (epididymal) and brown 20, 1139–1150. adipocytes. J Biol Chem 271, 6972–6977. Olson JA (1982) New approaches to methods for the assessment of Fawzi WW, Chalmors TC, Herrera MG & Mosteller F (1993) Vita- nutritional status of the individual. Am J Clin Nutr 35, min A supplementation and – a meta analysis. 1166–1168. J Am Med Assoc 269, 898–903. Ouamrane L, Larrieu G, Gauthier B & Pineau T (2003) RXR Folch J, Lees M & Sloane-Stanley GH (1957) A simple method for activators molecular signalling: involvement of a PPAR alpha- the isolation and purification of total lipids from animal tissues. dependent pathway in the liver and kidney, evidence for J Biol Chem 2, 497–509. an alternative pathway in the heart. Br J Pharmacol 138,

Forman BM, Chen J & Evans RM (1997) Hypolipidemic drugs, 845–854. .

https://doi.org/10.1017/S0007114507182659 polyunsaturated fatty acids, and eicosanoid are ligands for peroxi- Petrosillo G, Ruggiero FM, DiVenosa N & Paradies G (2003) some proliferator-activated receptors a and d. Proc Natl Acad Sci Decreased complex III activity in mitochondria isolated from rat USA94, 4312–4317. heart subjected to ischemia and reperfusion: role of reactive Grantham BD & Zammit VA (1986) Restoration of the properties of oxygen species and cardiolipin. FASEB J 17, 714–716. carnitine palmitoyltransferase I in liver mitochondria during re- Rauser G, Fluster S & Yamamoto A (1970) Two dimensional thin- feeding of starved rats. Biochem J 239, 485–488. layer chromatographic separation of polar lipid and determination Hoekstra M, Kruijt JK, Van Eck M & Van Berkel TJ (2003) Specific of phospholipid analysis of spots. Lipids 5, 494–496. gene expression of ATP-binding cassette transporters and nuclear Reeves PG, Nielsen FH & Fahey GC Jr (1993) AIN-93 purified receptors in rat liver parenchymal, endothelial, and diets for laboratory rodents: final report of the American Institute Kupffer cells. J Biol Chem 278, 25448–25453. of Nutrition Ad Hoc Writing Committee on the Reformulation of Humphrey JH, West KP Jr & Sommer A (1992) Vitamin A deficiency the AIN-76A. Rodent Diet J Nutr 123, 1939–1951. and attributable mortality among under-5-year-olds. Bull WHO 70, Ruff SJ & Ong DE (2000) Cellular retinoic acid binding protein is 225–232. associated with mitochondria. FEBS Lett 24457, 1–5. Downloaded from

272 L. B. Oliveros et al.

Sardesai VM & Manning JA (1968) Determination of triglycerides in Zak B, Moss N, Boyle AS & Zlatkis A (1954) Reactions of certain unsa- https://www.cambridge.org/core plasma and tissues. Clin chem 14, 156–161. turated with acid reagent. Anal Chem 26, 776–777. Wright GL, Wang S, Fultz ME, Arif I, Matthews K & Chertow BS Zhou YT, Wang ZW, Higa M, Newgard CB & Unger RH (1999) (2002) Effect of vitamin A deficiency on cardiovascular function Reversing adipocyte differentiation: implication for treatment of in the rat. Can J Physiol Pharmacol 80,1–7. obesity. Proc Natl Acad Sci U S A 96, 2391–2395.

. IP address:

170.106.33.22

, on

01 Oct 2021 at 13:42:02

, subject to the Cambridge Core terms of use, available at

https://www.cambridge.org/core/terms

.

https://doi.org/10.1017/S0007114507182659