Characterization of Akt Overexpression in Miapaca-2 Cells
Total Page：16
File Type：pdf, Size：1020Kb
ANTICANCER RESEARCH 28 : 957-964 (2008) Characterization of Akt Overexpression in MiaPaCa-2 Cells: Prohibitin Is an Akt Substrate both In Vitro and in Cells EDWARD KYU-HO HAN, THOMAS MCGONIGAL, CHRIS BUTLER, VINCENT L. GIRANDA and YAN LUO Abbott Laboratories, Department of R47S, Cancer Research, Global Pharmaceutical Research Division, Abbott Park, IL 60064, U.S.A. Abstract. Akt (PKB) is a serine/threonine protein kinase that is activated by growth factors, cytokines and insulin. that plays an important role in the transduction of signals Activated PI-3K produces PI-3,4,5-P 3 and PI-3,4,-P 2 that affecting apoptosis, cell proliferation and survival. The Akt interact with Akt and recruit Akt from the cytosol to the gene is frequently hyperactivated in tumors and has been plasma membrane. Following membrane localization, Akt is shown to be amplified in a number of types of human phosphorylated at Thr-308 in the T-loop (kinase activation cancers. Furthermore, Akt activity is elevated in cell lines loop) and Ser-473 in the carboxy-terminal tail (hydrophobic with the mutated PTEN tumor suppressor gene. These studies motif). Thr-308 phosphorylation is required for Akt establish Akt as an attractive target for cancer therapy. To activation, while Ser-473 phosphorylation is only needed for determine the roles of Akt1, Akt2 and Akt3 in signal maximal activity. Thr-308 is phosphorylated by 3- transduction, constitutively active Akt1, Akt2 and Akt3 was phophoinositide dependent kinase (PDK1), which is ectopically overexpressed in human pancreatic MiaPaCa-2 activated by PI-3K lipid products (2). cells. The three Akt stable clones were characterized to AKT is emerging as a key player in human cancer. Akt1 and determine their effects on transformation and proliferation. Akt2 genes are amplified in a human gastric and ovarian cancer Compared to a vector control, the three Akt clones were able (7). Akt3 activity and expression were up-regulated in estrogen to drive cellular proliferation even in reduced serum receptor-negative breast tumors and breast carcinomas and conditions. Furthermore, in soft-agar assays, the Akt clones androgen-insensitive prostate cell lines (14). Furthermore, Akt showed an 25-38% increase in colony formation in 2% transforms cells. For example, overexpression of constitutively serum. Our results indicate that all three forms of Akt may active Akt1 or Akt2 transforms NIH3T3 fibroblasts (1, 8, 11). have protective effects within the cell depending on the type Akt-3 overexpression in MCF-7 cells results in estrogen- of apoptotic stimuli. Using 2D-PAGE comparisons between independence for tumor formation (4). parental and Akt overexpressing cells, we attempted to Using two-dimensional-polyacry la mide gel electrophoresis determine novel targets of Akt phosphorylation. In this study, (2D-PAGE) and an Akt substrate phosphor specific antibody, we identified prohibitin as a substrate for Akt both in vitro we identified a number of potential new targets of Akt and in vivo. These studies suggest that Akt may regulate the phosphorylation. One of these targets was identified as cellular function of prohibitin via its phosphorylation. prohibitin-1 and additional studies were undertaken to confirm this relationship. The prohibitins, prohibitin-1 and The serine/threonine protein kinase B (Akt/PKB) plays a prohibitin-2 are highly conserved proteins in eukaryotic cells major role in cellular processes such as cell growth, cell present in multiple compartments. The prohibitins act as proliferation and apotosis (3). In humans, there are three chaperones in the assembly of subunits of mitochondrial closely related, highly conserved homologues designated as respiratory chain complexes (15). Furthermore, prohibitin-1 Akt1, Akt2, and Akt3. The Akt kinase is a major downstream is required for ras-induced raf-MEK-ERK activation and target of the phosphatidylinositol 3-kinase (PI-3K) pathway epithelial cell migration (16, 17). Recent studies indicated that prohibitins are localized in the nucleus and can modulate transcriptional activity by interacting with various transcriptional factors (12, 13). Prohibitin-2 inhibits muscle Correspondence to: Edward K. Han, Ph.D., Abbott Laboratories, differentiation by repressing the transcriptional activity of Dep artment of R47S, Bldg. AP9A, 100 Abbott Park Road, Abbott Park, IL 60064, U.S.A. Tel: +1 847 935 4733, Fax: +1 847 938 both MyoD and MEF2. In other work, Sun et al. (18) have 2365, e-mail: [email protected] demonstrated that Akt associaties with prohibitin-2 but in this case, prohibitin-2 does not seem to be a target for Akt Key Words: Akt, prohibitin, transformation. phosphorylation. 0250-7005/2008 $2.00+.40 957 ANTICANCER RESEARCH 28 : 957-964 (2008) In the present study, we examined the role of each Akt Proliferation assay. Cell proliferation assays were performed in family member by ectopic overexpression in MiaPaCa-2 96-well microtiter plates using the colorimetric method. To 3 pancreatic cancer cells. Akt overexpressing clones were measure cell proliferation, 5x10 cells were plated in the presence of different concentrations of serum. The cells were examined in cell proliferation and soft-agar assays. cultured for 72 h, after which time, cell culture medium was removed and 100 μl of 10% Alamar Blue reagent (Biosource Materials and Methods International, Camarillo, CA, USA) was added. After 2 h, plates were read at excitation of 544 nm/emission at 590 nm on F-Max Cell culture, isolation of AKT clones and in vitro kinase assay. fluorescent plate reader (Molecular Devices, Sunnyvale, CA, MiaPaCa-2 pancreatic cells were obtained from the ATCC USA). All values are representative of 2 to 3 independent (Rockville, MD, USA) and maintained in Dulbecco’s modified experiments. Eagle’s medium with 10% fetal bovine serum and 5% C O2 at 37˚C. pCIneo-LCK-HA-AKT1, AKT2 and AKT3 constructs were Soft-agar assay. provided by IDUN Pharmaceuticals (San Diego, CA, USA). These The soft agar assay was performed as described constructs were also used in 3T3 cells as described elsewhere (8). elsewhere (5). For the bottom layer of agar, 1 ml of 0.5% agar Recombinant Akt protein was purified as described (9). In vitro containing medium and different concentrations of serum was kinase assays were performed as described (9). MiaPaCa-2 cells added to each 35 mm-diameter well of six-well plates. The bottom agar was solidified (~30 min) in the hood. For the top were transfected with the above constructs using the 4 Lipofectamine Reagent according to the manufacturer’s agar, 2 ml of 0.35% top agar containing 1x10 cells and medium instructions (Invitrogen, Carlsbad, CA, USA). Following with serum (final 2%) was layered on top of the solidified bottom transfection, cells were selected with 1 mg/ml G418 and the AKT agar and after setting, the plates were incubated at 37 ˚C for 10 expressing clones were isolated and expanded. 293T Cells (ATCC) days. Colonies were stained with P-iodonitrotetrazolium violet were used for expression of exogenous prohibitin during and the number of stained colonies (>200 μm) were scored using cotransfection experiments with pAKT. an image analysis program (Image-Pro Plus; Media Cybernetics, Silver Springs, MD, USA). Construction of prohibitin plasmids. Full-length cDNA for Two -dimensional gel analysis. prohibitin was obtained from Research Genetics (Huntsville, AL, Two-dimensional gel electro- USA) as Image clone 42313. The following primers were used to phoresis was performed according to the method of O’Farrell by generate a BamHI, EcoRI pcr fragment to subclone the gene into Kendrick Labs, Inc. (Madison, WI, USA) as follows: Isoelectric plasmid pcDNA 3.1, adding an N-terminal HA tag and C-terminal focusing (IEF) was carried out in glass tubes of inner diameter 6-His tag to the construct: 5’gtgtggatccatgtatccttacgacgtgc 2.0 mm using 2% pH 4-8 ampholines (BDH from Hoefer ctgactacgccgctgc caaagtgtttgagtcc-3’ and 5’-gtgtgaattcagtgatgatg atg Scientific Instruments, San Francisco, CA, USA) for 9600 Vh. atggtgctggggcagctggaggagc-3’. Threonine 238 was mutagenized to One microgram of an IEF internal standard, tropomyosin, was alanine using the Quick Change Mutagenesis Kit (Stratagene, La added to each sample. This protein migrates as a doublet with Jolla, CA, USA) with the following primers: 5’-gctctcgga lower polypeptide spot of MW 33,000 and s pI of 5.2. The acatcgcctacctgccagcg-3’ and 5’-cgctggcaggtaggcgatgt tccg ag agc3’. enclosed tube gel pH gradient plot for this set of ampholines was determined with a surface pH electrode. After equilibration Protein extraction and Western blot analysis. Cells were scraped for 10 min in Buffer ‘O’ (10% glycerol, 50 mM dithiothreitol, into cold phosphate-buffered saline, pelleted, and then resuspended 2.3% sodium dodecyl sulfate and 0.0625 M Tris, pH 6.8) the in 100-200 μl ice-cold insect cell lysis buffer supplememented with tube gels were sealed to the top of stacking gels on top of 10% protease inhibitors (BD Biosciences Pharmingen, San Diego, CA, acrylamide slab gels (0.75 mm thick) and SDS slab gel USA). Cells were lysed by sonication and the debris cleared in a electrophoresis carried out for about 4 h at 12.5 mA/gel. The microcentrifuge. A total of 40 μg of lysate were loaded into each following proteins (Sigma Chemicals Co., St. Louis, MO, USA) well of 6% or 10% Tris-glycine polyacrylamide minigels were added as MW standards to a well in the agarose, which (Invitrogen) for SDS-PAGE analysis. Proteins were transferred to sealed the tube gel to the slab gel: myosin (220,000), PVDF membranes (Invitrogen), blocked for 1 h in TBS-T plus 5% phosphorylase A (94,000), catalase (60,000), actin (43,000) (w/v) powdered blotting grade milk (Bio-Rad Laboratories, carbonic anhydrase (29,000) and lysozyme (14,000). These Hercules, CA, USA), and then probed overnight at 40˚C with standards appear as horizontal lines on the Coomassie Brilliant primary antibodies at a 1:2000 dilution in blocking solution.