DOCSLIB.ORG

B-Deficient Mouse Reveals a Hierarchy of ANP32 Importance In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
B-Deficient Mouse Reveals a Hierarchy of ANP32 Importance In Acidic nuclear phosphoprotein 32kDa (ANP32)B-deficient mouse reveals a hierarchy of ANP32 importance in mammalian development Patrick T. Reillya, Samia Afzalb,c, Chiara Gorrinib, Koren Luib, Yury V. Bukhmanb,1, Andrew Wakehamb, Jillian Haightb, Teo Wei Linga, Carol C. Cheungb, Andrew J. Eliab, Patricia V. Turnerd, and Tak Wah Maka,b,2 aDivision of Cellular and Molecular Research, National Cancer Centre Singapore, Singapore 169610; bCampbell Family Cancer Research Institute, University Health Network, Toronto, ON, Canada M5G 2C1; cGraduate Program in Immunology, University of Toronto, Toronto, ON, Canada M5S 1A8; and dDepartment of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, ON, Canada N1G 2W1 Contributed by Tak Wah Mak, April 20, 2011 (sent for review February 18, 2011) The highly conserved ANP32 proteins are proposed to function in these studies has specifically excluded a particular ANP32 protein a broad array of physiological activities through molecular mech- as contributing to the activities examined. anisms as diverse as phosphatase inhibition, chromatin regulation, More recent work has demonstrated functions that are ex- caspase activation, and intracellular transport. On the basis of clusive to the ANP32B protein, at least in humans. First, previous analyses of mice bearing targeted mutations of Anp32a ANP32B, but not ANP32A, controls the expression of the den- or Anp32e, there has been speculation that all ANP32 proteins play dritic cell maturation factor CD83 by regulating the transport of redundant roles and are dispensable for normal development. its mRNA to the cytoplasm (22). Second, ANP32B modulates However, more recent work has suggested that ANP32B may in the activity of the transcription factor Kruppel-like factor 5 fact have functions that are not shared by other ANP32 family (KLF5), whereas ANP32A cannot (32). Finally, ANP32B is a members. Here we report that ANP32B expression is associated caspase substrate, whereas ANP32A is not (33). with a poor prognosis in human breast cancer, consistent with Reported loss-of-function mutants for ANP32 family members Anp32b include two independently targeted ANP32A-deficient mice (34, the increased levels of mRNA present in proliferating fi wild-type (WT) murine embryonic fibroblasts and stimulated WT 35), an ANP32E-de cient mouse (35), and a presumptive null mutant of mapmodulin in Drosophila (36). All of these mutants B and T lymphocytes. Moreover, we show that, contrary to pre- Anp32b were viable and fertile with no obvious abnormalities. Here, we vious assumptions, is very important for murine embryo- fi −/− fi report on the phenotype of Anp32b-de cient (Anp32b ) mice genesis. In a mixed genetic background, ANP32B-de cient mice and, using compound mutants, show that ANP32 family members displayed a partially penetrant perinatal lethality that became are not completely redundant in mammals. We demonstrate that fully penetrant in a pure C57BL/6 background. Surviving ANP32B- fi ANP32B is the most important ANP32 family member for mam- de cient mice showed reduced viability due to variable defects malian development and likely plays a complex role in sustaining in various organ systems. Study of compound mutants lacking viability that has yet to be completely defined. In addition, we ANP32A, ANP32B, and/or ANP32E revealed previously hidden roles provide evidence that the level of ANP32B mRNA expression in for ANP32A in mouse development that became apparent only in human breast cancers may serve as a prognostic marker. the complete absence of ANP32B. Our data demonstrate a hierarchy of importance for the mammalian Anp32 genes, with Anp32b be- Results ing the most critical for normal development. ANP32B as a Potential Prognostic Marker in Human Cancer. Reports that ANP32B expression was related to cell proliferation (15, 17) cell growth | mouse embryogenesis | premature aging prompted us to investigate whether ANP32B expression was al- tered in human tumor samples. We examined the relationship NP32B (a.k.a. APRIL, PAL31, PHAP1b) is a mamma- between ANP32B mRNA expression and breast cancer patient Alian member of the highly conserved acidic nuclear phos- prognosis using information from three available studies, namely phoprotein 32kDa (ANP32) family of gene products (1). These the NEJM (New England Medical Journal) (37), the BMC (BMC metazoan-specific factors are characterized by the presence of Genomics) (38), and the PNAS datasets (39). When we com- an amino-terminal leucine-rich repeat domain and a carboxyl- pared the survival of these three groups of patients among all terminal region that is highly enriched in acidic amino acid three datasets, we found that patients whose tumors showed the fi highest ANP32B mRNA levels had signi cantly shorter survival GENETICS residues (2). These features are found in ANP32 proteins from − times using the Cox proportional hazard model (P < 10 4). To mapmodulin, the single representative in Drosophila, and in the fi three vertebrate family members identified ANP32A, ANP32B, display this effect, we strati ed the patients in these datasets into three major groups: those with tumors expressing high levels of and ANP32E (1, 3). ANP32B mRNA (highest 33.3% or tertile), those with tumors The ANP32 proteins have been implicated in a broad array of with medium ANP32B mRNA levels (middle tertile), and those physiological processes, including cell differentiation (4–7), apo- with tumors with low ANP32B mRNA levels (lowest tertile). ptotic cell death (8–14), and cell proliferation (15–17). Diverse mechanisms have been postulated for how these proteins perform their function(s). Some studies indicate that ANP32 proteins may Author contributions: P.T.R. and T.W.M. designed research; P.T.R., S.A., C.G., K.L., A.W., directly control enzymatic activities, such as via inhibition of J.H., T.W.L., C.C.C., and A.J.E. performed research; P.T.R., S.A., C.G., Y.V.B., P.V.T., and protein phosphatase 2A (PP2A) (18–20) or activation of caspases T.W.M. analyzed data; and P.T.R. and T.W.M. wrote the paper. (10, 11, 13, 14, 21). Other studies suggest that they may regulate The authors declare no conflict of interest. – intracellular transport at nuclear pores or microtubules (22 25). Freely available online through the PNAS open access option. Several studies present evidence that nuclear ANP32 proteins 1Present address: Great Lakes Bioenergy Research Center, University of Wisconsin, Mad- may influence transcription either through the inhibitor of acetyl ison, WI 53706. transferases complex (26–29) or by direct effects on transcription 2To whom correspondence should be addressed. E-mail: [email protected]. factors (30, 31). Most of the above reports have focused on This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. ANP32A, the founding member of the ANP32 family, but none of 1073/pnas.1106211108/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1106211108 PNAS | June 21, 2011 | vol. 108 | no. 25 | 10243–10248 Downloaded by guest on October 2, 2021 Fig. 2. Elevated Anp32b mRNA expression correlates with increased cell pro- liferation. (A) Correlation with highly proliferative tissues. A commercial mouse tissue blot was examined by Northern blotting to detect Anp32b mRNA. Gapdh: Fig. 1. ANP32B mRNA expression is a marker for aggressive breast cancer. relative expression control. Anp32b mRNA is decreased relative to Gapdh in brain Survival analyses of patients with tumors expressing the highest levels of and muscle. (B) Correlation with nutrient-induced proliferation. WT MEFs were ANP32B mRNA (highest tertile: dashed line), and patients with tumors deprived of serum for 72 h and then resupplied with medium containing 10% expressing the lowest levels of ANP32B mRNA (lowest tertile: solid line). The FBS for 24 h. Anp32b mRNA levels were determined by qPCR relative to β-actin. middle tertile is not shown. Values were acquired from three separate Data shown are the mean ± SD of two independent WT MEF cultures. **P < 0.01. datasets: NEMJ (37), PNAS (39), and BMC (38). (C) Correlation with lymphocyte stimulation. (Left)Purified B cells from WT mice were treated with 1 μg/mL LPS for 24 h. (Right)PurifiedTcellsfromWTmicewere stimulated with plate-bound anti-CD3 (2 μg/mL) plus anti-CD28 (0.2 μg/mL) for Here, the survival effect of the highest and lowest ANP32B- 36 h. In both cases, Anp32b mRNA levels were determined by qPCR relative to expressing tumors is clearly demonstrated (Fig. 1; middle tertile 18S rRNA. Results shown are the mean ± SD of triplicates and are expressed as not shown). These results imply that elevated ANP32B expres- fold increase over levels in untreated controls. Results are representative of sion in a tumor may be a marker of poor patient prognosis. two trials. **P < 0.01. Anp32b mRNA Levels Are Linked to Cell Proliferation in Mice. The less favorable prognosis of breast cancer patients with high mRNA levels (Fig. 2C). These results indicate that Anp32b is up- ANP32B-expressing tumors suggested that the elevated ANP32B regulated under conditions that favor cell proliferation. inthesesamplesmightbelinkedtomoreaggressivetumor Anp32b cell proliferation. To investigate this hypothesis, we performed Gene Targeting of in Mice. To investigate the physiological Northern blot analysis of a wide range of tissues from adult wild- functions of ANP32B in vivo, we generated mice in which the type (WT) mice. We found that Anp32b expression was low Anp32b gene was disrupted by replacing the genomic region (relative to Gapdh) in tissues where less cell proliferation usually containing exons 2, 3, and 4 with a pgk-neo expression cassette occurs, i.e., in brain tissue (Fig. 2A). In contrast, tissues that (Fig. 3A). This mutation results in an mRNA in which the last 17 generally have high cell proliferation rates, i.e., spleen and thy- codons of exon 1 are linked to an out-of-frame exon 5. Southern mus, showed higher relative levels of Anp32b mRNA expression.
Load more

Recommended publications
  • A. Cellular Senescence
    Generation of antisense RNAs at convergent gene loci in cells undergoing senescence Maharshi Krishna Deb To cite this version: Maharshi Krishna Deb. Generation of antisense RNAs at convergent gene loci in cells undergo- ing senescence. Human genetics. Université Paul Sabatier - Toulouse III, 2016. English. NNT : 2016TOU30274. tel-03209213 HAL Id: tel-03209213 https://tel.archives-ouvertes.fr/tel-03209213 Submitted on 27 Apr 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 5)µ4& &OWVFEFMPCUFOUJPOEV %0$503"5%&-6/*7&34*5²%&506-064& %ÏMJWSÏQBS Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier) 1SÏTFOUÏFFUTPVUFOVFQBS DEB Maharshi Krishna -F mercredi 30 mars 2016 5Jtre : Generation of antisense RNAs at convergent gene loci in cells undergoing senescence École doctorale et discipline ou spécialité : ED BSB : Génétique moléculaire 6OJUÏEFSFDIFSDIF CNRS-UMR5088; LBCMCP %JSFDUFVS T EFʾÒTF Dr. TROUCHE Didier Co-Directeur/trice(s) de Thèse : Dr. NICOLAS Estelle 3BQQPSUFVST Prof. GILSON Eric, Dr. LIBRI Domenico, Dr. VERDEL Andre "VUSF T NFNCSF T EVKVSZ Prof. GLEIZES Pierre Emmanuel, President of Jury Dr. TROUCHE Didier, Thesis Supervisor This thesis is dedicated to any patients who may get cured with treatments manifesting from this work.
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche).
    [Show full text]
  • Identification of Differentially Methylated Cpg
    biomedicines Article Identification of Differentially Methylated CpG Sites in Fibroblasts from Keloid Scars Mansour A. Alghamdi 1,2 , Hilary J. Wallace 3,4 , Phillip E. Melton 5,6 , Eric K. Moses 5,6, Andrew Stevenson 4 , Laith N. Al-Eitan 7,8 , Suzanne Rea 9, Janine M. Duke 4, 10 11 4,9,12 4, , Patricia L. Danielsen , Cecilia M. Prêle , Fiona M. Wood and Mark W. Fear * y 1 Department of Anatomy, College of Medicine, King Khalid University, Abha 61421, Saudi Arabia; [email protected] 2 Genomics and Personalized Medicine Unit, College of Medicine, King Khalid University, Abha 61421, Saudi Arabia 3 School of Medicine, The University of Notre Dame Australia, Fremantle 6959, Australia; [email protected] 4 Burn Injury Research Unit, School of Biomedical Sciences, Faculty of Health and Medical Sciences, The University of Western Australia, Perth 6009, Australia; andrew@fionawoodfoundation.com (A.S.); [email protected] (J.M.D.); fi[email protected] (F.M.W.) 5 Centre for Genetic Origins of Health and Disease, Faculty of Health and Medical Sciences, The University of Western Australia, Perth 6009, Australia; [email protected] (P.E.M.); [email protected] (E.K.M.) 6 School of Pharmacy and Biomedical Sciences, Faculty of Health Science, Curtin University, Perth 6102, Australia 7 Department of Applied Biological Sciences, Jordan University of Science and Technology, Irbid 22110, Jordan; [email protected] 8 Department of Biotechnology and Genetic Engineering, Jordan University of Science and Technology, Irbid 22110,
    [Show full text]
  • ANP32B Deficiency Impairs Proliferation and Suppresses Tumor Progression by Regulating AKT Phosphorylation
    Citation: Cell Death and Disease (2016) 7, e2082; doi:10.1038/cddis.2016.8 OPEN & 2016 Macmillan Publishers Limited All rights reserved 2041-4889/16 www.nature.com/cddis ANP32B deficiency impairs proliferation and suppresses tumor progression by regulating AKT phosphorylation S Yang1,6, L Zhou2,6, PT Reilly3, S-M Shen1,PHe1, X-N Zhu1, C-X Li1, L-S Wang4, TW Mak5, G-Q Chen*,1 and Y Yu*,1 The acidic leucine-rich nuclear phosphoprotein 32B (ANP32B) is reported to impact normal development, with Anp32b-knockout mice exhibiting smaller size and premature aging. However, its cellular and molecular mechanisms, especially its potential roles in tumorigenesis, remain largely unclear. Here, we utilize 'knockout' models, RNAi silencing and clinical cohorts to more closely investigate the role of this enigmatic factor in cell proliferation and cancer phenotypes. We report that, compared with Anp32b wild- type (Anp32b+/+) littermates, a broad panel of tissues in Anp32b-deficient (Anp32b− / −) mice are demonstrated hypoplasia. Anp32b− / − mouse embryo fibroblast cell has a slower proliferation, even after oncogenic immortalization. ANP32B knockdown also significantly inhibits in vitro and in vivo growth of cancer cells by inducing G1 arrest. In line with this, ANP32B protein has higher expression in malignant tissues than adjacent normal tissues from a cohort of breast cancer patients, and its expression level positively correlates with their histopathological grades. Moreover, ANP32B deficiency downregulates AKT phosphorylation, which involves its regulating effect on cell growth. Collectively, our findings suggest that ANP32B is an oncogene and a potential therapeutic target for breast cancer treatment. Cell Death and Disease (2016) 7, e2082; doi:10.1038/cddis.2016.8; published online 4 February 2016 The acidic leucine-rich nuclear phosphoprotein 32 kDa lethality and reduced body weight,22–25 indicating a greater (ANP32) protein family are characterized by a N-terminal importance of Anp32b in normal development.
    [Show full text]
  • Downloaded 18 July 2014 with a 1% False Discovery Rate (FDR)
    UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer Permalink https://escholarship.org/uc/item/0t47b9ws Author Spiciarich, David Publication Date 2017 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Chemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Professor Matthew B. Francis Professor Amy E. Herr Fall 2017 Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer © 2017 by David Spiciarich Abstract Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich Doctor of Philosophy in Chemistry University of California, Berkeley Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Changes in glycosylation have long been appreciated to be part of the cancer phenotype; sialylated glycans are found at elevated levels on many types of cancer and have been implicated in disease progression. However, the specific glycoproteins that contribute to cell surface sialylation are not well characterized, specifically in bona fide human cancer. Metabolic and bioorthogonal labeling methods have previously enabled enrichment and identification of sialoglycoproteins from cultured cells and model organisms. The goal of this work was to develop technologies that can be used for detecting changes in glycoproteins in clinical models of human cancer.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name acidic (leucine-rich) nuclear phosphoprotein 32 family, member E Gene Symbol Anp32e Organism Mouse Gene Summary Description Not Available Gene Aliases 2810018A15Rik, AI047746, AI326868, CPD1, LANP-L, LANPL, mLANP-L RefSeq Accession No. NC_000069.6, NT_039240.8 UniGene ID Mm.218657 Ensembl Gene ID ENSMUSG00000015749 Entrez Gene ID 66471 Assay Information Unique Assay ID qMmuCIP0034318 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000165307, ENSMUST00000015893, ENSMUST00000168106, ENSMUST00000170125 Amplicon Context Sequence GGGGAAAGGAGGAGGACATGGAGATGAAGAAGAAGATTAACATGGAGTTGAAG AACAGAGCCCCGGAGGAGGTGACAGAGTTAGTCCTCGATAATTGCTTGTGTGTC AATGGGGAAATCGAAGGCCTGAA Amplicon Length (bp) 100 Chromosome Location 3:95929580-95933967 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9995 cDNA Cq 18.9 cDNA Tm (Celsius) 81 gDNA Cq 42.75 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Anp32e, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • Species Specific Differences in Use of ANP32 Proteins by Influenza a Virus
    Edinburgh Research Explorer Species specific differences in use of ANP32 proteins by influenza A virus Citation for published version: Long, JS, Idoko-Akoh, A, Mistry, B, Goldhill, DH, Staller , E, Schreyer, J, Ross, C, Goodbourn, S, Shelton, H, Skinner, MA, Sang, H, McGrew, M & Barclay, WS 2019, 'Species specific differences in use of ANP32 proteins by influenza A virus', eLIFE, vol. N/A, 2019;8:e45066. https://doi.org/10.7554/eLife.45066 Digital Object Identifier (DOI): 10.7554/eLife.45066 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: eLIFE Publisher Rights Statement: This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 11. Oct. 2021
    [Show full text]
  • Genetic Analysis of Multiple Myeloma Identifies Cytogenetic Alterations
    cancers Article Genetic Analysis of Multiple Myeloma Identifies Cytogenetic Alterations Implicated in Disease Complexity and Progression Can Li 1,2,†, Erik B. Wendlandt 3,†, Benjamin Darbro 4, Hongwei Xu 1, Gregory S. Thomas 3, Guido Tricot 1, Fangping Chen 2 , John D. Shaughnessy Jr. 1 and Fenghuang Zhan 1,* 1 Myeloma Center, Department of Internal Medicine, Winthrop P. Rockefeller Cancer Institute, University of Arkansas for Medical Sciences, Little Rock, AR 72205, USA; [email protected] (C.L.); [email protected] (H.X.); [email protected] (G.T.); [email protected] (J.D.S.J.) 2 Department of Hematology, Xiangya Hospital, Central South University, Changsha 410008, China; [email protected] 3 Department of Internal Medicine, University of Iowa, Iowa City, IA 52242, USA; [email protected] (E.B.W.); [email protected] (G.S.T.) 4 Cytogenetics and Molecular Laboratory, Carver College of Medicine, University of Iowa, Iowa City, IA 52242, USA; [email protected] * Correspondence: [email protected] † These authors contributed equally to this work. Simple Summary: Multiple myeloma (MM) is the second most common hematological neoplasia with a high incidence in elderly populations. The disease is characterized by a severe chaos of genomic abnormality. Comprehensive examinations of myeloma cytogenetics are needed for better understanding of MM and potential application to the development of novel therapeutic regiments. Here we utilized gene expression profiling and CytoScan HD genomic arrays to investigate molecular Citation: Li, C.; Wendlandt, E.B.; alterations in myeloma leading to disease progression and poor clinical outcomes. We demonstrates Darbro, B.; Xu, H.; Thomas, G.S.; that genetic abnormalities within MM patients exhibit unique protein network signatures that can be Tricot, G.; Chen, F.; Shaughnessy, J.D., exploited for implementation of existing therapies targeting key pathways and the development of Jr.; Zhan, F.
    [Show full text]
  • The Genetic Program of Pancreatic Beta-Cell Replication in Vivo
    Page 1 of 65 Diabetes The genetic program of pancreatic beta-cell replication in vivo Agnes Klochendler1, Inbal Caspi2, Noa Corem1, Maya Moran3, Oriel Friedlich1, Sharona Elgavish4, Yuval Nevo4, Aharon Helman1, Benjamin Glaser5, Amir Eden3, Shalev Itzkovitz2, Yuval Dor1,* 1Department of Developmental Biology and Cancer Research, The Institute for Medical Research Israel-Canada, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel 2Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel. 3Department of Cell and Developmental Biology, The Silberman Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel 4Info-CORE, Bioinformatics Unit of the I-CORE Computation Center, The Hebrew University and Hadassah, The Institute for Medical Research Israel- Canada, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel 5Endocrinology and Metabolism Service, Department of Internal Medicine, Hadassah-Hebrew University Medical Center, Jerusalem 91120, Israel *Correspondence: [email protected] Running title: The genetic program of pancreatic β-cell replication 1 Diabetes Publish Ahead of Print, published online March 18, 2016 Diabetes Page 2 of 65 Abstract The molecular program underlying infrequent replication of pancreatic beta- cells remains largely inaccessible. Using transgenic mice expressing GFP in cycling cells we sorted live, replicating beta-cells and determined their transcriptome. Replicating beta-cells upregulate hundreds of proliferation- related genes, along with many novel putative cell cycle components. Strikingly, genes involved in beta-cell functions, namely glucose sensing and insulin secretion were repressed. Further studies using single molecule RNA in situ hybridization revealed that in fact, replicating beta-cells double the amount of RNA for most genes, but this upregulation excludes genes involved in beta-cell function.
    [Show full text]
  • Genome-Wide Chromatin Accessibility Is Restricted by ANP32E
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.08.288241; this version posted September 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Genome-wide Chromatin Accessibility is Restricted by ANP32E Kristin E. Murphy+, Fanju W. Meng+, Claire E. Makowski, Patrick J. Murphy* Department of Biomedical Genetics, Wilmot Cancer Institute, University of Rochester Medical Center, Rochester NY, USA. + denotes equal contribution * Corresponding author: [email protected] ABSTRACT Genome-wide chromatin state underlies gene expression potential and cellular function. Epigenetic features and nucleosome positioning contribute to the accessibility of DNA, but widespread regulators of chromatin state are largely unknown. Our study investigates how control of genomic H2A.Z localization by ANP32E contributes to chromatin state in mouse fibroblasts. We define H2A.Z as a universal chromatin accessibility factor, and demonstrate that through antagonism of H2A.Z, ANP32E restricts genome-wide DNA access. In the absence of ANP32E, H2A.Z accumulates at promoters in a hierarchical manner. H2A.Z initially localizes downstream of the transcription start site, and if H2A.Z is already present downstream, additional H2A.Z accumulates upstream. This hierarchical H2A.Z accumulation coincides with improved nucleosome positioning, heightened transcription factor binding, and increased expression of neighboring genes. Thus, ANP32E dramatically influences genome-wide chromatin accessibility through refinement of H2A.Z patterns, providing a means to reprogram chromatin state and to hone gene expression levels.
    [Show full text]
  • Histone Variants: Dynamic Punctuation in Transcription
    Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Histone variants: dynamic punctuation in transcription Christopher M. Weber1,2 and Steven Henikoff1,3,4 1Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Molecular and Cellular Biology Program, University of Washington, Seattle, Washington 98195, USA; 3Howard Hughes Medical Institute, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA Eukaryotic gene regulation involves a balance between tinct amino acid sequences that can influence both the packaging of the genome into nucleosomes and enabling physical properties of the nucleosome and nucleosome access to regulatory proteins and RNA polymerase. dynamics. These properties are especially important Nucleosomes are integral components of gene regulation during transcription, where histone variants shape the that restrict access to both regulatory sequences and the chromatin landscape of cis-regulatory and coding regions underlying template. Whereas canonical histones pack- in support of specific transcription programs. age the newly replicated genome, they can be replaced Here we consider core variants of H2A and H3 that with histone variants that alter nucleosome structure, are implicated in transcription (Table 1). We discuss the stability, dynamics, and, ultimately, DNA accessibility. mechanisms responsible for shaping the histone variant Here we consider how histone variants and their inter- landscape, focusing on recent genome-wide mapping acting partners are involved in transcriptional regulation studies of these variants, their chaperones, RNAPII, and through the creation of unique chromatin states. nucleosome dynamics. We review how these chromatin landscapes and deposition pathways influence the dynamic interplay between nucleosome occupancy, regulatory The basic unit of chromatin is the nucleosome, consist- DNA-binding proteins, and, ultimately, RNAPII elongation ing of DNA wrapped around a core of histone proteins.
    [Show full text]
  • SMYD3-Mediated H2A.Z.1 Methylation Promotes Cell Cycle and Cancer
    Author Manuscript Published OnlineFirst on August 28, 2016; DOI: 10.1158/0008-5472.CAN-16-0500 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. SMYD3-Mediated H2A.Z.1 Methylation Promotes Cell Cycle and Cancer Proliferation Cheng-Hui Tsai1,a, Yun-Ju Chen1,a, Chia-Jung Yu2,7, Shiou-Ru Tzeng3, I-Chen Wu3, Wen-Hung Kuo4, Ming-Chieh Lin5, Nei-Li Chan3, Kou-Juey Wu6, and Shu-Chun Teng1,b 1Department of Microbiology, College of Medicine, National Taiwan University, Taipei 100, Taiwan 2Department of Cell and Molecular Biology, Chang Gung University, Tao-Yuan 333, Taiwan 3Institute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, Taipei 100, Taiwan 4Department of Surgery, National Taiwan University Hospital, College of Medicine, National Taiwan University, Taipei 100, Taiwan 5Department of Pathology, National Taiwan University Hospital, College of Medicine, National Taiwan University, Taipei 100, Taiwan 6Research Center for Tumor Medical Science, Graduate Institute of Cancer Biology, China Medical University, Taichung 404, Taiwan 7Department of Thoracic Medicine, Chang Gung Memorial Hospital, Linkou, Tao-Yuan 333, Taiwan aThese authors contributed equally to this work. bAddress correspondence to: Department of Microbiology, College of Medicine, National Taiwan University, No. 1, Sec. 1, Jen-Ai Road, Taipei 100, Taiwan 1 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2016 American Association for Cancer Research. Author Manuscript Published OnlineFirst on August 28, 2016; DOI: 10.1158/0008-5472.CAN-16-0500 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Phone: (886) 2-23123456 ext.
    [Show full text]