Genetic Analysis of Multiple Myeloma Identifies Cytogenetic Alterations
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia. -
A. Cellular Senescence
Generation of antisense RNAs at convergent gene loci in cells undergoing senescence Maharshi Krishna Deb To cite this version: Maharshi Krishna Deb. Generation of antisense RNAs at convergent gene loci in cells undergo- ing senescence. Human genetics. Université Paul Sabatier - Toulouse III, 2016. English. NNT : 2016TOU30274. tel-03209213 HAL Id: tel-03209213 https://tel.archives-ouvertes.fr/tel-03209213 Submitted on 27 Apr 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 5)µ4& &OWVFEFMPCUFOUJPOEV %0$503"5%&-6/*7&34*5²%&506-064& %ÏMJWSÏQBS Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier) 1SÏTFOUÏFFUTPVUFOVFQBS DEB Maharshi Krishna -F mercredi 30 mars 2016 5Jtre : Generation of antisense RNAs at convergent gene loci in cells undergoing senescence École doctorale et discipline ou spécialité : ED BSB : Génétique moléculaire 6OJUÏEFSFDIFSDIF CNRS-UMR5088; LBCMCP %JSFDUFVS T EFʾÒTF Dr. TROUCHE Didier Co-Directeur/trice(s) de Thèse : Dr. NICOLAS Estelle 3BQQPSUFVST Prof. GILSON Eric, Dr. LIBRI Domenico, Dr. VERDEL Andre "VUSF T NFNCSF T EVKVSZ Prof. GLEIZES Pierre Emmanuel, President of Jury Dr. TROUCHE Didier, Thesis Supervisor This thesis is dedicated to any patients who may get cured with treatments manifesting from this work. -
Supplementary Data
SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche). -
Identification of Differentially Methylated Cpg
biomedicines Article Identification of Differentially Methylated CpG Sites in Fibroblasts from Keloid Scars Mansour A. Alghamdi 1,2 , Hilary J. Wallace 3,4 , Phillip E. Melton 5,6 , Eric K. Moses 5,6, Andrew Stevenson 4 , Laith N. Al-Eitan 7,8 , Suzanne Rea 9, Janine M. Duke 4, 10 11 4,9,12 4, , Patricia L. Danielsen , Cecilia M. Prêle , Fiona M. Wood and Mark W. Fear * y 1 Department of Anatomy, College of Medicine, King Khalid University, Abha 61421, Saudi Arabia; [email protected] 2 Genomics and Personalized Medicine Unit, College of Medicine, King Khalid University, Abha 61421, Saudi Arabia 3 School of Medicine, The University of Notre Dame Australia, Fremantle 6959, Australia; [email protected] 4 Burn Injury Research Unit, School of Biomedical Sciences, Faculty of Health and Medical Sciences, The University of Western Australia, Perth 6009, Australia; andrew@fionawoodfoundation.com (A.S.); [email protected] (J.M.D.); fi[email protected] (F.M.W.) 5 Centre for Genetic Origins of Health and Disease, Faculty of Health and Medical Sciences, The University of Western Australia, Perth 6009, Australia; [email protected] (P.E.M.); [email protected] (E.K.M.) 6 School of Pharmacy and Biomedical Sciences, Faculty of Health Science, Curtin University, Perth 6102, Australia 7 Department of Applied Biological Sciences, Jordan University of Science and Technology, Irbid 22110, Jordan; [email protected] 8 Department of Biotechnology and Genetic Engineering, Jordan University of Science and Technology, Irbid 22110, -
DTL/CDT2 Is Essential for Both CDT1 Regulation and the Early G2/M Checkpoint
Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press DTL/CDT2 is essential for both CDT1 regulation and the early G2/M checkpoint Christopher L. Sansam, Jennifer L. Shepard, Kevin Lai, Alessandra Ianari, Paul S. Danielian, Adam Amsterdam, Nancy Hopkins, and Jacqueline A. Lees1 Center for Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139, USA Checkpoint genes maintain genomic stability by arresting cells after DNA damage. Many of these genes also control cell cycle events in unperturbed cells. By conducting a screen for checkpoint genes in zebrafish, we found that dtl/cdt2 is an essential component of the early, radiation-induced G2/M checkpoint. We subsequently found that dtl/cdt2 is required for normal cell cycle control, primarily to prevent rereplication. Both the checkpoint and replication roles are conserved in human DTL. Our data indicate that the rereplication reflects a requirement for DTL in regulating CDT1, a protein required for prereplication complex formation. CDT1 is degraded in S phase to prevent rereplication, and following DNA damage to prevent origin firing. We show that DTL associates with the CUL4–DDB1 E3 ubiquitin ligase and is required for CDT1 down-regulation in unperturbed cells and following DNA damage. The cell cycle defects of Dtl-deficient zebrafish are suppressed by reducing Cdt1 levels. In contrast, the early G2/M checkpoint defect appears to be Cdt1-independent. Thus, DTL promotes genomic stability through two distinct mechanisms. First, it is an essential component of the CUL4–DDB1 complex that controls CDT1 levels, thereby preventing rereplication. Second, it is required for the early G2/M checkpoint. -
ANP32B Deficiency Impairs Proliferation and Suppresses Tumor Progression by Regulating AKT Phosphorylation
Citation: Cell Death and Disease (2016) 7, e2082; doi:10.1038/cddis.2016.8 OPEN & 2016 Macmillan Publishers Limited All rights reserved 2041-4889/16 www.nature.com/cddis ANP32B deficiency impairs proliferation and suppresses tumor progression by regulating AKT phosphorylation S Yang1,6, L Zhou2,6, PT Reilly3, S-M Shen1,PHe1, X-N Zhu1, C-X Li1, L-S Wang4, TW Mak5, G-Q Chen*,1 and Y Yu*,1 The acidic leucine-rich nuclear phosphoprotein 32B (ANP32B) is reported to impact normal development, with Anp32b-knockout mice exhibiting smaller size and premature aging. However, its cellular and molecular mechanisms, especially its potential roles in tumorigenesis, remain largely unclear. Here, we utilize 'knockout' models, RNAi silencing and clinical cohorts to more closely investigate the role of this enigmatic factor in cell proliferation and cancer phenotypes. We report that, compared with Anp32b wild- type (Anp32b+/+) littermates, a broad panel of tissues in Anp32b-deficient (Anp32b− / −) mice are demonstrated hypoplasia. Anp32b− / − mouse embryo fibroblast cell has a slower proliferation, even after oncogenic immortalization. ANP32B knockdown also significantly inhibits in vitro and in vivo growth of cancer cells by inducing G1 arrest. In line with this, ANP32B protein has higher expression in malignant tissues than adjacent normal tissues from a cohort of breast cancer patients, and its expression level positively correlates with their histopathological grades. Moreover, ANP32B deficiency downregulates AKT phosphorylation, which involves its regulating effect on cell growth. Collectively, our findings suggest that ANP32B is an oncogene and a potential therapeutic target for breast cancer treatment. Cell Death and Disease (2016) 7, e2082; doi:10.1038/cddis.2016.8; published online 4 February 2016 The acidic leucine-rich nuclear phosphoprotein 32 kDa lethality and reduced body weight,22–25 indicating a greater (ANP32) protein family are characterized by a N-terminal importance of Anp32b in normal development. -
Anti-P21 Antibody [SPM306] (ARG56160)
Product datasheet [email protected] ARG56160 Package: 50 μg anti-p21 antibody [SPM306] Store at: -20°C Summary Product Description Mouse Monoclonal antibody [SPM306] recognizes p21 Tested Reactivity Hu Species Does Not React With Ms, Rat Tested Application IHC-P, WB Host Mouse Clonality Monoclonal Clone SPM306 Isotype IgG2a, kappa Target Name p21 Species Human Immunogen Human recombinant p21 protein. Conjugation Un-conjugated Alternate Names Melanoma differentiation-associated protein 6; WAF1; CIP1; CDKN1; CAP20; MDA-6; SDI1; CDK- interacting protein 1; P21; p21CIP1; p21; Cyclin-dependent kinase inhibitor 1 Application Instructions Application table Application Dilution IHC-P 2 - 5 µg/ml WB 1 - 2 µg/ml Application Note IHC-P: Antigen retrieval: Boil tissue sections in 10 mM Citrate buffer (pH 6.0) for 10-20 min, followed by cooling at RT for 20 min. * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Properties Form Liquid Purification Purification with Protein G. Buffer PBS, 0.05% Sodium azide and 0.1 mg/ml BSA. Preservative 0.05% Sodium azide Stabilizer 0.1 mg/ml BSA Concentration 0.2 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C or below. Storage in frost free freezers is not recommended. Avoid repeated www.arigobio.com 1/3 freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. -
The Evolution of Ancestral and Species-Specific Adaptations in Snowfinches at the Qinghai–Tibet Plateau
The evolution of ancestral and species-specific adaptations in snowfinches at the Qinghai–Tibet Plateau Yanhua Qua,1,2, Chunhai Chenb,1, Xiumin Chena,1, Yan Haoa,c,1, Huishang Shea,c, Mengxia Wanga,c, Per G. P. Ericsond, Haiyan Lina, Tianlong Caia, Gang Songa, Chenxi Jiaa, Chunyan Chena, Hailin Zhangb, Jiang Lib, Liping Liangb, Tianyu Wub, Jinyang Zhaob, Qiang Gaob, Guojie Zhange,f,g,h, Weiwei Zhaia,g, Chi Zhangb,2, Yong E. Zhanga,c,g,i,2, and Fumin Leia,c,g,2 aKey Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, 100101 Beijing, China; bBGI Genomics, BGI-Shenzhen, 518084 Shenzhen, China; cCollege of Life Science, University of Chinese Academy of Sciences, 100049 Beijing, China; dDepartment of Bioinformatics and Genetics, Swedish Museum of Natural History, SE-104 05 Stockholm, Sweden; eBGI-Shenzhen, 518083 Shenzhen, China; fState Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, 650223 Kunming, China; gCenter for Excellence in Animal Evolution and Genetics, Chinese Academy of Sciences, 650223 Kunming, China; hSection for Ecology and Evolution, Department of Biology, University of Copenhagen, DK-2100 Copenhagen, Denmark; and iChinese Institute for Brain Research, 102206 Beijing, China Edited by Nils Chr. Stenseth, University of Oslo, Oslo, Norway, and approved February 24, 2021 (received for review June 16, 2020) Species in a shared environment tend to evolve similar adapta- one of the few avian clades that have experienced an “in situ” tions under the influence of their phylogenetic context. Using radiation in extreme high-elevation environments, i.e., higher snowfinches, a monophyletic group of passerine birds (Passer- than 3,500 m above sea level (m a.s.l.) (17, 18). -
Datasheet: VPA00465 Product Details
Datasheet: VPA00465 Description: RABBIT ANTI DTL Specificity: DTL Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Rabbit polyclonal antibody purified by affinity chromatography Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 2% Sucrose Immunogen Synthetic peptide directed towards the N terminal region of human DTL External Database Links UniProt: Q9NZJ0 Related reagents Entrez Gene: 51514 DTL Related reagents Synonyms CDT2, CDW1, DCAF2, L2DTL, RAMP Page 1 of 2 Specificity Rabbit anti Human DTL antibody recognizes DTL also known as Denticleless protein homolog, DDB1 and CUL4 associated factor 2, retinoic acid-regulated nuclear matrix-associated protein or Lethal(2) denticleless protein homolog. Rabbit anti Human DTL antibody detects a band of 79 kDa. -
Downloaded 18 July 2014 with a 1% False Discovery Rate (FDR)
UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer Permalink https://escholarship.org/uc/item/0t47b9ws Author Spiciarich, David Publication Date 2017 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Chemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Professor Matthew B. Francis Professor Amy E. Herr Fall 2017 Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer © 2017 by David Spiciarich Abstract Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich Doctor of Philosophy in Chemistry University of California, Berkeley Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Changes in glycosylation have long been appreciated to be part of the cancer phenotype; sialylated glycans are found at elevated levels on many types of cancer and have been implicated in disease progression. However, the specific glycoproteins that contribute to cell surface sialylation are not well characterized, specifically in bona fide human cancer. Metabolic and bioorthogonal labeling methods have previously enabled enrichment and identification of sialoglycoproteins from cultured cells and model organisms. The goal of this work was to develop technologies that can be used for detecting changes in glycoproteins in clinical models of human cancer. -
Involvement of Elevated Expression of Multiple Cell-Cycle Regulator, DTL
Oncogene (2008) 27, 5672–5683 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE Involvement of elevated expression of multiple cell-cycle regulator, DTL/RAMP (denticleless/RA-regulated nuclear matrix associated protein), in the growth of breast cancer cells T Ueki1,2, T Nishidate1, JH Park1, ML Lin1, A Shimo1, K Hirata2, Y Nakamura1 and T Katagiri1,3 1Laboratory of Molecular Medicine, Human Genome Center, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo, Japan and 2Department of Surgery, Sapporo Medical University, Chuo-ku, Sapporo, Japan To investigate the detailed molecular mechanism of mam- Introduction mary carcinogenesis and discover novel therapeutic targets, we previously analysed gene expression profiles of breast Breast cancer is the most common cancer in women, cancers. We here report characterization of a significant role with estimated new cases of 1.15 million worldwide of DTL/RAMP (denticleless/RA-regulated nuclear matrix in 2002 (Parkin et al., 2005). Incidence rates of breast associated protein) in mammary carcinogenesis. Semiquanti- cancer are increasing in most countries, and the tative RT–PCR and northern blot analyses confirmed increasing rate is much higher in countries where its upregulation of DTL/RAMP in the majority of breast incidence was previously low (Parkin et al., 2005). Early cancer cases and all of breast cancer cell lines examined. detection with mammography as well as development Immunocytochemical and western blot analyses using anti- of molecular targeted drugs such as tamoxifen and DTL/RAMP polyclonal antibody revealed cell-cycle-depen- trastuzumab reduced the mortality rate and made the dent localization of endogenous DTL/RAMP protein in quality of life of the patients better (Bange et al., 2001; breast cancer cells; nuclear localization was observed in cells Navolanic and McCubrey, 2005). -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name acidic (leucine-rich) nuclear phosphoprotein 32 family, member E Gene Symbol Anp32e Organism Mouse Gene Summary Description Not Available Gene Aliases 2810018A15Rik, AI047746, AI326868, CPD1, LANP-L, LANPL, mLANP-L RefSeq Accession No. NC_000069.6, NT_039240.8 UniGene ID Mm.218657 Ensembl Gene ID ENSMUSG00000015749 Entrez Gene ID 66471 Assay Information Unique Assay ID qMmuCIP0034318 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000165307, ENSMUST00000015893, ENSMUST00000168106, ENSMUST00000170125 Amplicon Context Sequence GGGGAAAGGAGGAGGACATGGAGATGAAGAAGAAGATTAACATGGAGTTGAAG AACAGAGCCCCGGAGGAGGTGACAGAGTTAGTCCTCGATAATTGCTTGTGTGTC AATGGGGAAATCGAAGGCCTGAA Amplicon Length (bp) 100 Chromosome Location 3:95929580-95933967 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9995 cDNA Cq 18.9 cDNA Tm (Celsius) 81 gDNA Cq 42.75 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Anp32e, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.