Evaluation of Mid-Gut Bacteria Present in the Larva of Rice Moth

INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 03, MARCH 2020 ISSN 2277-8616 Evaluation Of Mid-Gut Bacteria Present In The Larva Of Rice Moth, Corcyra Cephalonica (Stain.) (Galleriidae: Lepidoptera) Fed On Different Grains Using 16S rDNA Sequence Based Culture Dependent Technique

Arumugam Dhanalakshmi, Ganesan Sasireka, Palaniappan Suresh, Panagal Mani, Palanisamy Chella Perumal, Kalimuthu Ayyakalai Marikannu Karthikeyan*

Abstract— Corcyra cephalonica (Stainton) (Lepidoptera: Pyralidae) is a factitious host extensively used for rearing egg parasitoids. The present study attempt to investigate mid-gut bacteria present in larva of Corcyra cephalonica (C. cephalonica). The mid-gut bacteria were collected from the C. cephalonica fed on eight different grains were identified and characterized by 16S rDNA sequence based culture dependent method. The results revealed that, 16 bacterial species where presented in mid-gut of C. cephalonica larva which are belonging to 11 bacterial genera included in three phyla namely Firmicutes, Proteobacteria and Actinobacteria. Among the three phyla Firmicutes was the most dominant phylum with a record of 7 bacterial species, followed by Proteobacteria with 5 species and Actinobacteria with 4 species. Phylum Firmicutes, was dominated by members of Class Bacilli. The genus Staphylococcus was the largest genus represented by 4 species namely Staphylococcus sp., S. saprophyticus, Staphylococcus pasteuri and Staphylococcus warneri and also the most prevalent genus which was recorded in the mid-gut of C. cephalonica fed on 4 grains. No single bacterium was found in all the mid-gut samples. This record of varied mid-gut bacterial composition could be attributed to the feeding behaviour/pattern of the larvae and further intensive large scale research like extensive sampling and deep-sequencing are needed to ascertain it.

Index Terms— Grains, C. cephalonica, mid-gut bacteria, 16S rDNA sequencing. ——————————  —————————— 1 INTRODUCTION Corcyra cephalonica (C. cephalonica) is commonly known as warehouses, retail shops and local storage areas like houses rice meal moth or rice moth which belongs to the family of and the successful establishment of this pest species is Pyralidae. It is a destructive insect and infects cereals, cereal attributed to the poor storage facilities [9]. Besides the products, oilseeds, pulses, dried fruits, nuts and spices [1-3]. destructive properties of C. cephaionica, it has some good The adult C. cephalonica is nocturnal, grey in colour and does aspects as well, as it acts as an alternate host for some egg not feed. Generally the female lays about 100-200 eggs near parasitoids which are used for biological control programmes food source. Eggs hatch after an incubation period of about 5 of different destructive pests like sugarcane borers in many days [4,5]. The larva however, constructs a feeding tube countries of the world [10-14]. It is one of the most used gallery, consisting of silken web and food particles, to stay, factitious hosts and is being utilized in various bio-control feed and grow inside it. After larval period of 23-25 days fully- research, developmental and extension units for mass grown larvae form dense white cocoons to pupate. Pupae are production of number of natural enemies in several countries usually found in food or they may be found between pellets [15,16]. Therefore present study aimed to screen the bacteria and sacks [6]. Adults emerge from pupae after pupal period of present in mid-gut of C. cephaionica larva using 16S rDNA 4-8 days and lives for about a week. One C. cephalonica sequence based culture dependent technique. alone can feed up to 32.9 mg. While feeding, it forms web on the stored grains, thus leads to the quality loss of the stored 2 MATERIALS AND METHODS products [7,8]. The infestation of this stored product pest is limited to the grains in the storage locations like godowns, 2.1 Insect sample collection The infested grains such as rice (Oryza sativa), red rice (Oryza ———————————————— punctata), groundnut (Arachis hypogaea L.), pearl millet (Pennisetum glaucum (L.)), red sorghum (Sorghum bicolour  Arumugam Dhanalakshmi and Kalimuthu Ayyakalai Marikannu L.), white sorghum (Sorghum vulgare), sesame black Karthikeyan: Department of Zoology, N.M.S.S. Vellaichamy Nadar College, Madurai-625 019, Tamil Nadu, India. (Sesamum indicum) and almond (Prunus dulcis) were  Ganesan Sasireka: Department of Zoology, Sri Meenakshi collected from the godowns of Regulated Trade Centre, Government Arts College for Women, Madurai-625 002, Tamil Nadu, Villupuram, Tamilnadu, India and white sorghum and dry nuts India. were collected from local godowns in Madurai, Tamilnadu,  Palaniappan Suresh: Department of Zoology, Thiagarajar College, India. The actively feeding sixth instar larvae of C. cephalonica Madurai-625 009, Tamil Nadu, India. were isolated from the infested grains and were used for the  Panagal Mani: Department of Biotechnology, Annai College of Arts determination of gut microbiota study. and Science, Kovilacheri-612503, Tamil Nadu, India.  Palanisamy Chella Perumal: Department of Plant Science, University of the Free State, QwaQwa Campus, South Africa. 2.2 Mid-gut dissection  *Corresponding Author: K.A.M. Karthikeyan, Email: The collected larvae of C. cephalonica were sacrificed and [email protected]; Mobile No. +91-9865578847 surface sterilized with 70% of ethanol for 5 min followed by washing in 0.85% normal saline (phosphate buffered saline 1733 IJSTR©2020 www.ijstr.org INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 03, MARCH 2020 ISSN 2277-8616

(PBS)) twice. The mid-gut was dissected out in a sterile volume with glass distilled water (Bangalore Genei, India). The condition and placed in 2ml microcentrifuge tube containing PCR reactions were conducted MJ Mini-BIO RAD Thermal 300µl of 0.85% saline (PBS) and homogenized with micro- Cycler. The PCR reaction cycles consisted of initial pestle. The 0.85% saline (PBS) after second wash in all the denaturation for 5 minutes at 94ºC, 40 cycles of 94ºC for 30 samples were collected and used as a negative control to seconds (denaturation), 55ºC for 45 seconds (annealing) and check the sterility of the procedure. Scissors, forceps, needle, 72ºC for 30 seconds (extension) and followed by the final glasswares, plasticwares, buffers and solutions/reagents used extension of 72ºC for 10 minutes. The amplicons were run in the dissection process were sterilized in autoclave and UV through 1% agarose gel electrophresis along with 100bp DNA treatment. About 10 insect specimens were used for single ladder (Bangalore Genei, India) and purified for sequencing midgut sample preparation and three replicates (positive process using the DNA elution kit (Bangalore Genei) as per controls) were maintained. manufacturer’s protocol [19].

2.3 Isolation of mid-gut bacteria 2.6 Sequencing of 16S rDNA The mid-gut homogenates were centrifuged for a brief period The amplified 16S rDNA region of the bacterial samples are of 2min. at 2,000g and the supernatant was collected. 100µl sequenced by the dideoxy chain termination method (Sanger each of the supernatant was spread on Nutrient Agar plate and et al., 1977), using the Big Dye Terminator Version 3.1” Cycle incubate at 30ºC for 48hrs. The resulting bacterial colonies Sequencing Kit in the ABI 3130 Genetic Analyzer in obtained on the spread plate were differentiated according to accordance with the manufacturer’s instructions (Polymer & their colony morphology like shape, size, colour, margin, Capillary Array: POP_7 polymer, 50cm Capillary Array; opacity, elevation etc. and morphologically distinct colonies Analysis protocol: BDTv3-KB-Denovo_v5.2; Data Analysis were selected for repeated subculture on nutrient agar plates Software: Seq Scape_v 5.2; Reaction Plate: Applied until a presumably pure colony was obtained. The pure Biosystem Micro Amp Optical 96-Well Reaction Plate) [20]. colonies were transferred to nutrient broth and incubated at 30ºC. 2.7 Sequencing of Sequence analysis of 16S rDNA for Bacterial species identification 2.4 Extraction of Genomic DNA from bacterial samples The sequence of 16S rDNA of the bacterial samples obtained 1.5 ml of overnight grown bacterial isolates maintained in were analysed for the bacterial species identification by nutrient broth were transferred to 2 ml of microcentrifuge tube carrying out NCBI-BLAST. After identification of the bacterial and centrifuged at 10,000g for 2 min and pellet was collected. species, each species have been deposited in the NCBI- The same was repeated for another 1.5 ml of culture to GenBank through BlankIt tool [21]. harvest enough quantity of cells (100 mg). The pellet was resuspended in 1.5ml of sterile distilled water and centrifuged 3 RESULTS at 10,000g for 2min. The pellet was then collected and ground As demonstrated C. cephalonica infesting different grains with 300µl of CTAB (cetyltrimethyl ammonium bromide) DNA namely rice, red sorghum, sesame black, pearl millet, red rice, extraction buffer (1% W/V CTAB; 1.4M NaCl; 10mM EDTA, pH groundnut, almond and white sorghum were sacrificed and the 8.0; 100mM Tris-HCl, pH 8.0; 0.2% V/V ß-mercaptoethanol) in mid-guts were isolated for the study of mid-gut microbiota. A a glass homogenizer. The mixture was emulsified with equal total of twenty species of bacteria were recorded in the midgut volume of phenol:chloroform (1:1). It was centrifuged at samples of C. cephalonica infesting eight different grains with 10,000rpm for 5min. at room temperature. The aqueous an average of 2.5 bacterial species per mid-gut sample (Table phase was collected and mixed with equal volume of 1). In this present study no fungal colony was recorded in chloroform:isoamyl alcohol (24:1). The mixture was then the mid-gut samples of C. cephalonica. The twenty bacterial centrifuged at 10,000g for 5min. at room temperature. The species represent 11 Genera and 16 species of bacteria (Table aqueous phase collected was then added with equal volume 2), which include Staphylococcus saprophyticus, Enterococcus of cold absolute ethanol and the DNA was allowed to gallinarum, Staphylococcus sp., Alcaligenes faecalis, precipitate by keeping the tubes in -20ºC for overnight. DNA Luteimonas sp., Oceanobacillus sp., Kocuria palustris, pellets were obtained by centrifugation at 10,000g for 5min. Brevibacterium sp., Kocuria flava, Brevundimonas sp., and the ethanol was air-dried. The pellet was dissolved in Staphylococcus pasteuri, Kytococcus sp., Staphylococcus 50µl of TE buffer (Tris 10mM, pH 8.0 and EDTA 1mM, pH 8.0) warneri, Pseudomonas sp. and Pseudomonas stutzeri belong and stored at 4ºC. The quality of the isolated genomic DNA to the phyla Firmicutes, proteobacteria and Actinobacteria. was tested by agarose gel electrophoresis [17]. The C. cephalonica fed on rice (oryza sativa) harbored maximum number of bacteria of five species namely 2.5 PCR amplification of 16S rDNA Paenibacillus sp., S. saprophyticus, E. gallinarum, The Universal Primers for the amplification of the 16S rDNA Staphylococcus sp. and A. faecalis. Three bacterial species region of approximately 1,550bp were Forward primer 27F: was found in the gut of C. cephalonica fed on pearl millet (K. 5’AGAGTTTGATCCTGGCTCAG3’ and Reverse primer 1492R: 5’ 3’ palustris, E. gallinarium and Brevibacterium sp.) and ground GGTTACCTTGTTACGACT used [18]. The primer set used nut (S. pasteuri, K. palustris and Kytococcus sp.). Two in the PCR reactions resulted in the amplification of the species of bacteria was recorded in the midgut of red sorghum homologous fragments from all the bacterial isolates. The PCR (S. saprophyticus and E. gallinarum), sesame black reaction mix was prepared in a total volume of 30ul with 10ng (Luteimonas sp. and Oceanobacillus sp.) red rice (Kocuria of genomic DNA, a 2.5mM concentration each of dATP, dTTP, flava and Brevundimonas sp.) and white sorghum dCTP and dGTP, 100ng each of the Forward primer and (Pseudomonas sp. and P. stutzeri). The most common genus Reverse primer, 3U of Taq DNA polymerase enzyme and 1X of bacteria found in the gut was Staphylococcus which had Taq DNA polymerase assay buffer (10X) and the remaining four species; and Kocuria and Pseudomonas recorded two

1734 IJSTR©2020 www.ijstr.org INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 03, MARCH 2020 ISSN 2277-8616 species of bacteria each. E. gallinarum was the bacterium TABLE 1 which was commonly found in the gut of C. cephalonica fed IDENTIFICATION OF MID-GUT BACTERIAL SPECIES with rice, red sorghum and pear millet and S. saprophyticus was found in the gut of rice and red sorghum fed C. cephalonica. The bacterial genus Pseudomonas was exclusively present in the midgut of white sorghum fed C. cephalonica. Diet dependent gut flora was clearly exhibited in the present study and no single bacterium was found in all the midgut samples of C. cephalonica fed with different grains.

4 DISCUSSION The bacteria species identified from the mid-gut larval samples of C. cephalonica fed on six different grains comprising 11 Genera and 16 species and 3 phyla (Firmicutes, proteobacteria and Actinobacteria). The most dominant species of bacteria is Staphylococcus saprophyticus which was present in the mid-gut of fed C. cephalonica. From the present study it was observed that the predominant phyla in the mid-gut of larvae of C. cephalonica was Firmicutes representing 43.75%. The gut of the insect provides suitable microbiome to many gut-associated microorganisms like bacteria, fungi and viruses, amongst which bacteria dominate in most insect groups [22]. The association between insect and bacteria are significant and the gut of insect species harbor highly diverse bacteria comprising of different Phyla, Class, Order, Family, Genus, species and strains. 16S rDNA gene, which is present in all nucleoid of bacteria have been widely used to determine the diversity of the insect gut bacterial microbiota [23]. Recently 16S rDNA sequence based identification and characterization of insect intestinal bacteria was carried out. They are having well symbiotic association which leads to the enhancement in the nutrition supply, increased physiological activities and behavioral changes in the host insect [24]. Apart from that some bacteria confers resistance of host insect species to particular pesticides and some bacteria plays antagonistic role. The insect pests of household like housefly and cockroach are very common in possessing some pathogenic bacteria in their gut environment and serves as a vector of diseases [25]. The classical way of biochemical based identification of bacterial species, which is usually mentioned as culture dependent method, is cumbersome, laborious and time consuming and needs expertise in bacterial taxonomy, in addition only cultivable bacteria can be identified. The technological advancement in the field of biotechnology made it simple, easy, rapid and uncultivable bacterial species can be identify by sequencing 16S rRNA region and subsequent blast of the query sequence in the NCBI [26]. This culture independent method need less effort in the bacterial species identification as the species is 5 CONCLUSION identified purely based on the similarity of the 16S rRNA gene In the present study, evaluated the presence of mid-gut sequences. This method of identification of bacterial species bacteria in the larva of C. cephalonica and it showed 16 at its current form enables to identify more number of bacterial bacterial species which are belonging to 11 bacterial genera species due to the pyrosequencing or Next Generation included in three phyla namely Firmicutes, Proteobacteria and Sequencing [27]. The study on the gut microbiota of the Actinobacteria. Among the three phyla Firmicutes was the economically important insect pests provide valuable most dominant phylum with a record of 7 bacterial species, information about the total gut bacterial community and any followed by Proteobacteria with 5 species and Actinobacteria economically important bacterial species which could be with 4 species. Phylum Firmicutes, was dominated by cultured and potent compounds extracted from it. members of Class Bacilli. None of the single bacterium was found in all the mid-gut samples. Together this study can conclude that, C. cephalonica could be serve as factitious hosts and might be utilized in various bio-control research, developmental and extension units for large-scale production of natural enemies. However, further studies such as,

1735 IJSTR©2020 www.ijstr.org INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 03, MARCH 2020 ISSN 2277-8616 extensive sampling and deep-sequencing are warranted to 824. determine the current findings. [9] Ray R. Life table and intrinsic rate of increase of Corcyra cephalonica (Stain.) on maize. Ent Abs. 1994; 25(10): 95. TABLE 2 [10] Seshagiri AD. Seshagiri Notes on rice moth, Corcyra LIST OF BACTERIAL SPECIES IDENTIFIED cephalonica (Stain.) (Galleriidae: Lepidoptera). Indian J Ent. 1954; 16(2): 95-114. [11] Padamshali S., Ganguli JL. Evaluation of life-cycle of rice meal moth, Corcyra cephalonica stainton larvae reared on different diets. Int J Chem Stud. 2019; 7(3): 4279-4282. [12] Jalali SK., Singh SP. Effect of infestation of sorghum grains by different dosage of Corcyra cephalonica on adult emergence pattern. Entomon. 1992; 17(1-2):117-119. [13] Kumar S., Murthy KS. Mass production of corcyra. in: training manual of the second training on mass production of biological control agents. National Centre for Integrated Pest Management, New Delhi, India, 2000, 10-20. [14] Chaudhuri N., Ghosh A., Ghosh J. Variation in biological parameters of Corcyra cephalonica Stainton (Lepidoptera: Pyralidae) with quality of rearing media. Int J Curr Res Acad. 2015; 3(4):373-380. [15] Sahayaraj K., Sathiamoorthi P. Influence of different diets of Corcyra cephalonica on life history of a reduviid predator Rhynocoris marginatus (Fab.). J Centr Eur Agric. 2002; 3:53D61. [16] Sowjanya KC., Thippaiah M., Mohan K. Gender associated

differences in developmental parameters of Corcyra ACKNOWLEDGMENT cephalonica (Stainton) (Lepidoptera: Pyralidae). Int J Curr The authors are thankful to the management of N.M.S.S. Microbiol App Sci. 2018; 7(9):2534-2539. Vellaichamy Nadar College, Madurai, Tamil Nadu, India for providing facilities and encouragement to complete this [17] Smith K., Diggle MA., Clarke SC. Comparison of commercial research work finefulfilment. DNA extraction kits for extraction of bacterial genomic DNA from whole-blood samples. J Clin Micro. 2003; 2440–2443. REFERENCES [18] Jiang H., Dong H., Zhang G., Yu B., Chapman LR., Fields MW. [1] Rasool A., Zubair R., Rasheed R., Gull S., Ahmed A. Mass Microbial diversity in water and sediment of lake chaka, an production of rice meal moth (Corcyra cephalonica) on different Athalassohaline lake in Northwestern China. App Environ food media under laboratory conditions. J Res Dev. 2018; 74- Microbiol. 2006; 72 (6): 3832–3845. 80. [19] Clarke SC. Nucleotide sequence-based typing of bacteria and [2] Chakravorty S., Das HC. Egg laying behaviour of Corcyra the impact of automation. Bioessays. 2002; 24: 858–862. cephalonica (Stain.). Rev Appl Ent. 1985; 73 (4): 222. [20] Woo PCY., Lau SKP., Teng JLL., Tse H., Yuen KY. Then and [3] Suchiung C., Wikang P., Se C., Wk P. Emergence and longevity now: use of 16S rDNA gene sequencing for bacterial of the rice moth, Corcyra cephalonica (Stain.) (Pyralidae: identification and discovery of novel bacteria in clinical Lepidoptera). Chinese J Ent. 1998; 18(2): 135-140. microbiology laboratories. Clin Microbiol Infec. 2008; 14 (10): [4] Yaui Chu., Menping T., Wenyi C. Effect of photoperiodism on the 908-934. larval development, adult emergence, and fecundity of the rice [21] Wagner K., Springer B., Pires VP., Keller PM. High-throughput moth, Corcyra cephalonica (Stain.) (Galleriidae: Lepidoptera) at screening of bacterial pathogens in clinical specimens using 16S constant temperature. Ent. Abs. 1994; 25(6): 74. rDNA qPCR and fragment analysis. Diagnos Microbiol Infec Dis. [5] Islam MN. Studies on the biology and control of rice meal moth, 2019; 93(4): 287-292. Corcyra cephalonica (Stain.) on stored wheat. M.Sc.(Ag) thesis, [22] Douglas AE. Multiorganismal insects: diversity and function of Bangladesh Agricultural University, Mymensingh. 1971; 76 pp. resident microorganisms. Annu Rev Entomol. 2015; 60: 17–34. [6] Mbata GN. Studies on some aspect of the biology of Corcyra [23] Gill EE., Brinkman FS. The proportional lack of archaeal cephalonica (Stain.). Rev. Appl. Ent. 1989; 78 (7): 793. pathogens: Do viruses/phages hold the key? BioEssays. [7] Mukhukrishnan N., Venugopal MS., Hamurougu K., Janathan R. 2011;33:248–54. Recycling of spent larval food of Corcyra cephalonica for fuel [24] Sabree ZL., Kambhampati S., Moran NA. Nitrogen recycling gas production. Rev Agril Ent. 1996; 85(12): 1418. and nutritional provisioning by Blattabacterium, the cockroach [8] Pajni HR., Rose HS., Gill KM. Some observation of the biology endosymbiont. Proc Natl Acad Sci USA. 2009; 106: 19521– of Corcyra cephalonica (Stain.). Rev Appl Ent. 1980; 68 (12): 19526.

[25] Köhler T., Dietrich C., Scheffrahn RH., Brune A. High-resolution analysis of gut environment and bacterial microbiota reveals functional compartmentation of the gut in wood-feeding higher termites (Nasutitermes spp.). Appl Environ Microbiol. 2012; 78(13): 4691-4701. [26] Wong AC., Chaston JM., Douglas AE. The inconstant gut microbiota of Drosophila species revealed by 16S rRNA gene analysis. ISME J. 2013; 7: 1922–1932. [27] Akman L., Yamashita A., Watanabe H., Oshima K., Shiba T., et al. Genome sequence of the endocellular obligate symbiont of tsetse flies, Wigglesworthia glossinidia. Nat Genet. 2002; 32: 402–407.